Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Calidris pusilla

A small (5 ½ -6 ½ inches) sandpiper, the Semipalmated Sandpiper may be identified by its size), short wings, and dark legs. In summer, this species is mottled brown above with a white belly, streaked breast and throat, and pale white eye-stripes. In winter, this species becomes darker and duller than in summer. Male and female Semipalmated Sandpipers are similar to one another in all seasons. The Semipalmated Sandpiper breeds in high arctic Siberia, Alaska, and Canada south to the Hudson Bay. This species is a long-distance migrant, wintering from Central America and the West Indies south to southern South America. On migration, this species may be seen in the eastern United States and Canada, both in the interior and along the coast. Semipalmated Sandpipers primarily breed on wet tundra. This species may be found in wet grasslands and marshes while on migration, occurring in these habitats (as well as mangroves) during the winter. This species primarily eats insects and larvae, but may also take small snails, crustaceans, and fish. Due to its remote breeding habitat, most birdwatchers never see the Semipalmated Sandpiper during the summer. This species is more likely to be seen in winter and on migration, where it may be observed along the shore probing the mud for food with its bill. Semipalmated Sandpipers are primarily active during the day.

Threat Status: Near Threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

The semipalmated sandpiper, Calidris pusilla, is a small bird named for the webbing present between its toes (Terres 1980). Despite its somewhat nondescript coloration, the species is used as a standard for identification of sandpipers. Distinguishing characteristics include a thick black bill and black legs (Paulson 2005). Both sexes are similar in appearance, differing mainly in bill size and shape. Male bills are short and blunt, while the longer bills of females have a tapered and slightly drooped form (Farrand 1983). Plumage and body coloration vary with age and season, and descriptions are divided accordingly below. Breeding Adult Plumage varies from grayish-brown to mottled brown and black upperparts with an occasional reddish tint (Paulson 2005). The brow feathers (supercilium) and throat are conspicuously white, and the head is marked on each side with a brown loral (between the eye and bill) stripe. The breast usually bears several brown stripes and dots, and the sides of the body are often streaked with brown.Non-breeding Adult Plumage is gray-brown with fine, dark streaks at the shaft of the feathers (Paulson 2005). The supercilium and loral stripes are similar to those of breeding adults. Juvenile Legs are olive, darkening to black during the fall migration (Paulson 2005). Plumage coloration is quite variable, but most individuals are brownish with feathers fringed in tan and tipped with white, giving the birds a scaled appearance. Breasts of the youngest individuals are tan, fading to white during the first migration.
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
  • Audubon. 2010. Semipalmated Sandpiper. National Audubon Society. Online at http://web1.audubon.org/science/species/watchlist/profile.php?speciesCode=semsan (Date accessed: 08/10/2010).
  • Collazo, JA, O'Harra, DA & CA Kelly. 2002. Accessible habitat for shorebirds: factors influencing its availability and conservation implications. Waterbirds 25: 13-24.
  • McCurdy, DG, Forbes, MR & JS Boates. 1999. Evidence that the parasitic nematode Skrjabinoclava manipulates host Corophium behavior to increase transmission to the sandpiper, Calidris pusilla. Behav. Ecol. 19: 351-357.
  • Safriel, UN. 1975. On the significance of clutch size in nidifugous birds. Ecology 56: 703-708.
  • Schneider, DC & BA Harrington. 1981. Timing of shorebird migration in relation to prey depletion. The Auk 98: 801-811.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: western and northern Alaska, northern Yukon, northrn Mackenzie, Canadian arctic islands (except northernmost), and northern Labrador south to western Alaska, east-central Mackenzie, southeastern Keewatin, northeastern Manitoba, Southampton Island, northern Ontario, northern Quebec, and coastal Labrador. Nonbreeders often spend breeding season in coastal North America south to Gulf Coast, Panama. NORTHERN WINTER: Florida and Bahamas south to West Indies, Atlantic coast of South America (to Paraguay and southern Brazil), and Pacific coast from Guatemala south to northern Chile. Accidental in Hawaii. By far the largest numbers in winter occur on the northern coast of South America, centered on Suriname and the Guianas (Morrison and Ross 1989). Delaware Bay is the most important spring stopover in the eastern U.S. (Clark et al. 1993). The Bay of Fundy is an important staging area during fall migration and is used by perhaps 1-2 million individuals (up to 50-90% of the world population) (Mawhinney et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Calidris pusilla is a common breeder in the Arctic and subarctic from far-eastern Siberia (Russia) east across Alaska (USA) and northern Canada to Baffin Island and Labrador (Chandler 2009). In the non-breeding season the species uses coastal estuarine habitats, wintering on the Pacific coast from Mexico to Peru, and on the Atlantic coast from the Yucatan and the West Indies south to central Argentina, with large non-breeding concentrations occurring along the coast of Suriname and French Guiana (del Hoyo et al. 1996, Chandler 2009, D. Mizrahi in litt. 2009). The population was formerly estimated at 3.5 million individuals, but this was revised downwards to 2.2 million individuals in 2006 (Morrison et al. 2006, A. Lesterhuis in litt. 2009) assuming annual declines of 5% in 75% of the North American population. Trends are hard to quantify, but aerial surveys conducted along the coasts of Suriname and French Guiana suggest that the non-breeding population in the region could have declined by c.80% between the early 1980s and 2008, from c.2 million to c.400,000 individuals; the possibility that there has been a shift in the wintering range seems unlikely but has not been completely ruled out (D. Mizrahi in litt. