Overview

Brief Summary

Biology

The buff-breasted sandpiper is the only North American shorebird that courts using a lek mating system. Males gather on display grounds, where they attempt to attract visiting females by lifting a wing to expose the bright white plumage of the underwing. If more than one female is present, the males spread both wings, angle their bills in the air, shake their bodies up and down and utter several short calls. Females then approach the male they wish to mate with; successful males may mate with more than one female. The female builds a nest on the ground and lines it with grass. Three to four eggs are laid and incubated by the female for three weeks. Remarkably, the chicks leave the nest less than 12 hours after hatching in order to feed themselves (6). Buff-breasted sandpipers feed on earthworms, aquatic insects and larvae, and seeds (7). They forage in small flocks of up to 15 birds, walking in a crouched position and lifting the legs high with each step. They move quickly, frequently changing direction and bobbing the head like a pigeon. During the non-breeding season, they are fairly unafraid and can be approached (2). They migrate bi-annually from various breeding grounds to favoured wintering grounds in autumn, and back to the breeding grounds in spring (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This small, attractive bird has a long, straight bill and greenish-yellow legs (7). The sexes are alike in colouration; both have a pale brown body elegantly spotted with black. The crown has fine streaks of black which extend down the hind neck and over the back to the tail, giving the appearance of overlapping black scales on the upperparts. The sides of the head and body are paler brown with less conspicuous black markings, fading to cream on the throat and breast. Juveniles are slightly paler overall (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Breeds Arctic North America; winters in s South America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Tryngites subruficollis breeds sporadically along arctic coasts from central Alaska, USA to Devon Island, Canada, with a relict population on Wrangel Island and west Chukotka, Russia. Also reported from St Pierre and Miquelon (to France) as a non-breeder. Birds winter in eastern South America including Argentina, Uruguay, Paraguay and Bolivia after passing through the Greater and Lesser Antilles or around the Gulf coast of Central America. Originally numbering in the hundreds of thousands to millions (1890s-1900s), the species was brought to near extinction in the early 1920s by hunting. It has not recovered, with the current population estimated at 16,000-84,000 individuals based on various estimates from birds passing through the Rainwater Basin in Nebraska and the Gulf coastal plain in Louisiana and Texas5. It is difficult to monitor, as it is not faithful to breeding sites (and possibly not to wintering sites), but data from North American migration sites suggests that declines are continuing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range encompasses the low and high acrtic in eastern Russia, northern Alaska, northern Yukon, northwestern Mackenzie, and the region fromBanks, Melville, Bathurst, and Devon islands south to southern Victoria, Jenny Lind, and King William islands; the bulk of the breeding population appears to occupy coastal portions of the Yukon and Northwest Territories and most of the Queen Elizabeth Islands (Lanctot and Laredo 1994). During the nonbreeding season, this species occurs in South America (Brazil, Uruguay, and Argentina). Due to destruction of native grasslands by agriculture, most winter in coastal portions of the Río de La Plata grasslands where livestock grazing maintains suitable habitat. Migration in the United States is mainly through the central plains; juveniles are more common along the east coast in fall migration, rare along the west coast during southward migration.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Breeding along the Arctic coasts from central Alaska to Devon Island, Canada, as well as on Wrangel Island and west Chukotka, Russia, the buff-breasted sandpiper migrates through the Greater and Lesser Antilles of the Caribbean to winter in eastern South America (8). It is occasionally recorded in the Afro-tropics (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 21 cm

Weight: 71 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Tryngites subruficollis
Catalog Number: USNM A6694
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: unknown; Adult
Preparation: Skin: Whole
Collector(s): J. Parke
Locality: San Antonio, Prairie Near, Bexar, Texas, United States, North America
  • Type: Heermann. (Not Earlier Than October 31) 1854. Proc. Acad. Nat. Sci. Philadelphia. 7: 178.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It breeds in the high Arctic on well drained tundra with tussocks and scant vegetation. It is generally not near the sea and avoids marshes. It appears to depend heavily upon intensive grazing by livestock in its wintering grounds to creat short grassland4, but also uses flooded Pampas grasslands. During migration it is found on many short grass habitats. It is a lekking species.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Breeding: Dry slopes with numerous sedge tussocks, on grass tundra with mosses and willows, in moist or wet sedge-grass meadows, in well-drained sandy areas with scant vegetation, and on well-vegetated hummocky ground bordering marshy ponds (Johnsgard 1981, Cramp and Simmons 1983, Godfrey 1986, Johnson and Herter 1989, Lanctot 1995). Prefers raised and grassy terrain, although the nature of the tundra often involves proximity to moist or wet ground (Cramp and Simmons 1983). Overall, avoids marshy areas (Johnsgard 1981).

