Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

The adult has blue-grey legs and a very long dark bill with a slight upward curve and pink at the tip. The neck, breast and belly are unbroken brick red in breeding plumage, off white in winter. The back is mottled grey.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: just inland from the coasts across northern and western Alaska (east to Sagavanirktok River), northern Scandinavia, across northern Russia and northern Siberia to Chukotski Peninsula and northern Anadyrland. NON-BREEDING: Eurasia, Africa, Indian Ocean islands, southeastern Asia, Indonesia, Australia, New Zealand (AOU 1983, Johnson and Herter 1989). MIGRATION: through Hawaiian, Aleutian, and Pribilof Islands, along Bering Sea coast of Alaska Peninsula, through Europe and Pacific (AOU 1983). Lagoons along north shore of Alaska Peninsula are important fall staging areas (see Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

accidental shore bird from Eurasia, reported in Newfoundland
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Subspecies and Distribution:


    * lapponica (Linnaeus, 1758) - Lappland W through Kola and Kanin Peninsulas to Taymyr; winters from North Sea, W Iberia and NW Africa S to W South Africa, and E to Persian Gulf and W India. * menzbieri Portenko, 1936 - N Siberia, between R Khatanga and Kolyma Delta; winters from SE Asia to NW Australia, and possibly E Australia. * baueri Naumann, 1836 - NE Siberia, E of R Kolyma, to W Alaska; winters from China to New Zealand and some Pacific Is.


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 41 cm

Weight: 376 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Bar-tailed Godwit is a relatively short-legged species of godwit. The bill-to-tail length is 37–41 cm, with a wingspan of 70–80 cm. Males average smaller than females but with much overlap; males weigh 190–400 g, while females weigh 260–630 g

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

The adult has blue-grey legs and a very long dark bill with a slight upward curve and pink at the tip. The neck, breast and belly are unbroken brick red in breeding plumage, off white in winter. The back is mottled grey.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is a full long-distance migrant (del Hoyo et al. 1996). It breeds from late-May to August (Hayman et al. 1986) in solitary pairs (del Hoyo et al. 1996), although it may also form small colonies (Flint et al. 1984). After breeding adults disperse to coastal moulting sites, the onward migration to wintering grounds then continuing into October and November (Hayman et al. 1986). The species often flies in large flocks (Hayman et al. 1986) and forages in groups outside of the breeding season (del Hoyo et al. 1996), occasionally aggregating into huge flocks of several hundreds of thousands of individuals at favoured sites (e.g. in Mauritania) (Hayman et al. 1986). Habitat Breeding The species breeds in marshy, swampy areas in lowland moss and shrub tundra (Johnsgard 1981, Flint et al. 1984, del Hoyo et al. 1996) near wet river valleys (Johnsgard 1981), lakes and sedge bogs (Flint et al. 1984), as well as on swampy heathlands in the willow and birch zone near the Arctic treeline (Johnsgard 1981), in open larch Larix spp. woodland close to water (del Hoyo et al. 1996), and occasionally on open bogs in the extreme north of the coniferous forest zone (Johnsgard 1981). Non-breeding On passage the species may frequent inland wetlands (Hayman et al. 1986), sandy beaches with pine Pinus spp. stands, swampy lowlands near lakes (Flint et al. 1984) and short-grass meadows, but during the winter it is more common in intertidal areas along muddy coastlines, estuaries, inlets, mangrove-fringed lagoons and sheltered bays (del Hoyo et al. 1996) with tidal mudflats or sandbars (Johnsgard 1981). Diet Breeding When breeding the species feeds on insects, annelid worms, molluscsand occasionally seeds and berries (del Hoyo et al. 1996). Non-breeding In intertidal areas the species's diet consists of annelids (e.g. Nereis spp. and Arenicola spp.), bivalves and crustaceans, although it will also take cranefly larvae and earthworms on grasslands and occasionally larval amphibians (tadpoles) and small fish (del Hoyo et al. 1996). Breeding site The nest is a depression positioned on a dry elevated site (del Hoyo et al. 1996) such as a tundra ridge (Johnsgard 1981) or hummock (Flint et al. 1984), often between clumps of grass (del Hoyo et al. 1996) or under a thicket (Flint et al. 1984). Management information In the UK there is evidence that the removal of Spartina anglica from tidal mudflats using a herbicide is beneficial for the species (Evans 1986).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Coastal tundra and sedge-dwarf shrub tundra of foothills; in migration and winter also marshes, flooded fields, estuarine areas and beaches (AOU 1983). Nest is a simple depression in dry upland tundra. In Europe, apparently seeks nest protection by breeding near nesting Whimbrels (NUMENIUS PHAEOPUS), which are more actively defensive against predators (Larsen and Moldsvor 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 10 specimens in 3 taxa.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.226 - 10.963
  Nitrate (umol/L): 1.402 - 6.915
  Salinity (PPS): 31.635 - 35.082
  Oxygen (ml/l): 6.327 - 6.746
  Phosphate (umol/l): 0.273 - 0.481
  Silicate (umol/l): 0.987 - 3.586