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Breeds Arctic North America; winters to s South America.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Semipalmated sandpipers (Calidris pusilla) are small shorebirds which breed along the coast of the Hudson Bay and the coast of northern Alaska. During the non-breeding season semipalmated sandpipers migrate to coastal South America, the Caribbean, and Central America.  Migration occurs in long flights of 3000 to 4000 kilometers from Canada and the northern United States to South America. The birds travel in large migratory flocks which can vary in size and can be as large as 350,000 individuals. Some semipalmated sandpiper populations follow very specific migration paths with regular stops at critical, resource-rich locations such as the Bay of Fundy in eastern Canada, and the Delaware Bay in the United States. Short flight migration is also prevalent when individuals or flocks move to closer areas.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • 2009. "The Cornell Lab of Ornithology" (On-line).
    All About Birds
    . Accessed February 11, 2010 at http://www.allaboutbirds.org/guide/Semipalmated_Sandpiper/id.
  • Gough, G. 2012. "United States Geological Survey" (On-line). Patuxent Bird Identification InfoCenter. Accessed February 11, 2010 at http://137.227.242.23/id/framlst/i2460id.html.
  • Lank, D., R. Butler, R. Ydenberg, J. Ireland. 2003. Effects of predation danger on migration strategies of sandpipers. OIKOS, 103: 303-319.
  • Page, G., L. Middleton. 1972. Fat Depostion During Autumn Migration in the Semiplated Sandpiper. Bird-Banding a Journal of Ornthological Ivestigation, 43/2: 85-160.
  • Peterson, R., M. DiGirgio, P. Lehmen, M. O'Brien, L. Rosche, B. Thompson III. 2009. Field Guide to Birds of North America. New York: Houghton Mifflin Books.
  • Shepherd, P., J. Boates. 2001. Effects of a Commercial Baitworm Harvest on Semipalmated Sandpipers and Their Prey in the Bay of Fundy Hemispheric Shorebird Reserve. Conservation Biology, 13/2: 347 - 356.
  • Tsipoura Burger, N., J. Burger. 1999. Shorebird diet during spring migration stopover on Delaware Bay. Condor, 101/3: 635-644.
  • del Hoyo, J., A. Elliott, J. Sargatal. 1996. Handbook of Birds of the World Vol III. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Like many shorebirds, C. pusilla is found throughout a large range extended by long seasonal migrations. Breeding occurs in the arctic from Alaska to the Atlantic Ocean, while wintering and migratory populations can be seen in several locations, including the east coast of the U.S. to southern Florida, eastern Mexico and the Caribbean south to Brazil (Terres 1980; Farrand 1983; Paulson 2005).Indian River Lagoon (India River Lagoon) Distribution: Little information is available on the distribution of the semipalmated sandpiper in the India River Lagoon, but surveys have been conducted at sites such as the Merritt Island National Wildlife Refuge (NWR) (Collazo et al. 2002). Birds are found on tidal flats or salt marshes in the lagoon and in the swash zone of sandy beaches exposed to the coastal waters of the adjacent Atlantic Ocean (e.g. Terres 1980; Paulson 2005).
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
  • Audubon. 2010. Semipalmated Sandpiper. National Audubon Society. Online at http://web1.audubon.org/science/species/watchlist/profile.php?speciesCode=semsan (Date accessed: 08/10/2010).
  • Collazo, JA, O'Harra, DA & CA Kelly. 2002. Accessible habitat for shorebirds: factors influencing its availability and conservation implications. Waterbirds 25: 13-24.
  • McCurdy, DG, Forbes, MR & JS Boates. 1999. Evidence that the parasitic nematode Skrjabinoclava manipulates host Corophium behavior to increase transmission to the sandpiper, Calidris pusilla. Behav. Ecol. 19: 351-357.
  • Safriel, UN. 1975. On the significance of clutch size in nidifugous birds. Ecology 56: 703-708.
  • Schneider, DC & BA Harrington. 1981. Timing of shorebird migration in relation to prey depletion. The Auk 98: 801-811.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Semipalmated sandpipers are small sized shorebird about 13 to 15 cm long weighing from 21 to 32 g. They have black legs and straight tubular bills which are black or darkly colored. Wingspan ranges from 29 to 30 cm. The name 'semipalmated' refers to the slight webbing between the 3 front toes. Plumage differs between juveniles, breeding and nonbreeding adults. During the breeding season semipalmated sandpipers have gray to brown upper body, with a uniformly scaly pattern. The belly is white with darker streaks along the upper breast. Juveniles vary greatly in plumage, but generally have a darker brown cap with a pronounced supercilium. Nonbreeding plumage fades to a lighter gray-brown on the upper body with only faint streaking on sides of an otherwise white breast. On average females are slightly larger than males.