During incubation breaks, females occur along stream banks with scant vegetation (Lanctot 1995). Females with broods occur primarily in moist and emergent vegetation along wetlands and stream beds (Lanctot 1995).

Landforms at leks are dominated by non-patterned ground, with reticulate-patterned ground, polygons, strangmoor, and frost-boils less commonly used (Lanctot and Slater 1992). Vegetation at leks is dominated by moist, graminoid (Carex aquatilis and Eriophorum angustifolium) and wet, graminoid meadows (Lanctot and Slater 1992). A third of all leks occur at traditional sites along bends and junctions of rivers (Lanctot 1995).

Non-breeding: Southern temperate zone on predominantly dry to moist open ground, short grass uplands (grass height < 3 cm). Individuals have also been observed in open mudflats or muddy shores near lakes and channels, abandoned and newly planted rice fields, and on burnt stubble after cutting sugar cane (Myers and Myers 1979, Cramp and Simmons 1983, Paulson 1993, Lanctot et al. 2001). Also utilize dry riverine sandbars, rain pools in pastures, golf courses, and airfields (Cramp and Simmons 1983).

Migration: Frequents short grass plains and dry uplands (Johnsgard 1981). Have been observed in man-altered habitats such as sod fields, airport runways, golf courses, cemeteries, burnt-over grasslands, cotton fields, recently ploughed fields, newly planted rice fields, flat, hard, sun-baked stubble, and barren recently inundated land (Cramp and Simmons 1983, Lanctot, unpubl. data). Edges of ponds are used for wading, drinking, and bathing, but not feeding (Cramp and Simmons 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

During the breeding season, the buff-breasted sandpiper is found on dry, sloping tundra, or in tundra regions with both wet and dry areas. Whilst on migration this sandpiper stops in dry grasslands, earning it the nickname 'grasspiper'. Throughout the winter it is found mainly on Argentina's pampas grasslands (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northward migration begins in early February to mid-March (Palmer 1967, Myers and Myers 1979). Migration via central Amazonia/Pantanal flyway, over Brazil, Venezuela, Guyana, and Surinam (Haverschmidt 1972, Lanctot and Laredo 1994), across the Gulf of Mexico, and arriving in coastal Texas and Louisiana between mid-March and early April (Lanctot and Laredo 1994, Lanctot 1995). Passes through US in May, arrives in breeding areas late May - early June (Palmer 1967, Johnson and Herter 1989).

Southward migration begins from mid-June to early July; most depart breeding areas by end of August, but females with broods may remain in the Arctic as late as early September; rare in fall on Pacific islands; arrives in northern South America between August and October; most arrive in Argentina in mid-September, many depart in late January, a few still present in March (Hayman et al. 1986).

This sandpiper migrates as singles, pairs, or occasional small flocks. It may concentrate at particular staging areas. Variation of habitat use may coincide with changes in local food abundance or other conditions. Adults and juveniles may use different migration routes (Lanctot and Laredo 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Feed primarily on insects (adults, larvae, and pupae) (Bent 1929, Palmer 1967). Also eat spiders, mollusk species, and seeds of aquatic plants (Bent 1929). On breeding grounds, foods consist of terrestrial invertebrates, especially the adults and larvae of beetles and the larvae and pupae of dipterans (Johnsgard 1981). Diets differ from other arctic shorebirds because this species tends to occupy upland habitats (Lanctot and Laredo 1994). As a result, diets are highly dependent on insect larvae and adults, feeding less on Chironomidae larvae and other wetland invertebrates (Lanctot and Laredo 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 - 100,000 individuals

Comments: Morrison et al. (2001) estimated about 15,000 individuals in total, perhaps as many as 20,000. An estimated 2,000 adults on Banks Island (Manning et al. 1956, cited by Lanctot and Laredo 1994). Breeding adults did not exceed "several tens of nesting birds" on Wrangel Island (Dorogoi 1983, cited by Lanctot and Laredo 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Gregarious. Nonbreeding: roosts at night in flocks often of about 600-1000; often seen in mixed flocks in association with golden and upland sandpipers, or Baird's or pectoral sandpipers (Stiles and Skutch 1989). Many defend small feeding territories in winter, but they roost in monospecific flocks (Hayman et al. 1986).

