Overview

Brief Summary

Biology

The buff-breasted sandpiper is the only North American shorebird that courts using a lek mating system. Males gather on display grounds, where they attempt to attract visiting females by lifting a wing to expose the bright white plumage of the underwing. If more than one female is present, the males spread both wings, angle their bills in the air, shake their bodies up and down and utter several short calls. Females then approach the male they wish to mate with; successful males may mate with more than one female. The female builds a nest on the ground and lines it with grass. Three to four eggs are laid and incubated by the female for three weeks. Remarkably, the chicks leave the nest less than 12 hours after hatching in order to feed themselves (6). Buff-breasted sandpipers feed on earthworms, aquatic insects and larvae, and seeds (7). They forage in small flocks of up to 15 birds, walking in a crouched position and lifting the legs high with each step. They move quickly, frequently changing direction and bobbing the head like a pigeon. During the non-breeding season, they are fairly unafraid and can be approached (2). They migrate bi-annually from various breeding grounds to favoured wintering grounds in autumn, and back to the breeding grounds in spring (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This small, attractive bird has a long, straight bill and greenish-yellow legs (7). The sexes are alike in colouration; both have a pale brown body elegantly spotted with black. The crown has fine streaks of black which extend down the hind neck and over the back to the tail, giving the appearance of overlapping black scales on the upperparts. The sides of the head and body are paler brown with less conspicuous black markings, fading to cream on the throat and breast. Juveniles are slightly paler overall (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Tryngites subruficollis breeds sporadically along Arctic coasts from central Alaska, U.S.A., to Devon Island, Canada, with a relict population on Wrangel Island and west Chukotka, Russia. It has also been reported from St Pierre and Miquelon (to France) as a non-breeder. Birds winter in eastern South America including Argentina, Uruguay, Paraguay and Bolivia after passing through the Greater and Lesser Antilles or around the Gulf coast of Central America. Originally numbering in the hundreds of thousands to millions (1890s-1900s), the species was brought to near extinction in the early 1920s by hunting. It has not recovered, with the current population estimated at 16,000-84,000 individuals based on various estimates from birds passing through the Rainwater Basin in Nebraska and the Gulf coastal plain in Louisiana and Texas (Morrison et al. 2006). It is difficult to monitor, as it is not faithful to breeding sites (and possibly not to wintering sites), but data from North American migration sites suggest that declines are continuing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeds Arctic North America; winters in s South America.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeding along the Arctic coasts from central Alaska to Devon Island, Canada, as well as on Wrangel Island and west Chukotka, Russia, the buff-breasted sandpiper migrates through the Greater and Lesser Antilles of the Caribbean to winter in eastern South America (8). It is occasionally recorded in the Afro-tropics (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Type for Tryngites subruficollis
Catalog Number: USNM A6694
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: unknown; Adult
Preparation: Skin: Whole
Collector(s): J. Parke
Locality: San Antonio, Prairie Near, Bexar, Texas, United States, North America
  • Type: Heermann. (Not Earlier Than October 31) 1854. Proc. Acad. Nat. Sci. Philadelphia. 7: 178.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It breeds in the high Arctic on well drained tundra with tussocks and scant vegetation. It is generally not found near the sea and avoids marshes. It appears to depend heavily upon intensive grazing by livestock in its wintering grounds to create short grassland (Lanctot et al. 2002), but also uses flooded pampas grasslands. During migration it is found on many short grass habitats. At the internationally important Rainwater Basin stopover site in Nebraska, U.S.A., it was observed to feed primarily in agricultural grassland, and use wetlands for resting (McCarty et al. 2009). It is a lekking species.


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During the breeding season, the buff-breasted sandpiper is found on dry, sloping tundra, or in tundra regions with both wet and dry areas. Whilst on migration this sandpiper stops in dry grasslands, earning it the nickname 'grasspiper'. Throughout the winter it is found mainly on Argentina's pampas grasslands (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tryngites subruficollis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTAATCTTCGGTGCATGAGCTGGTATAGTCGGAACTGCCCTTAGCTTGCTCATTCGTGCAGAACTAGGTCAACCCGGAACCCTTCTAGGAGATGACCAGATCTATAATGTTATTGTCACTGCCCACGCCTTTGTAATAATCTTCTTCATAGTAATGCCAATCATAATTGGCGGCTTCGGAAACTGACTAGTCCCACTTATAATCGGTGCCCCTGACATGGCATTCCCTCGTATAAACAACATAAGCTTCTGACTACTACCTCCATCATTCCTACTACTGCTAGCATCATCTACAGTAGAAGCTGGAGCAGGAACAGGATGAACAGTATACCCCCCACTTGCTGGCAACCTGGCCCATGCTGGAGCTTCTGTAGACCTAGCTATCTTCTCTCTTCACCTAGCAGGTGTATCTTCTATTCTAGGTGCCATCAACTTCATTACAACTGCCATCAACATAAAACCTCCAGCTCTCTCCCAATACCAAACACCCCTGTTCGTATGATCAGTACTTATCACTGCCGTCCTACTCCTACTCTCTCTTCCAGTTCTTGCTGCTGGCATTACTATACTACTAACAGACCGAAACCTGAACACTACATTCTTTGACCCCGCTGGGGGAGGAGACCCAGTCCTATACCAACACCTCTTCTGATTCTTCGGCCATCCAGAAGTTTACATCCTAATTCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tryngites subruficollis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Casañas, H., Harrington, B., Lanctot, R. & Russell, B.