Range mass: 21 to 32 g.

Range length: 13 to 15 cm.

Range wingspan: 29 to 30 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 16 cm

Weight: 28 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

C. pusilla is a small bird, approximately 14-18 cm in length with a wingspan of 28-33 cm (Terres 1980). Lifespan varies with environmental conditions and other factors, but individuals have been documented to live up to 7 years of age (Terres 1980).
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
  • Audubon. 2010. Semipalmated Sandpiper. National Audubon Society. Online at http://web1.audubon.org/science/species/watchlist/profile.php?speciesCode=semsan (Date accessed: 08/10/2010).
  • Collazo, JA, O'Harra, DA & CA Kelly. 2002. Accessible habitat for shorebirds: factors influencing its availability and conservation implications. Waterbirds 25: 13-24.
  • McCurdy, DG, Forbes, MR & JS Boates. 1999. Evidence that the parasitic nematode Skrjabinoclava manipulates host Corophium behavior to increase transmission to the sandpiper, Calidris pusilla. Behav. Ecol. 19: 351-357.
  • Safriel, UN. 1975. On the significance of clutch size in nidifugous birds. Ecology 56: 703-708.
  • Schneider, DC & BA Harrington. 1981. Timing of shorebird migration in relation to prey depletion. The Auk 98: 801-811.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Several species of sandpipers resemble C. pusilla at first glance. Of these, the western sandpiper, C. mauri, and the least sandpiper, C. minutilla, are most likely to overlap in range. The bill of the western sandpiper is usually longer, thinner and more drooped than that of C. pusilla (Farrand 1983; Paulson 2005). Plumage is very similar between the species, except in breeding adults where the head of the western sandpiper is reddish-brown and sides are distinctly marked with chevrons. The least sandpiper is easily distinguished from C. pusilla upon close examination, characterized by paler legs, shorter wings and browner coloration (Paulson 2005). When plumage and body coloration are similar among species, the semipalmated sandpiper can be identified with practice by its distinct call (see 'Voice' below) (Farrand 1983). Flight Patterns & Locomotion: While in flight, semipalmated sandpipers form close flocks with a uniform twisting motion that reveals their dark backs followed by the white of their breasts. Flight speeds of some individuals have been recorded up to 50 mph (Terres 1980). Flocks settle on the ground and spread out to feed, running just above the wave line on beaches, in shallow water or on exposed tidal flats (Terres 1980; Collazo et al. 2002). While resting, flocks often huddle closely. Individuals orient into the wind with their bills buried in their back feathers, and frequently stand or lightly hop on one leg (Terres 1980).
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
  • Audubon. 2010. Semipalmated Sandpiper. National Audubon Society. Online at http://web1.audubon.org/science/species/watchlist/profile.php?speciesCode=semsan (Date accessed: 08/10/2010).
  • Collazo, JA, O'Harra, DA & CA Kelly. 2002. Accessible habitat for shorebirds: factors influencing its availability and conservation implications. Waterbirds 25: 13-24.
  • McCurdy, DG, Forbes, MR & JS Boates. 1999. Evidence that the parasitic nematode Skrjabinoclava manipulates host Corophium behavior to increase transmission to the sandpiper, Calidris pusilla. Behav. Ecol. 19: 351-357.
