Articles on this page are available in 2 other languages: Spanish (8), Chinese (Simplified) (5) (learn more)

Overview

Comprehensive Description

The western sandpiper, Calidris mauri, is one of a few Florida shorebirds belonging to a group known as 'stints' (small sandpipers belonging to the genera Erolia or Calidris). Distinguishing characteristics include a black bill and legs (Paulson 2005). Like similar species, sex can be determined in part by bill length. In general, female bills measure at least 2.5 cm longer than those of males (Paulson 2005), a difference thought to be derived from intersexual competition for food at wintering locations (Stein et al. 2008). Plumage and body coloration vary with age and season, and descriptions are divided accordingly below. Breeding Adult Reddish-brown plumage of varying degrees is concentrated on the crown, ears and along the upper back (Paulson 2005). The breast is streaked, and the sides are marked with several black streaks and chevrons. In the fall after breeding, individuals are often faded and patchier. Non-breeding Adult Coloration is nearly identical to that of the semipalmated sandpiper, C. pusilla. Plumage is plain grayish-brown above and white below, the eyebrow feathers (supercilium) are white and the breast is lightly streaked (Paulson 2005).Juvenile Legs are olive, darkening to black in adults (Paulson 2005). Plumage coloration on the head is similar to that of non-breeding adults, but darker and more distinct. Wing feathers are grayish-brown to reddish-brown with buff fringes. Underparts are mostly unmarked, and the sides of the breast are streaked. Breasts of the youngest individuals are tan, fading to white during the first migration.
  • Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
  • Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
  • Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Breeds Siberia and Alaska; winters to n South America.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) BREEDS: islands in Bering Sea, along coasts of western and northern Alaska, northeastern Siberia. Nonbreeding birds spend breeding season south to Panama. NORTHERN WINTER: coastal California and North Carolina south along both coasts, through West Indies, to Peru and Surinam.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Like many shorebirds, C. mauri is found throughout a large range extended by long seasonal migrations. Wintering and migratory stopover populations occur from Washington in the west and Delaware in the east south throughout the Americas to Peru (e.g. Terres 1980). Depending on the season, individuals may be abundant both inland and along the coast. Despite its broad migratory range, this species is known to breed only in western and northern Alaska (Terres 1980; Paulson 2005).Indian River Lagoon (India River Lagoon) Distribution: Little information is available on the distribution of the western sandpiper in the India River Lagoon, but birds are found throughout Florida on tidal flats and sandy beaches (Kale 1990).
  • Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
  • Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
  • Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 17 cm

Weight: 23 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The western sandpiper is the largest of the stints, with a body length of about 16.5 cm and a wingspan ranging from 30 to 36 cm (Terres 1980; Paulson 2005). Lifespan varies with environmental conditions and other factors. Little information is available on the maximum age of C. mauri, but similar species live up to 7 years under certain conditions (Terres 1980).
  • Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
  • Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
  • Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

The western sandpiper is most easily confused with the semipalmated sandpiper, C. pusilla. As mentioned above, non-breeding adults are very similar in coloration (e.g. Paulson 2005). On average, western sandpipers are larger than C. pusilla and have longer, more curved bills. In flight, the two species are distinguished only by their calls (Peterson 1980) (see 'Voice' below).
  • Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
  • Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
  • Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 13.353 - 16.316
  Nitrate (umol/L): 0.240 - 3.951
  Salinity (PPS): 33.239 - 33.496
  Oxygen (ml/l): 5.685 - 6.095
  Phosphate (umol/l): 0.330 - 0.674
  Silicate (umol/l): 1.436 - 5.723

