Overview

Brief Summary

Biology

The buff-breasted sandpiper is the only North American shorebird that courts using a lek mating system. Males gather on display grounds, where they attempt to attract visiting females by lifting a wing to expose the bright white plumage of the underwing. If more than one female is present, the males spread both wings, angle their bills in the air, shake their bodies up and down and utter several short calls. Females then approach the male they wish to mate with; successful males may mate with more than one female. The female builds a nest on the ground and lines it with grass. Three to four eggs are laid and incubated by the female for three weeks. Remarkably, the chicks leave the nest less than 12 hours after hatching in order to feed themselves (6). Buff-breasted sandpipers feed on earthworms, aquatic insects and larvae, and seeds (7). They forage in small flocks of up to 15 birds, walking in a crouched position and lifting the legs high with each step. They move quickly, frequently changing direction and bobbing the head like a pigeon. During the non-breeding season, they are fairly unafraid and can be approached (2). They migrate bi-annually from various breeding grounds to favoured wintering grounds in autumn, and back to the breeding grounds in spring (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This small, attractive bird has a long, straight bill and greenish-yellow legs (7). The sexes are alike in colouration; both have a pale brown body elegantly spotted with black. The crown has fine streaks of black which extend down the hind neck and over the back to the tail, giving the appearance of overlapping black scales on the upperparts. The sides of the head and body are paler brown with less conspicuous black markings, fading to cream on the throat and breast. Juveniles are slightly paler overall (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Calidrissubruficollis breeds sporadically along Arctic coasts from central Alaska, U.S.A., to Devon Island, Canada, with a relict population on Wrangel Island and west Chukotka, Russia. It has also been reported from St Pierre and Miquelon (to France) as a non-breeder. Birds winter in eastern South America including Argentina, Uruguay, Paraguay and Bolivia after passing through the Greater and Lesser Antilles or around the Gulf coast of Central America. Originally numbering in the hundreds of thousands to millions (1890s-1900s), the species was brought to near extinction in the early 1920s by hunting. It has not recovered, with the current population estimated at 16,000-84,000 individuals based on various estimates from birds passing through the Rainwater Basin in Nebraska and the Gulf coastal plain in Louisiana and Texas (Morrison et al. 2006). It is difficult to monitor, as it is not faithful to breeding sites (and possibly not to wintering sites), but data from North American migration sites suggest that declines are continuing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeds Arctic North America; winters in s South America.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range encompasses the low and high acrtic in eastern Russia, northern Alaska, northern Yukon, northwestern Mackenzie, and the region fromBanks, Melville, Bathurst, and Devon islands south to southern Victoria, Jenny Lind, and King William islands; the bulk of the breeding population appears to occupy coastal portions of the Yukon and Northwest Territories and most of the Queen Elizabeth Islands (Lanctot and Laredo 1994). During the nonbreeding season, this species occurs in South America (Brazil, Uruguay, and Argentina). Due to destruction of native grasslands by agriculture, most winter in coastal portions of the Río de La Plata grasslands where livestock grazing maintains suitable habitat. Migration in the United States is mainly through the central plains; juveniles are more common along the east coast in fall migration, rare along the west coast during southward migration.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeding along the Arctic coasts from central Alaska to Devon Island, Canada, as well as on Wrangel Island and west Chukotka, Russia, the buff-breasted sandpiper migrates through the Greater and Lesser Antilles of the Caribbean to winter in eastern South America (8). It is occasionally recorded in the Afro-tropics (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 21 cm

Weight: 71 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Tryngites subruficollis
Catalog Number: USNM A6694
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: unknown; Adult
Preparation: Skin: Whole
Collector(s): J. Parke
Locality: San Antonio, Prairie Near, Bexar, Texas, United States, North America
  • Type: Heermann. (Not Earlier Than October 31) 1854. Proc. Acad. Nat. Sci. Philadelphia. 7: 178.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Tryngites subruficollis
Catalog Number: USNM A6694
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: unknown; Adult
Preparation: Skin: Whole
Collector(s): J. Parke
Locality: San Antonio, Prairie Near, Bexar, Texas, United States, North America
  • Type: Heermann. (Not Earlier Than October 31) 1854. Proc. Acad. Nat. Sci. Philadelphia. 7: 178.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It breeds in the high Arctic on well drained tundra with tussocks and scant vegetation. It is generally not found near the sea and avoids marshes. It appears to depend heavily upon intensive grazing by livestock in its wintering grounds to create short grassland (Lanctot et al. 2002), but also uses flooded pampas grasslands. During migration it is found on many short grass habitats. At the internationally important Rainwater Basin stopover site in Nebraska, U.S.A., it was observed to feed primarily in agricultural grassland, and use wetlands for resting (McCarty et al. 2009). It is a lekking species.