  • Safriel, UN. 1975. On the significance of clutch size in nidifugous birds. Ecology 56: 703-708.
  • Schneider, DC & BA Harrington. 1981. Timing of shorebird migration in relation to prey depletion. The Auk 98: 801-811.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Nonbreeding: mudflats, sandy beaches, shores of lakes and ponds, and wet meadows (AOU 1983). In northern Alaska, postbreeding habitat was mainly coastal mudflats and slough edges (Smith and Connors 1993). Breeds on grassy or dry shrubby tundra, usually near water. In northern Alaska, favored areas with well-drained ridges for nesting and adjacent wet tundra for feeding (see Johnson and Herter 1989). Often returns to nest in natal area or area of previous nesting (Gratto et al. 1985). The nest is a shallow depression, lined with grasses, moss, and leaves. See also Rodrigues (1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It breeds in high and low Arctic and subarctic wet sedge or heath tundra, oftern near pools, rivers and lakes (del Hoyo et al. 1996). In the non-breeding season it is mainly coastal, favouring sandy beaches and intertidal mudflats, sometimes also shallow lagoons and saltmarsh (del Hoyo et al. 1996). On migration also at inland wetlands, lake edges etc (del Hoyo et al. 1996). Food is mainly chironomid larvae in the breeding season, along with other small invertebrates and seeds. Various small aquatic, marine and terrestrial invertebrates taken on migration, including horseshoe crab Limulus polyphemus eggs on spring migration in eastern USA (del Hoyo et al. 1996). Makes non-stop flights of up to 4,000 km on migration, with flocks of up to 350,000 gathering at key stopover sites (del Hoyo et al. 1996).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Semipalmated sandpipers breed along the shores of northern Canada and Alaska on wet sedge or sedge-tundra. They select open habitats well-suited for breeding displays and scrape nests. They generally are found running along sandy shorelines, probing the loose sand for invertebrates. Ideal foraging habitat includes pools close to lakes and rivers, shrubby river deltas, and sandy areas along the shore. Migration stopover habitats may include wetlands, grassy fields, marshes, or edges of lakes and rivers. During non-breeding winter months, semipalmated sandpipers inhabit sandy beaches and intertidal zones of South America, the Caribbean, and Central America.

Habitat Regions: temperate ; tropical ; polar ; terrestrial

Terrestrial Biomes: tundra ; savanna or grassland

Aquatic Biomes: coastal

Other Habitat Features: riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 13 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 1.694 - 9.236
  Nitrate (umol/L): 1.306 - 4.057
  Salinity (PPS): 30.132 - 33.967
  Oxygen (ml/l): 6.776 - 7.983
  Phosphate (umol/l): 0.412 - 0.725
  Silicate (umol/l): 2.103 - 6.431

Graphical representation

Temperature range (°C): 1.694 - 9.236

Nitrate (umol/L): 1.306 - 4.057

Salinity (PPS): 30.132 - 33.967

Oxygen (ml/l): 6.776 - 7.983

Phosphate (umol/l): 0.412 - 0.725

Silicate (umol/l): 2.103 - 6.431
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Begins migrating northward in April, passing through U.S. in mid-May; arrives in breeding areas late May-early June. Northward and southward migration through interior North America are primarily east of Rockies, and on Atlantic-Gulf coast.