Graphical representation

Temperature range (°C): 13.353 - 16.316

Nitrate (umol/L): 0.240 - 3.951

Salinity (PPS): 33.239 - 33.496

Oxygen (ml/l): 5.685 - 6.095

Phosphate (umol/l): 0.330 - 0.674

Silicate (umol/l): 1.436 - 5.723
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Nonbreeding: mudflats, beaches, shores of lakes and ponds, shallow lagoons, artificial salt ponds, and flooded fields; various coastal habitats with flat or gently sloping muddy, sandy, or gravelly shores; less often inland at pond edges, rain pools, wet fields (Stiles and Skutch 1989). Breeds coastally on sedge-dwarf tundra, on hummocks surrounded by marsh. Nests on the ground in a shallow depression, lined with leaves, lichen, and other plant material. Strong tendency to nest in same area in successive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward, mostly along coasts of U.S., early April-early June. Southward migration begins early July, adults prior to juveniles. Nonbreeding birds may not migrate north to breeding range. Uncommon fall and rare spring migrant in Hawaii; occasionally overwinters (Pratt et al. 1987). Migrates through Costa Rica August-November and mid-March to early May (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Feeds primarily on aquatic insects; also eats mollusks, worms, and crustaceans. Runs along edge of water snatching up prey from wet mud. See Senner et al. (1989) for information on feeding ecology of migrants at Copper-Bering river delta, south-central Alaska.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The western sandpiper feeds and forages in a similar fashion to the semipalmated sandpiper, walking with its head down while snapping or probing through the sand in search of prey (Terres 1980). This species may also submerge its head to catch a variety of invertebrate prey, and utilize the surface tension of the surrounding water to transport food down the beak (Estrella et al. 2007).Predators: Little information is available concerning predators of the western sandpiper, but birds of prey, alligators and larger mammals probably consume eggs, hatchlings and adults.Parasites: Like many other bird species, the red knot acts as a terminal or final host for several parasites acquired from a variety of prey items, including the parasitic worms, Bartolius pierrei (Cremonte 2004), Skrjabinocerca canutus, Viktorocara capillaries, and V. limosae (Diaz et al. 2005).
  • Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
  • Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
  • Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Although there are no obligate associations documented between the western sandpiper and other species, C. mauri is commonly found alongside other organisms from the tidal flat and sandy beach habitats in which it resides. For more extensive information on these ecosystems and their associated species found in and around the IRL, please visit the Tidal Flat and Beach Habitat pages.
  • Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
  • Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
  • Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Total population estimated at 3.5 million (Morrison et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The western sandpiper is a common stint, considered abundant despite its limited breeding range (Paulson 2005) (see 'Regional Occurrence' above). Detailed abundance records for sandpiper populations within the IRL are scarce. However, birds are known to stopover in Florida from July through May, and some non-breeding individuals extend their stay throughout the summer (Kale 1990). With the exception of the spring season, the western sandpiper is more abundant in the southeastern U.S. than its prolific relative, C. pusilla (Paulson 2005).
  • Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
  • Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
  • Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Nonbreeding: forages regularly in large flocks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Migrants in south-central Alaska tended to feed continuously between successive high tides (Senner et al. 1989). See Robert et al. (1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 9.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Breeding begins late May (Harrison 1978). Both sexes, in turn, incubate 4 eggs for 18-19 days (Terres 1980). Nestlings precocial and downy. Young tended by both parents. Up to 500-700 pairs per sq km near Barrow, Alaska.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The leaf and grass-lined nests of C. mauri are typically built in ground depressions on moist to dry arctic tundra or on mossy mountain slopes near sedges and low-lying plants (Terres 1980). Clutch size is generally four eggs per nest. Eggs are cream to light brown and marked with reddish-brown spots and blotches (Terres 1980). Both parents incubate the eggs until they hatch, a period of about 18-19 days. After hatching, chicks are brooded for 5-7 days, and further parental investment includes leading chicks out of the nest and offering protection from predators via territorial displays and parent-offspring signal calls for an additional 2-3 week period (Johnson et al. 2008) (see "Voice" below). Studies have revealed some degree of nesting site and mate fidelity from one breeding season to the next. Of the population surveyed from the Yukon-Kuskokwim River Delta in Alaska, 40-60 % of breeding adults returned to the same nesting site, and 4-29 % returned to the same mate (Johnson & Walters 2008). Results indicated that site and mate fidelity lead to faster clutch initiation and higher nest survival rates. Voice: Western sandpipers emit a variety of calls, depending on the circumstance. During flight, vocal communication consists of a high-pitched, squeaky dzheet, jeet or cheep. While in flight, call variation is the only method for distinguishing C. mauri from the semipalmated sandpiper, which often trills repeatedly and emits a duller sound (Peterson 1980; Paulson 2005). Breeding adults produce a crescendoed trill of brr-eee brr-eee brr-eee breee-urrrrr that drops at the end (Paulson 2005). After hatchlings leave the nest, parents have been documented to use four distinct calls for communicating with offspring, categorized as 'brood', 'alarm', 'freeze' and 'gather' (Johnson et al. 2008). Chicks respond in varying ways, depending on the type of call. In some instances, juveniles notify parents of their location, while others remain silent as an antipredatory response. Temperature &
  • Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
  • Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
  • Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Bird bill draws food into mouth: sandpiper
 

The bills of sandpipers draw food into their mouth via capillary action.