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Breeding: Dry slopes with numerous sedge tussocks, on grass tundra with mosses and willows, in moist or wet sedge-grass meadows, in well-drained sandy areas with scant vegetation, and on well-vegetated hummocky ground bordering marshy ponds (Johnsgard 1981, Cramp and Simmons 1983, Godfrey 1986, Johnson and Herter 1989, Lanctot 1995). Prefers raised and grassy terrain, although the nature of the tundra often involves proximity to moist or wet ground (Cramp and Simmons 1983). Overall, avoids marshy areas (Johnsgard 1981).

During incubation breaks, females occur along stream banks with scant vegetation (Lanctot 1995). Females with broods occur primarily in moist and emergent vegetation along wetlands and stream beds (Lanctot 1995).

Landforms at leks are dominated by non-patterned ground, with reticulate-patterned ground, polygons, strangmoor, and frost-boils less commonly used (Lanctot and Slater 1992). Vegetation at leks is dominated by moist, graminoid (Carex aquatilis and Eriophorum angustifolium) and wet, graminoid meadows (Lanctot and Slater 1992). A third of all leks occur at traditional sites along bends and junctions of rivers (Lanctot 1995).

Non-breeding: Southern temperate zone on predominantly dry to moist open ground, short grass uplands (grass height < 3 cm). Individuals have also been observed in open mudflats or muddy shores near lakes and channels, abandoned and newly planted rice fields, and on burnt stubble after cutting sugar cane (Myers and Myers 1979, Cramp and Simmons 1983, Paulson 1993, Lanctot et al. 2001). Also utilize dry riverine sandbars, rain pools in pastures, golf courses, and airfields (Cramp and Simmons 1983).

Migration: Frequents short grass plains and dry uplands (Johnsgard 1981). Have been observed in man-altered habitats such as sod fields, airport runways, golf courses, cemeteries, burnt-over grasslands, cotton fields, recently ploughed fields, newly planted rice fields, flat, hard, sun-baked stubble, and barren recently inundated land (Cramp and Simmons 1983, Lanctot, unpubl. data). Edges of ponds are used for wading, drinking, and bathing, but not feeding (Cramp and Simmons 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During the breeding season, the buff-breasted sandpiper is found on dry, sloping tundra, or in tundra regions with both wet and dry areas. Whilst on migration this sandpiper stops in dry grasslands, earning it the nickname 'grasspiper'. Throughout the winter it is found mainly on Argentina's pampas grasslands (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northward migration begins in early February to mid-March (Palmer 1967, Myers and Myers 1979). Migration via central Amazonia/Pantanal flyway, over Brazil, Venezuela, Guyana, and Surinam (Haverschmidt 1972, Lanctot and Laredo 1994), across the Gulf of Mexico, and arriving in coastal Texas and Louisiana between mid-March and early April (Lanctot and Laredo 1994, Lanctot 1995). Passes through US in May, arrives in breeding areas late May - early June (Palmer 1967, Johnson and Herter 1989).

Southward migration begins from mid-June to early July; most depart breeding areas by end of August, but females with broods may remain in the Arctic as late as early September; rare in fall on Pacific islands; arrives in northern South America between August and October; most arrive in Argentina in mid-September, many depart in late January, a few still present in March (Hayman et al. 1986).