Southbound migrants from Alaska migrate chiefly across the Great Plains. Southbound migrants from the Canadian arctic (central and eastern breeding range) stop and feed at estuaries in Canadian maritime provinces and northeastern U.S. before flying nonstop to wintering areas in South America. The Bay of Fundy is a very important migration stop (may be used by 1-2 million birds in fall; Mawhinney et al. 1993). Adults depart breeding areas on Victoria Island by the end of July, juveniles depart in early to mid-August. Migrates through Costa Rica mid-August to mid-November and March-early May (Stiles and Skutch 1989).

In spring, western breeders migrate northward apparently through the interior of North America whereas most central and eastern breeders follow an Atlantic route from northern South America to the eastern U.S. at Delaware Bay (some migrate through interior of North America). Spring migrants in interior North America evidently use multiple stopover areas enroute to breeding areas (Skagen and Knopf 1994).

Birds wintering on the north coast of Brazil probably derive from breeding grounds in the eastern Arctic; birds on the western part of the north coast of South America and on the northern part of the Pacific coast likely come from the western sectors of the breeding grounds (Morrison and Ross 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Feeds primarily on aquatic insects; also eats mollusks, worms, and crustaceans. In spring at Delaware Bay, consumes large numbers of horseshoe crab eggs (Castro and Myers 1993, Botton et al. 1994). Runs along sand or mud snatching at food, sometimes probes for food with bill.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Semipalmated sandpipers utilize a probing method to forage for small invertebrates on the ground, in mud, or occasionally under water. Typical diet consists of chironomid larvae (Diptera), arachnids, plant seeds, tipulid larvae (Diptera), dolichopodid larvae (Diptera), snails, Donacia adults (Chrysomelidae, Coleoptera), Lispe larvae (Muscidae, Diptera), Agapes larvae (Dytiscidae, Coleoptera), Pericoma larvae (Psychodidae, Diptera), and Hyrgotus adults (Dytiscidae, Coleoptera). Semipalmated sandpipers rely heavily on horseshoe crab eggs during spring migration.  Feeding behavior consists of running along the water's edge, pecking and probing in the ground along damp or flooded mud flats. When invertebrates are abundant, semipalmated sandpipers also forage along marsh edges.

Semipalmated sandpipers use both visual and tactile foraging to collect food, depending on the food source. They actively defend feeding territories year-round, though they are much more vigilant while breeding.

Females will also eat small mammal bones as an extra source of calcium during egg laying.

Animal Foods: insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic or marine worms; aquatic crustaceans; other marine invertebrates

Primary Diet: carnivore (Molluscivore , Vermivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The semipalmated sandpiper feeds and forages by running with its head down while snapping or probing through the sand in search of prey (Terres 1980). In coastal marine and estuarine habitats, C. pusilla feeds on a variety of benthic organisms, such as: the amphipods, Corophium volutator, Acanthohaustorius millsi and Protohaustorius deichmannae; polychaete worms; and small mollusks (Terres 1980; Schneider & Harrington 1981; McCurdy et al. 1999). Freshwater and terrestrial prey consists of fly larvae, beetles and other insects (Terres 1980).Predators: Documented predators of C. pusilla include larger birds such as the snowy owl, Nyctea scandiaca, and jaegers of the genus Stercorarius (Safriel 1975).Parasites: Like many other bird species, C. pusilla acts as a terminal or final host for several parasites acquired from a variety of prey items. One such example is the parasitic worm, Skrjabinoclava morrisoni, transmitted from the amphipod, Corophium volutator (McCurdy et al. 1999).
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
  • Audubon. 2010. Semipalmated Sandpiper. National Audubon Society. Online at http://web1.audubon.org/science/species/watchlist/profile.php?speciesCode=semsan (Date accessed: 08/10/2010).
  • Collazo, JA, O'Harra, DA & CA Kelly. 2002. Accessible habitat for shorebirds: factors influencing its availability and conservation implications. Waterbirds 25: 13-24.
  • McCurdy, DG, Forbes, MR & JS Boates. 1999. Evidence that the parasitic nematode Skrjabinoclava manipulates host Corophium behavior to increase transmission to the sandpiper, Calidris pusilla. Behav. Ecol. 19: 351-357.
  • Safriel, UN. 1975. On the significance of clutch size in nidifugous birds. Ecology 56: 703-708.
  • Schneider, DC & BA Harrington. 1981. Timing of shorebird migration in relation to prey depletion. The Auk 98: 801-811.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Semipalmated sandpipers impact populations of their prey. They also are host to parasites such as parasitic nematodes (Skrjabinoclava morrisoni) which are transmitted through ingesting amphipods Corophium volutator. Eggs and chicks often are eaten by predators such as gulls, jaegers, and foxes.