Breeding densities are low and can vary dramatically from year to year; in Alaska, densities were 0.5-14.0 individuals per sq km from 1981 to 1989 (see Lanctot 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Flies at night during migration.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males and females arrive simultaneously on the arctic breeding grounds late May through early June (Lanctot and Laredo 1994). Lek breeding system (Sutton 1967, Johnson and Herter 1989, Lanctot and Laredo 1994, Lanctot and Weatherhead 1997). Leks change location from year to year. Within 2 to 11 days of arrival, males begin to display together on leks. Approximately 2 to 20 males occur together in a lek, although some males may display in solitary locations (Lanctot and Weatherhead 1997). Females visit leks only for copulation (Sutton 1967). Males and females do not pair (Johnson and Herter 1989). Males may mate with several females but take no part in incubation, leaving the breeding grounds in mid-June to early July (Parmelee et al. 1967, Sutton 1967, Lanctot and Laredo 1994). Females lay a single clutch per year (Lanctot and Laredo 1994), normally consisting of 4 eggs (Harrison 1978, Johnsgard 1981, Godfrey 1986). Incubation lasts 22-25 days (Troy 1988 in Johnson and Herter 1989, Lanctot and Laredo 1994). Peak hatching during second and third week of July, although hatching has been documented as early as July 5, 1992 and July 4, 1993 (Lanctot and Laredo 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tryngites subruficollis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTAATCTTCGGTGCATGAGCTGGTATAGTCGGAACTGCCCTTAGCTTGCTCATTCGTGCAGAACTAGGTCAACCCGGAACCCTTCTAGGAGATGACCAGATCTATAATGTTATTGTCACTGCCCACGCCTTTGTAATAATCTTCTTCATAGTAATGCCAATCATAATTGGCGGCTTCGGAAACTGACTAGTCCCACTTATAATCGGTGCCCCTGACATGGCATTCCCTCGTATAAACAACATAAGCTTCTGACTACTACCTCCATCATTCCTACTACTGCTAGCATCATCTACAGTAGAAGCTGGAGCAGGAACAGGATGAACAGTATACCCCCCACTTGCTGGCAACCTGGCCCATGCTGGAGCTTCTGTAGACCTAGCTATCTTCTCTCTTCACCTAGCAGGTGTATCTTCTATTCTAGGTGCCATCAACTTCATTACAACTGCCATCAACATAAAACCTCCAGCTCTCTCCCAATACCAAACACCCCTGTTCGTATGATCAGTACTTATCACTGCCGTCCTACTCCTACTCTCTCTTCCAGTTCTTGCTGCTGGCATTACTATACTACTAACAGACCGAAACCTGAACACTACATTCTTTGACCCCGCTGGGGGAGGAGACCCAGTCCTATACCAACACCTCTTCTGATTCTTCGGCCATCCAGAAGTTTACATCCTAATTCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tryngites subruficollis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s
Casañas, H., Harrington, B., Lanctot, R., Russell, B.

Justification
This species underwent rapid historical declines. Its moderately small remaining population continues to decline and as a result it is considered Near-Threatened.