Justification
This species underwent rapid historical declines. Its moderately small remaining population continues to decline and as a result it is considered Near-Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

The buff-breasted sandpiper is classified as Near Threatened (NT) on the IUCN Red List 2004 (1) and is listed on Appendix II of the Convention on Migratory Species (CMS or Bonn Convention) (3). It is also listed on Appendix II of the Berne Convention on the Conservation of European Wildlife and Natural Habitats (4) and the United States Fish and Wildlife Service's Birds of Conservation Concern (5). It is a 'Species of High Conservation Concern' on the United States Shorebird Conservation Plan (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.16,000-84,000 individuals (Morrison et al. 2006).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It was severely overhunted in the early part of the 1900s, reportedly declining to near extinction from a population which may have numbered in the millions. Immediate threats are the matter of some conjecture. The breeding grounds may be affected by habitat loss and degradation, and environmental contaminants (R. Lanctot in litt. 2003). Previously, on-going declines were attributed to widespread and continuing destruction of grasslands in the wintering range (Lanctot and Laredo 1994, Lanctot 1995), but there seems little evidence to support this, although environmental contaminants may be playing a part there (R. Lanctot in litt. 2003). Exposure on migration to toxic chemicals and pollutants in its agricultural feeding grounds may pose a threat, and is being investigated further (Lanctot 2006, McCarty et al. 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

At the end of the 19th century the buff-breasted sandpiper numbered in the hundreds of thousands to perhaps millions, but was brought to the brink of extinction in the early 1920s by hunting. Although the population has now increased, it still stands at just 5,000 – 15,000 individuals. It is notoriously difficult to assess numbers of this species since it is faithful to neither the breeding grounds nor the wintering grounds, but it is thought to be in decline. The modern threats are not understood but it has been suggested that habitat change at the breeding sites has prevented adequate reproductive rates. It appears to rely on intensive grazing by livestock, but previously grazed pampas is being converted to agricultural land. It may also be susceptible to the agricultural pesticides used in the regions passed through on migration (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
CMS Appendix I and II. A symposium was held in 2005-2006 to identify priority actions for the conservation of the species.

Conservation Actions Proposed
Implement priority actions identified at the Buff-breasted Sandpiper symposium. Ascertain the population size and trend for the species. Complete a species action plan. Conserve key staging and wintering grasslands. Investigate the quality of foraging habitat and the influence of contaminants at the agricultural feeding grounds used on migration (McCarty et al. 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation action for the buff-breasted sandpiper is in the early stages, with work being done to preserve grassland habitats. More survey work to determine the range and distribution of this species is planned, but it is known to be present in the Western Hemisphere Shorebird Reserve Network (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Buff-breasted sandpiper

The buff-breasted sandpiper, Tryngites subruficollis, is a small shorebird. It is a calidrid sandpiper and currently considered to be the only member of the genus Tryngites. Indeed, it probably belongs in the genus Calidris itself, or more precisely with the small species thereof which should be split into a distinct genus (Thomas et al., 2004). Depending on whether this would include the curlew sandpiper or not, the name Erolia would or would not, respectively, apply.

Description[edit]

This species is brown above, and has a buff face and underparts in all plumages. It has a short bill and yellow legs. Males are larger than females. Juveniles resemble the adults, but may be paler on the rear underparts.

Distribution and habitat[edit]

T. subruficollis breeds in the open arctic tundra of North America and is a very long-distance migrant, spending the non-breeding season mainly in South America, especially Argentina.

It migrates mainly through central North America, and is uncommon on the coasts. It occurs as a regular wanderer to western Europe, and is not classed as rare in Great Britain or Ireland, where small flocks have occurred. Only the pectoral sandpiper is a more common American shorebird visitor to Europe.

This species nests on the ground, laying four eggs. The male has a display which includes raising the wings to display the white undersides, which is also given on migration, sometimes when no other buff-breasted sandpipers are present. Outside the breeding season, this bird is normally found on short-grass habitats such as airfields or golf-courses, rather than near water.

These birds pick up food by sight, mainly eating insects and other invertebrates. They are often very tame.

Buff-breasted sandpipers are suspected to have hybridized with the white-rumped or Baird's sandpiper.

Distribution in South Asia and Australia[edit]

This species has been sighted in South Asia on at least three occasions. It is believed that instead of going to Argentina, this bird might have been wind-blown from the Great Plains Flyway of North America and landed up in South Asia. In 2011, November this species was sighted near Kannur, Kerala in South India.[2] The buff-breasted sandpiper has also been recorded from Australia on at least eight occasions.[3]

References[edit]

  1. ^ BirdLife International (2012). "Tryngites subruficollis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ http://www.migrantwatch.in/blog/2011/11/26/north-american-sandpiper-in-kerala/
  3. ^ http://www.tonypalliser.com/barc/vol1.htm
  • Hayman, Peter; Marchant, John & Prater, Tony (1986): Shorebirds: an identification guide to the waders of the world. Houghton Mifflin, Boston. ISBN 0-395-60237-8
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!