Commensal/Parasitic Species:

  • Parasitic nematodes (Skrjabinoclava morrisoni)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The predominate predators of the semipalmated sandpiper are merlins (Falco columbarius) and other members of the falcon, and accipitor families. Other documented predators include snowy owls and some jaegers.

Known Predators:

Anti-predator Adaptations: cryptic

  • McCurdy, D., M. Forbes, J. Boates. 1999. Evidence that the parasitic nematode Skrjabinoclava manipulates host Corophium behavior to increase transmission to the sandpiper, Calidris pusilla.. Behavioral Ecology, 19: 351-357.
  • Safriel, U. 1975. On the significance of clutch size in nidifugous birds.. Ecology, 56: 703-708.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although there are no obligate associations documented between the semipalmated sandpiper and other species, C. pusilla is commonly found alongside other organisms from the salt marshes, tidal flats and sandy beach habitats in which it resides. For more extensive information on these ecosystems and their associated species found in and around the IRL, please visit the Salt Marsh, Tidal Flat and Beach Habitat pages.
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
  • Audubon. 2010. Semipalmated Sandpiper. National Audubon Society. Online at http://web1.audubon.org/science/species/watchlist/profile.php?speciesCode=semsan (Date accessed: 08/10/2010).
  • Collazo, JA, O'Harra, DA & CA Kelly. 2002. Accessible habitat for shorebirds: factors influencing its availability and conservation implications. Waterbirds 25: 13-24.
  • McCurdy, DG, Forbes, MR & JS Boates. 1999. Evidence that the parasitic nematode Skrjabinoclava manipulates host Corophium behavior to increase transmission to the sandpiper, Calidris pusilla. Behav. Ecol. 19: 351-357.
  • Safriel, UN. 1975. On the significance of clutch size in nidifugous birds. Ecology 56: 703-708.
  • Schneider, DC & BA Harrington. 1981. Timing of shorebird migration in relation to prey depletion. The Auk 98: 801-811.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Possiby the most abundant shorebird. Morrison et al. (2001) estmiated the total population as 3.5 million (range 2-5 million).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The semipalmated sandpiper is considered the most abundant migratory 'peep' and one of the most numerous shorebirds in North America (Peterson 1980; Kale 1990). Detailed abundance records for sandpiper populations within the IRL are scarce. However, birds are known to stopover throughout Florida during spring and fall migrations, and some individuals may winter in Florida Bay (Kale 1990).
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
  • Audubon. 2010. Semipalmated Sandpiper. National Audubon Society. Online at http://web1.audubon.org/science/species/watchlist/profile.php?speciesCode=semsan (Date accessed: 08/10/2010).
  • Collazo, JA, O'Harra, DA & CA Kelly. 2002. Accessible habitat for shorebirds: factors influencing its availability and conservation implications. Waterbirds 25: 13-24.
  • McCurdy, DG, Forbes, MR & JS Boates. 1999. Evidence that the parasitic nematode Skrjabinoclava manipulates host Corophium behavior to increase transmission to the sandpiper, Calidris pusilla. Behav. Ecol. 19: 351-357.
  • Safriel, UN. 1975. On the significance of clutch size in nidifugous birds. Ecology 56: 703-708.
  • Schneider, DC & BA Harrington. 1981. Timing of shorebird migration in relation to prey depletion. The Auk 98: 801-811.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Average territory size 1 ha on breeding grounds in Manitoba (Gratto et al. 1985). Seen in association with least sandpiper, sanderling, and semipalmated plover. Often in large flocks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Semipalmated sandpipers use vocal and visual forms of communication. Many calls have been linked specific situations and functions. For example, a soft 'cher' is often made from individuals of a large roosting flock to convey safety or lack of threat. This 'cher' is quickly replaced by a loud 'churt' when predators are detected. Other calls have been described for nest defense, chick defense, injury feigning, copulation, short-range communication between mates, calling chicks, and brooding.