History
  • 2006
    Near Threatened
  • 2004
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B - Apparently Secure

United States

Rounded National Status Rank: N4B - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Highly restricted range in far northern North America; population has increased somewhat since large numbers were killed in the late 1800s and early 1900s by commercial hunters; current total population size (approximately 15,000 birds worldwide) is relatively small and may be declining; large segments of population are localized at vulnerable locations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The buff-breasted sandpiper is classified as Near Threatened (NT) on the IUCN Red List 2004 (1) and is listed on Appendix II of the Convention on Migratory Species (CMS or Bonn Convention) (3). It is also listed on Appendix II of the Berne Convention on the Conservation of European Wildlife and Natural Habitats (4) and the United States Fish and Wildlife Service's Birds of Conservation Concern (5). It is a 'Species of High Conservation Concern' on the United States Shorebird Conservation Plan (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Morrison et al. (in press).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Morrison (1993/1994) categorized the population trend in Canada as "decreasing?". Lanctot and Laredo (1994) noted that recent surveys in the migration corridor also suggest that the population is declining. On the wintering grounds, density estimates at Estancia Medaland, Argentina declined from 8-15 birds/ha in 1973 to 0.25-2.7 birds/ha in 1992 (Lanctot and Laredo 1994). It is possible, however, that this decline is the result of birds changing wintering areas. Lanctot (pers. comm.) estimated that the decline over the past 30 years to be on the order of 20-40%, but cautions that there are few data to substantiate this estimate.

Global Long Term Trend: Decline of >90%

Comments: Originally numbered in the hundreds of thousands to millions (Gotthardt and Lanctot 2002, citing Forbush 1912 and Hudson 1920); now only 15,000-20,000 remain (Morrison et al. 2001). A conservative estimate of the decline would be 200,000 to 20,000, or 90 per cent.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
It was severely overhunted in the early part of the 1900s reportedly declining to near extinction from a population which may have number in the millions. Immediate threats are the matter of some conjecture. The breeding grounds may be affected by habitat loss and degradation and environmental contaminants3. Previously, ongoing declines were attributed to widespread and continuing destruction of grasslands in the wintering range1,2, but there seems little evidence to support this, although environmental contaminants may be playing a part there3. Exposure on migration ot toxic chemicals and pollutants may pose a threat and is being investigated further6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Numbers declined in late 1800s due to market hunting. Lanctot (pers. comm.) believes major threats lie along migratory routes. Habitat along migratory route in the central United States and on wintering grounds has been lost, and continues to be lost, to agricultural development or overgrazing (Lanctot and Laredo 1994). Agriculture-associated pesticides are a potential threat there as well. No direct threats to habitat are apparent on the breeding ground at this time, but potential negative effects from oil and other development exist. Small mammals (e.g., arctic fox [Alopex lagopus], red fox [Vulpes vulpes]), owls, and corvids are potential predators during nesting and brooding. Predation accounted for 50-65 percent of nest loss in northern Alaska in 1992 and 1993 (Lanctot and Laredo 1994). Predation near developed sites in the Arctic may be abnormally high due to an increased number of predators that result from human-augmented food resources. Various raptors take adults or juveniles on breeding or wintering grounds. See Lanctot and Laredo (1994). Human disturbance to nests has led to abandonment and increased predation (Lanctot and Laredo 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

At the end of the 19th century the buff-breasted sandpiper numbered in the hundreds of thousands to perhaps millions, but was brought to the brink of extinction in the early 1920s by hunting. Although the population has now increased, it still stands at just 5,000 – 15,000 individuals. It is notoriously difficult to assess numbers of this species since it is faithful to neither the breeding grounds nor the wintering grounds, but it is thought to be in decline. The modern threats are not understood but it has been suggested that habitat change at the breeding sites has prevented adequate reproductive rates. It appears to rely on intensive grazing by livestock, but previously grazed pampas is being converted to agricultural land. It may also be susceptible to the agricultural pesticides used in the regions passed through on migration (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
CMS Appendix I and II. A symposium was held in 2005-2006 to identify priority actions for the conservation of the species.

Conservation Actions Proposed
Implement priority actions identified at the Buff-breasted Sandpiper symposium. Ascertain the population size and trend for the species. Complete a species action plan. Conserve key staging and wintering grasslands.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: May be impacted on breeding grounds by exploration and development of oil and natural gas resources. Pre-development surveys of upland habitats should be conducted to prevent construction of resource facilities in areas with large numbers of birds and associated preferred habitats co-exist (e.g., lek locations; Lanctot 1995).

Additional information is needed to determine relative importance of wintering sites in Brazil and Uruguay, including basic wintering ecology information to include data on site tenacity within and between years, seasonal abundances and changes in bird numbers, movement of birds among sites, and effects of different management regimes on bird use of the areas.