Graphical representation

Temperature range (°C): 9.226 - 10.963

Nitrate (umol/L): 1.402 - 6.915

Salinity (PPS): 31.635 - 35.082

Oxygen (ml/l): 6.327 - 6.746

Phosphate (umol/l): 0.273 - 0.481

Silicate (umol/l): 0.987 - 3.586
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

On wintering grounds, swamps, floods and irrigated paddy fields can attract flocks of birds. In India, inland pools, lakes and marshes are used, and occasionally brackish lakes, tidal creeks and estuaries.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Nesting birds from Alaska probably winter in southeastern Asia and on South Pacific islands (Johnson and Herter 1989). Adults begin fall migration before juveniles, which usually depart nesting areas shortly after mid-August.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

It forages by probing in mudflats or marshes. In short vegetation, it may pick up insects by sight. Mainly, it eats insects and crustaceans, but also parts of aquatic plants.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Limosa lapponica (Limosa lapponica bar-tailed godwit) preys on:
Nereis diversicolor

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Estimated to be 1,345,000 (range 1,200,000 - 2,200,000) by Rose and Scott (1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 31.3 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Clutch size usually 4. Incubation 20-21 days, by both sexes (female at night). Young tended by both parents or by male only (Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Bar-tailed Godwit is a non-breeding migrant in Australia. Breeding take place each year in Scandinavia, northern Asia and Alaska. The nest is a shallow cup in moss, and is either lined with vegetation or is unlined. Both sexes share incubation of the eggs and care for the young.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Organ changes enable long migration: bar-tailed godwit
 

The metabolism of the eastern bar-tailed godwit allows it to survive long-distance migration by absorbing and then rebuilding tissue from its organs.

   
  "A grotesque phenomenon known as autophagy or autocannibalism, in which an animal eats portions of its own body, can be used as an aid to migration. Intriguingly, the eastern bar-tailed godwit (Limosa lapponica baueri), a wading bird, exhibits a similar but more subtle behavior that appears to assist its long-distance migration. As revealed in 1998 by Groningen University researcher Dr. Theunis Piersma and Dr. Robert Gill from the U.S. Geological Survey, before setting out on its 6,800 mile (11,000 km) migration from Alaska to New Zealand, this bird builds up huge amounts of fat to sustain it on its flight. In order to provide itself with enough room to house all of this extra fuel, yet also keep its weight down for flying, the godwit absorbs up to 25 percent of the tissue comprising its liver, kidneys, and alimentary canal. Only when the bird completes its migration are these organs reformed in their entirety. This is the first time that partial organ absorption and subsequent reconstitution has been documented in a species of migratory bird." (Shuker 2001:71)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
  • Piersma, T.; Gill, R.E., Jr. 1998. Guts don't fly: small digestive organs in obese Bar-tailed Godwits. Auk. 115(1): 196-203.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Limosa lapponica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTATACTTAATTTTCGGCGCATGAGCCGGTATAGTCGGAACTGCCCTTAGTCTACTCATTCGTGCAGAACTAGGCCAACCAGGAACCCTTCTAGGAGACGACCAAATTTACAATGTAATCGTCACCGCCCATGCTTTCGTAATAATTTTCTTCATAGTAATGCCAATCATGATCGGCGGATTTGGAAACTGACTAGTCCCACTCATAATCGGCGCCCCCGATATGGCATTCCCACGCATAAACAACATGAGCTTTTGACTGCTTCCCCCATCATTCCTACTATTATTGGCCTCATCTACAGTAGAAGCTGGAGCAGGGACAGGATGAACAGTTTATCCTCCTCTCGCTGGTAACCTTGCCCACGCTGGAGCCTCAGTAGACCTGGCCATCTTCTCTCTTCACCTAGCAGGTGTCTCCTCCATCCTAGGTGCTATTAACTTCATCACAACAGCCATTAACATAAAACCCCCAGCTCTTTCCCAATATCAAACCCCCCTGTTCGTATGATCAGTACTCATCACCGCTGTTCTACTACTGCTCTCCCTCCCAGTTCTCGCTGCTGGCATTACCATACTACTAACAGATCGAAACCTAAACACTACATTCTTCGATCCCGCTGGGGGAGGAGATCCAGTTCTATATCAACACCTTTTCTGATTCTTTGGACACCCAGAAGTCTATATCCTAATCCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Limosa lapponica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Fairly large range, numerous within range, no significant threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.1,100,000-1,200,000 individuals (Wetlands International 2006), while national population estimates include: < c.10,000 individuals on migration and c.50-1,000 wintering individuals in China; c.50-1,000 individuals on migration and c.50-1,000 wintering individuals in Taiwan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species is threatened by the degradation of foraging sites due to land reclamation, pollution, human disturbance (del Hoyo et al. 1996, Kelin and Qiang 2006), reduced river flows (Kelin and Qiang 2006) and in some areas the invasion of mudflats and coastal saltmarshes by mangroves (owing to sea-level rise and increased sedimentation and nutrient loads at the coast from uncontrolled development and soil erosion in upstream catchment areas) (Straw and Saintilan 2006). The species is also susceptible to avian influenza so may be threatened by future outbreaks of the virus (Melville and Shortridge 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bar-tailed godwit