Males use aerial displays to attract mates to established territories. These displays include a "motorboat" call given while hovering in midair.

Semipalmated sandpipers perceive auditory, tactile, visual, and chemical stimuli.

Communication Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: See Robert et al. (1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Annually it is estimated that 50% to 70% of adult semipalmated sandpipers survive. Some causes of mortality (degree of impact unknown) include illegal poaching on wintering grounds and botulism. It has been noted that juveniles have much lower fat reserves than adults when they arrive at wintering grounds, but how that affects survivorship is unknown. Longest known living individual was a female at 16 years old. The odds of a survival until age of 16 are 1 in 10000 if survival rate is ~50%.

Range lifespan

Status: wild:
16 (high) years.

  • Gratto-Trevor, C., C. Vacek. 2001. Longevity Record and Annual Adult Survival of Semipalmated Sandpipers. THE WILSON BULLETIN, 113/3: 348-350.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.3 years (wild) Observations: In the wild, average IMR has been estimated at 0.3 per year (http://bna.birds.cornell.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Begins breeding late May or early to mid-June. Usually 4 eggs incubated by both sexes, in turn, 18-21.5 days. Young tended by both parents, can fly at 14-19 days. May have same mate in successive years. Breeding population includes some yearlings. Up to 20 nests per sq km in some areas of northern Alaska.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Semipalmated sandpipers breed from late May to July. Upon arriving at the breeding grounds, males establish territories from which to display to females arriving about a week later. Males perform aerial displays at 5 to 9 m where they hover and produce "motorboat" calls. These aerial displays are well suited to their relatively open habitat where visibility is high. The male excavates up to 10 to 12 scrapes among sparse vegetation within his territory for females to choose from. The female will then select 2 to 3 of these scrapes (although only one is used) to begin lining with vegetation and other organic matter. Semipalmated sandpipers form monogamous pairs.

Mating System: monogamous

Semipalmated sandpipers breed from May through July. After mating, the male defends the territory while the female lays eggs in the nest. Females typically lay 3 to 4 eggs per brood in 24 to 32 hour intervals. Incubation of the eggs, which is done by both parents, lasts 18 to 22 days. Like all scolopacids, semipalmated sandpipers are precocial at birth and begin actively foraging within hours of hatching. The young fledge 16 to 19 days after hatching. Semipalmated sandpipers reach sexual maturity at 1 year old.

Breeding interval: Semipalmated sandpipers produce one brood per year.

Breeding season: Semipalmated sandpipers breed from May to July.

Range eggs per season: 3 to 4.

Average eggs per season: 4.

Range time to hatching: 18 to 22 days.

Range fledging age: 16 to 19 days.

Average fledging age: 19 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Semipalmated sandpipers provide parental care for their young starting with incubation by both parents. Incubation lasts 20 to 22 days. Both parents participate in feeding and protecting the young for up to 11 days. Between 6 to 11 days after the chicks hatch the parents abandon the brood at separate times with the female being the first to leave nearly 91% of the time. Females stay with their young on average 6 days after they are hatched then leave their young to be provided for by their mate. The male continues to make a night scrape for the young for 6 to 8 days after hatching. The male abandons the brood on average 8 days after female, regardless of whether or not chicks have fledged.

Parental Investment: precocial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Male, Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Protecting: Male); pre-independence (Provisioning: Male, Protecting: Male)

  • 2009. "The Cornell Lab of Ornithology" (On-line).
    All About Birds
    . Accessed February 11, 2010 at http://www.allaboutbirds.org/guide/Semipalmated_Sandpiper/id.
  • