Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) BREEDS: northeastern Siberia, northwestern and northern Alaska, northern Yukon, and northwestern Mackenzie, east to Franklin Bay, Northwest Territories. WINTERS: from central California, southern Arizona, southern New Mexico, central Texas, Gulf Coast, and southern Florida south to Guatemala, rarely to Costa Rica, casually to Panama; occasionally in Hawaii.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 29 cm

Weight: 109 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 16.316 - 16.316
  Nitrate (umol/L): 0.240 - 0.240
  Salinity (PPS): 33.496 - 33.496
  Oxygen (ml/l): 5.685 - 5.685
  Phosphate (umol/l): 0.330 - 0.330
  Silicate (umol/l): 1.436 - 1.436
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Nonbreeding: marshes, shores of ponds and lakes, mudflats and flooded fields, primarily in freshwater situations (AOU 1983). Nests on the ground in tundra and wet meadows, usually in marshes or grassy areas with scattered shrubs and trees near open fresh water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates primarily through western North America west of Rockies, less frequently (primarily in fall) east of Rockies (AOU 1983). Migrates northward to breeding areas, arriving late May-early June in northern Alaska. Southward migration usually begins in late July or early August, greatest numbers in August-September; juveniles begin migration after mid-August, rare before mid-September (Hayman et al. 1986). Rare but regular migrant in Hawaii.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Forages shallow fresh water and mud bars, probing into mud with bill. Feeds on insects and their larvae, mollusks, crustaceans, marine worms, spiders, and seeds of aquatic plants (bulrushes, pondweeds, sedges, etc.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

100,000 - 1,000,000 individuals

Comments: Morrison et al. (2001) estimated the total population to be roughly 500,000 with about 200,000 spring migrants moving through western North America, 290,800 moving through central and Interior Flyway sites, and 3100 through the eastern U.S.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Little information on home range; in Siberia, nesting pairs remained in an area about 100-300 meters in diameter (Johnsgard 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 13.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Breeding begins in late May or early June (Harrison 1978); early nestings in northern Alaska in the first half of June. Clutch size is 4. At first both sexes take turns incubating the eggs; later only the male is involved. Incubation appears to last for 20 days. Precocial young are tended by male.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Limnodromus scolopaceus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
BROM427-06|MKP 1523|Limnodromus scolopaceus| AACCGATGACTATTCTCAACCAACCACAAAGATATCGGTACCCTATATCTGATCTTCGGCGCATGAGCCGGAATAGTTGGAACCGCCCTC---AGCCTTCTCATCCGCGCAGAGCTAGGTCAACCAGGGACCCTCTTAGGAGAC---GACCAAATCTACAATGTAATTGTCACCGCCCACGCCTTCGTAATAATCTTCTTTATAGTCATACCAATCATAATCGGCGGGTTTGGAAACTGACTAGTCCCCCTAATA---ATTGGTGCTCCCGACATAGCATTCCCCCGCATAAACAACATAAGCTTCTGACTACTCCCACCATCATTCCTGCTACTCCTAGCATCATCCACAGTAGAAGCTGGGGCTGGCACAGGATGAACAGTATATCCCCCTCTCGCTGGTAACCTCGCCCACGCCGGAGCCTCAGTAGACCTC---GCTATTTTTTCCCTTCACTTAGCAGGTGTCTCCTCCATCTTAGGTGCCATCAACTTCATTACCACTGCTATTAACATAAAACCCCCAGCCCTTTCTCAATACCAAACCCCTCTATTCGTATGATCAGTCCTCATTACCGCTGTTTTACTCTTACTTTCCCTTCCAGTCCTTGCTGCC---GGTATTACTATACTACTAACAGATCGAAATCTAAATACCACATTCTTTGACCCAGCTGGGGGAGGAGACCCAGTCCTATATCAACACCTCTTCTGATTCTTCGGTCATCCAGAAGTCTATATCCTAATCCTACCAGGCTTTGGTATTATTTCACATGTTGTAACCTACTACGCAGGCAAAAAA---GAACCATTCGGATACATAGGAATAGTATGAGCTATACTATCTATTGGATTCCTAGGCTTCATCGTCTGAGCACATCACATATTTACAGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Limnodromus scolopaceus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Species: 7
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B - Apparently Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Long-billed Dowitcher

The Long-billed Dowitcher, Limnodromus scolopaceus, is a medium-sized shorebird.

Adults have yellowish legs and a long straight dark bill. The body is dark brown on top and reddish underneath with spotted throat and breast, bars on flanks. The tail has a black and white barred pattern. The winter plumage is largely grey.

Their breeding habitat is wet tundra in the far north of North America and eastern Siberia. They nest on the ground, usually near water.

They migrate to the southern United States and as far south as Central America. Long-billed Dowitcher is a rare but regular visitor to western Europe, with some individuals staying for long periods.

These birds forage by probing in shallow water or on wet mud. They mainly eat insects, mollusks, crustaceans and marine worms, but also eat some plant material.

They are more likely to be seen near fresh water than the Short-billed Dowitcher.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Avise and Zink (1988) for information on genetic divergence between L. SCOLOPACEUS and L. GRISEUS.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!