Adult bar-tailed godwits in a meadow. Texel, Netherlands (2007)

The bar-tailed godwit (Limosa lapponica) is a large wader in the family Scolopacidae, which breeds on Arctic coasts and tundra mainly in the Old World, and winters on coasts in temperate and tropical regions of the Old World and of Autralia and New Zealand.[2] Its migration is the longest known non-stop flight of any bird and also the longest journey without pausing to feed by any animal.[3]

Description[edit]

non breeding plumage
Cairns, Australia

The bar-tailed godwit is a relatively short-legged species of godwit. The bill-to-tail length is 37–41 cm (15–16 in), with a wingspan of 70–80 cm (28–31 in). Males average smaller than females but with much overlap; males weigh 190–400 g, while females weigh 260–630 g; there is also some regional variation in size (see subspecies, below). The adult has blue-grey legs and a very long dark bill with a slight upward curve and pink at the tip. The neck, breast and belly are unbroken brick red in breeding plumage, off white in winter. The back is mottled grey.[2][4]

It is distinguished from the black-tailed godwit (Limosa limosa) by its barred, rather than wholly black, tail and a lack of white wing bars. The most similar species is the Asiatic Dowitcher.


There are three subspecies, listed from west to east:[2][4]

Diet[edit]

It forages by probing in mudflats or marshes. It may find insects by sight in short vegetation. It eats mainly insects and crustaceans, but also parts of aquatic plants.

Breeding[edit]

An egg of Limosa lapponica. Held in the collection of MHNT.
A flock landing in Tasmania, Australia. Note the barring on the tail

The bar-tailed godwit is a non-breeding migrant in Australia. Breeding take place each year in Scandinavia, northern Asia, and Alaska. The nest is a shallow cup in moss sometimes lined with vegetation. Both sexes share incubation of the eggs and care for the young.

Migrations[edit]

The routes of satellite tagged bar-tailed godwits migrating north from New Zealand to Korea and China

The bar-tailed godwit migrates in flocks to coastal East Asia, Alaska, Australia, Africa, northwestern Europe and New Zealand, where the sub-species Limosa lapponica baueri is called Kūaka in Māori.[5][6][7]

It was shown in 2007 to undertake the longest non-stop flight of any bird. Birds in New Zealand were tagged and tracked by satellite to the Yellow Sea in China. According to Dr. Clive Minton (Australasian Wader Studies Group) "The distance between these two locations is 9,575 kilometres (5,950 mi), but the actual track flown by the bird was 11,026 kilometres (6,851 mi). This was the longest known non-stop flight of any bird. The flight took approximately nine days. At least three other bar-tailed godwits also appear to have reached the Yellow Sea after non-stop flights from New Zealand."[8]

One specific female of the flock, nicknamed "E7", flew onward from China to Alaska and stayed there for the breeding season. Then on 29 August 2007 she departed on a non-stop flight from the Avinof Peninsula in western Alaska to the Piako River near Thames New Zealand, setting a new known flight record of 11,680 kilometres (7,258 mi).[3] Stray birds from Europe and Asia occasionally appear on both North American coasts.[citation needed]

This is merely anecdotal, but according to Neal, President and owner of Aitutaki Scuba, Aitutaki, Cook Islands, two flocks of godwits migrate yearly from Siberia; one landing, breeding and nesting in Aitutaki, the other on the nearby island of Manuae. They leave Siberia before the northern winter and then return to Siberia for its summer. They reportedly fly non-stop coming and going, and those who are hatched on Manuae always return only there, whilst those hatched on Aitutaki always return to that island.

Protection[edit]

The bar-tailed godwit is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

References[edit]

  1. ^ BirdLife International (2012). "Limosa lapponica". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c del Hoyo, J., Elliott, A., & Sargatal, J., eds. (1996). Handbook of the Birds of the World Vol. 3. Lynx Edicions, Barcelona ISBN 84-87334-15-6.
  3. ^ a b Gill RE, Tibbitts TL, Douglas DC, Handel CM, Mulcahy DM, Gottschalck JC, Warnock N, McCaffery BJ, Battley PF, Piersma T. (2009). "Extreme endurance flights by landbirds crossing the Pacific Ocean: ecological corridor rather than barrier?". Proc Biol Sci. 276 (1656): 447–57. doi:10.1098/rspb.2008.1142. 
  4. ^ a b Snow, D. W.; Perrins, C. M. (1998). The Birds of the Western Palearctic (Concise ed.). OUP. ISBN 0-19-854099-X. 
  5. ^ Heather, Barrie; Robertson, Hugh (2005). The Field Guide to the Birds of New Zealand (Revised ed.). Viking. ISBN 0-14-302040-4. 
  6. ^ New Zealand Birding Network Brings You The Best Of New Zealand Birding
  7. ^ Stap, Don. "The Flight of the Kuaka." Living Bird. Autumn, 2009
  8. ^ Shorebird Migration

Further reading[edit]

Identification[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!