     
  "Instead of filtering, as do most planktivores, these small birds 'tweezer' prey. But that puts the prey at the tip of the bill, not the pharynx. Gaping the bill slightly, though, creates an interface, as in fig. 5.8a). The water then does its part - surface tension reduces the area of interface by making the droplet of water move up and back from the bill's tip." (Vogel 2003:107)
  Learn more about this functional adaptation.
  • Steven Vogel. 2003. Comparative Biomechanics: Life's Physical World. Princeton: Princeton University Press. 580 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calidris mauri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNTATACCTAATCTTCGGTGCATGAGCTGGTATAGTCGGAACCGCCCTTAGCCTGCTCATTCGTGCAGAACTAGGTCAACCCGGAACCCTCTTAGGAGACGACCAGATCTACAACGTTATTGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATGCCAATCATAATTGGTGGCTTCGGAAATTGACTAGTCCCACTTATAATCGGTGCCCCTGACATAGCATTCCCTCGTATAAACAACATAAGCTTCTGACTACTACCCCCATCATTCCTGCTACTACTGGCATCGTCTACAGTAGAAGCCGGAGCAGGTACAGGATGAACAGTATATCCCCCACTTGCTGGTAACCTAGCCCATGCTGGAGCCTCCGTAGACCTAGCCATCTTCTCTCTCCACCTAGCAGGTGTCTCCTCTATCCTAGGTGCCATCAACTTCATCACTACCGCCATTAACATAAAACCTCCAGCCCTCTCTCAATACCAAACACCCTTATTCGTGTGATCAGTACTTATCACCGCCGTTCTACTTTTACTCTCTCTCCCAGTTCTTGCTGCCGGCATTACCATGCTACTAACAGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCAGTCCTATATCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTTTACATCCTAATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Calidris mauri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NUB,N4M : NUB: Unrankable - Breeding, N4M: Apparently Secure - Migrant

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Needs: "Regional conservation plans that restore salt marshes for the benefit of endangered species must consider the effects of losing artificial salt-pond habitats, which are locally important for sandpipers" (Warnock and Takekawa 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Threats & Conservation: Unlike the related red knot, Calidris canutus rufa, populations of the western sandpiper are strong and no special status has been issued for the species. However, C. mauri is protected under the Migratory Bird Treaty Act of 1918, which prohibits the harassment, capture, kill and/or possession of listed migratory species (e.g. USFWS 2010).
  • Estrella, SM, Masero, JA & A Pérez-Hurtado. 2007. Small-prey profitability: field analysis of shorebirds' use of surface tension of water to transport prey. The Auk 124: 1244-1253.
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Fernández, G & DB Lank. 2007. Variation in the wing morphology of western sandpipers (Calidris mauri) in relation to sex, age class, and annual cycle. The Auk 124: 1037-1046.
  • Johnson, M, Araf, S & JR Walters. 2008. Parent-offspring communication in the western sandpiper. Behav. Ecol. 19: 489-501.
  • Johnson, M & JR Walters. 2008. Effects of mate and site fidelity on nest survival of western sandpipers (Calidris mauri). The Auk 125: 76-86.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Norris, DR, Lank, DB, Pither, J, Chipley, D, Ydenberg, RC & TK Kyser. 2007. Trace element profiles as unique identifiers of western sandpiper (Calidris mauri) populations. Can. J. Zool. 85: 579-583.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Stein, RW, Fernandez, G, de la Cueva, H & RW Elner. 2008. Disproportionate bill length dimorphism and niche differentiation in wintering western sandpipers (Calidris mauri). Can. J. Zool. 86: 601-609.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Western Sandpiper

The Western Sandpiper, Calidris or Erolia mauri, is a small shorebird.

Adults have dark legs and a short, thin, dark bill, thinner at the tip. The body is brown on top and white underneath. They are reddish-brown on the crown. This bird can be difficult to distinguish from other similar tiny shorebirds, especially the Semipalmated Sandpiper. This is particularly the case in winter plumage, when both species are plain gray. The Western Sandpiper acquires winter plumage much earlier in the autumn than the Semipalmated Sandpiper.

Their breeding habitat is on tundra in eastern Siberia and Alaska. They nest on the ground usually under some vegetation. The male makes several scrapes; the female selects one and lays 4 eggs. Both parents incubate and care for dependent young, who feed themselves. Sometimes the female deserts her mate and brood prior to offspring fledging.

They migrate to both coasts of North America and South America. It is a very rare vagrant to western Europe.

These birds forage on mudflats during migration and the non-breeding season by probing or picking up food by sight. Foraging occurs on tundra and wet meadows during the breeding season. They mainly eat insects, small crustaceans, and mollusks.

This is one of the most abundant shorebird species in North America with a population in the millions.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Pusilla and C. MAURI are often placed in the genus EREUNETES (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!