Limnodromus scolopaceus (Say, 1823)

Long-billed Dowitcher

Species recognized by The Integrated Taxonomic Information System external link, T Orrell (custodian) in 
IUCN Red List Status: Least Concern (LC) external link Showing: scientific names

Media Center Navigation

Limnodromus scolopaceus (Say, 1823)

Images

Items in yellow are not reviewed.

Choose images

Limnodromus scolopaceus
Limnodromus scolopaceus (Say, 1823)
Limnodromus scolopaceus (Say, 1823)
Limnodromus scolopaceus (Say, 1823)
Limnodromus scolopaceus (Say, 1823)
Limnodromus scolopaceus
Limnodromus scolopaceus (Say, 1823)
Limnodromus scolopaceus (Say, 1823)
Limnodromus scolopaceus (Say, 1823)

Page navigation

Page 1 Next
Classification : Text | Graphic |
  

Table of Contents

Barcode

Barcode data

Source and Additional Information
Supplier
Barcode of Life Data Systems (BOLD) external link
Copyright
Some rights reserved external link
Compiler
Sujeevan Ratnasingham external link
Compiler
Paul D.N. Hebert external link
Location
Source URL
View original data object external link
Citation

The following is a representative barcode sequence, the centroid of all available sequences for this species.



 
There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 

BROM427-06|MKP 1523|Limnodromus scolopaceus|

AACCGATGACTATTCTCAACCAACCACAAAGATATCGGTACCCTATATCTGATCTTCGGCGCATGAGCCGGAATAGTTGGAACCGCCCTC---AGCCTTCTCATCCGCGCAGAGCTAGGTCAACCAGGGACCCTCTTAGGAGAC---GACCAAATCTACAATGTAATTGTCACCGCCCACGCCTTCGTAATAATCTTCTTTATAGTCATACCAATCATAATCGGCGGGTTTGGAAACTGACTAGTCCCCCTAATA---ATTGGTGCTCCCGACATAGCATTCCCCCGCATAAACAACATAAGCTTCTGACTACTCCCACCATCATTCCTGCTACTCCTAGCATCATCCACAGTAGAAGCTGGGGCTGGCACAGGATGAACAGTATATCCCCCTCTCGCTGGTAACCTCGCCCACGCCGGAGCCTCAGTAGACCTC---GCTATTTTTTCCCTTCACTTAGCAGGTGTCTCCTCCATCTTAGGTGCCATCAACTTCATTACCACTGCTATTAACATAAAACCCCCAGCCCTTTCTCAATACCAAACCCCTCTATTCGTATGATCAGTCCTCATTACCGCTGTTTTACTCTTACTTTCCCTTCCAGTCCTTGCTGCC---GGTATTACTATACTACTAACAGATCGAAATCTAAATACCACATTCTTTGACCCAGCTGGGGGAGGAGACCCAGTCCTATATCAACACCTCTTCTGATTCTTCGGTCATCCAGAAGTCTATATCCTAATCCTACCAGGCTTTGGTATTATTTCACATGTTGTAACCTACTACGCAGGCAAAAAA---GAACCATTCGGATACATAGGAATAGTATGAGCTATACTATCTATTGGATTCCTAGGCTTCATCGTCTGAGCACATCACATATTTACAGTAGGAATGG


 
-- end --
 


Download FASTA File
"Limnodromus scolopaceus (Say, 1823)". Encyclopedia of Life, available from "http://www.eol.org/pages/1049545". Accessed 18 Mar 2010.