This sandpiper migrates as singles, pairs, or occasional small flocks. It may concentrate at particular staging areas. Variation of habitat use may coincide with changes in local food abundance or other conditions. Adults and juveniles may use different migration routes (Lanctot and Laredo 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feed primarily on insects (adults, larvae, and pupae) (Bent 1929, Palmer 1967). Also eat spiders, mollusk species, and seeds of aquatic plants (Bent 1929). On breeding grounds, foods consist of terrestrial invertebrates, especially the adults and larvae of beetles and the larvae and pupae of dipterans (Johnsgard 1981). Diets differ from other arctic shorebirds because this species tends to occupy upland habitats (Lanctot and Laredo 1994). As a result, diets are highly dependent on insect larvae and adults, feeding less on Chironomidae larvae and other wetland invertebrates (Lanctot and Laredo 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 - 100,000 individuals

Comments: Morrison et al. (2001) estimated about 15,000 individuals in total, perhaps as many as 20,000. An estimated 2,000 adults on Banks Island (Manning et al. 1956, cited by Lanctot and Laredo 1994). Breeding adults did not exceed "several tens of nesting birds" on Wrangel Island (Dorogoi 1983, cited by Lanctot and Laredo 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Gregarious. Nonbreeding: roosts at night in flocks often of about 600-1000; often seen in mixed flocks in association with golden and upland sandpipers, or Baird's or pectoral sandpipers (Stiles and Skutch 1989). Many defend small feeding territories in winter, but they roost in monospecific flocks (Hayman et al. 1986).

Breeding densities are low and can vary dramatically from year to year; in Alaska, densities were 0.5-14.0 individuals per sq km from 1981 to 1989 (see Lanctot 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Flies at night during migration.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Males and females arrive simultaneously on the arctic breeding grounds late May through early June (Lanctot and Laredo 1994). Lek breeding system (Sutton 1967, Johnson and Herter 1989, Lanctot and Laredo 1994, Lanctot and Weatherhead 1997). Leks change location from year to year. Within 2 to 11 days of arrival, males begin to display together on leks. Approximately 2 to 20 males occur together in a lek, although some males may display in solitary locations (Lanctot and Weatherhead 1997). Females visit leks only for copulation (Sutton 1967). Males and females do not pair (Johnson and Herter 1989). Males may mate with several females but take no part in incubation, leaving the breeding grounds in mid-June to early July (Parmelee et al. 1967, Sutton 1967, Lanctot and Laredo 1994). Females lay a single clutch per year (Lanctot and Laredo 1994), normally consisting of 4 eggs (Harrison 1978, Johnsgard 1981, Godfrey 1986). Incubation lasts 22-25 days (Troy 1988 in Johnson and Herter 1989, Lanctot and Laredo 1994). Peak hatching during second and third week of July, although hatching has been documented as early as July 5, 1992 and July 4, 1993 (Lanctot and Laredo 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tryngites subruficollis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTAATCTTCGGTGCATGAGCTGGTATAGTCGGAACTGCCCTTAGCTTGCTCATTCGTGCAGAACTAGGTCAACCCGGAACCCTTCTAGGAGATGACCAGATCTATAATGTTATTGTCACTGCCCACGCCTTTGTAATAATCTTCTTCATAGTAATGCCAATCATAATTGGCGGCTTCGGAAACTGACTAGTCCCACTTATAATCGGTGCCCCTGACATGGCATTCCCTCGTATAAACAACATAAGCTTCTGACTACTACCTCCATCATTCCTACTACTGCTAGCATCATCTACAGTAGAAGCTGGAGCAGGAACAGGATGAACAGTATACCCCCCACTTGCTGGCAACCTGGCCCATGCTGGAGCTTCTGTAGACCTAGCTATCTTCTCTCTTCACCTAGCAGGTGTATCTTCTATTCTAGGTGCCATCAACTTCATTACAACTGCCATCAACATAAAACCTCCAGCTCTCTCCCAATACCAAACACCCCTGTTCGTATGATCAGTACTTATCACTGCCGTCCTACTCCTACTCTCTCTTCCAGTTCTTGCTGCTGGCATTACTATACTACTAACAGACCGAAACCTGAACACTACATTCTTTGACCCCGCTGGGGGAGGAGACCCAGTCCTATACCAACACCTCTTCTGATTCTTCGGCCATCCAGAAGTTTACATCCTAATTCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tryngites subruficollis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Casaas, H., Harrington, B., Lanctot, R. & Russell, B.

Justification
This species underwent rapid historical declines. Its moderately small remaining population continues to decline and as a result it is considered Near Threatened.


History
  • Near Threatened (NT)
  • Near Threatened (NT)
  • Near Threatened (NT)
  • Lower Risk/near threatened (LR/nt)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5