On the migration route, research is needed to determine if important regional stopover sites exist, and if so, whether they can be protected and included in the WHSRN (Lanctot et al. in press). Additional research is also needed at specific migration stopover sites in the United States and Canada identified either historically or through the USFWS' Shorebird Sister Schools Program (SSSP) to be important. Efforts should be made to document the timing and duration of migration, site tenacity within and between years by individual birds, and potential for pesticide and herbicide exposure. Birds should be collected or sampled in various man-altered habitats to document current levels of contaminants in their bodies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few (1-3) occurrences appropriately protected and managed

Comments: Listed as Category 3 of the Red Book of the Russian Republic, and it has been recommended for listing as endangered in the U.S.S.R. Red Book (Dorogoi 1983 in Lanctot and Laredo 1994). Also protected by State Nature Preserve on Wrangel Island (Kondratev 1989 in Lanctot and Laredo 1994). Receives minimal protection in breeding area zone that is within the Arctic National Wildlife Refuge. Listed as vulnerable on the official threatened list in Rio Grande do Sul state, Brazil, where species' primary wintering habitat occurs.

Needs: A coordinated system of preserves that protect breeding, migration, and wintering habitat is needed. Protection of upland habitat is especially important (Lanctot 1995). In the winter habitat, compatible pesticide application schedules and livestock grazing patterns need to be enacted (Lanctot 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation action for the buff-breasted sandpiper is in the early stages, with work being done to preserve grassland habitats. More survey work to determine the range and distribution of this species is planned, but it is known to be present in the Western Hemisphere Shorebird Reserve Network (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Buff-breasted Sandpiper

The Buff-breasted Sandpiper, Tryngites subruficollis, is a small shorebird. It is a calidrid sandpiper and currently considered to be the only member of the genus Tryngites. Indeed, it probably belongs in the genus Calidris itself, or more precisely with the small species thereof which should be split into a distinct genus (Thomas et al., 2004). Depending on whether this would include the Curlew Sandpiper or not, the name Erolia would or would not, respectively, apply.

Contents

Description

This species is brown above, and has a buff face and underparts in all plumages. It has a short bill and yellow legs. Males are larger than females. Juveniles resemble the adults, but may be paler on the rear underparts.

Distribution and habitat

T. subruficollis breeds in the open arctic tundra of North America and is a very long-distance migrant, spending the non-breeding season mainly in South America, especially Argentina.

It migrates mainly through central North America, and is uncommon on the coasts. It occurs as a regular wanderer to western Europe, and is not classed as rare in Great Britain or Ireland, where small flocks have occurred. Only the Pectoral Sandpiper is a more common American shorebird visitor to Europe.

This species nests on the ground, laying four eggs. The male has a display which includes raising the wings to display the white undersides, which is also given on migration, sometimes when no other Buff-breasted Sandpipers are present. Outside the breeding season, this bird is normally found on short-grass habitats such as airfields or golf-courses, rather than near water.

These birds pick up food by sight, mainly eating insects and other invertebrates. They are often very tame.

Buff-breasted Sandpipers are suspected to have hybridized with the White-rumped or Baird's Sandpiper.

Distribution in South Asia and Australia

This species has been sighted in South Asia on at least three occasions. It is believed that instead of going to Argentina, this bird might have been wind-blown from the Great Plains Flyway of North America and landed up in South Asia. In 2011, November this species was sighted near Kannur, Kerala in South India.[2] The Buff-breasted Sandpiper has also been recorded from Australia on at least eight occasions.[3]

References

  1. ^ BirdLife International (2012). "Tryngites subruficollis". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ http://www.migrantwatch.in/blog/2011/11/26/north-american-sandpiper-in-kerala/
  3. ^ http://www.tonypalliser.com/barc/vol1.htm
  • Hayman, Peter; Marchant, John & Prater, Tony (1986): Shorebirds: an identification guide to the waders of the world. Houghton Mifflin, Boston. ISBN 0-395-60237-8
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Kessel (1989) suggested that a western population of T. subruficollis breeds in western Chukotka (Russia) and migrates along the coast of the Pacific Ocean (in contrast to the interior of North America), but no banding, morphometric, or genetic studies have been conducted to define the differences between western and eastern populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!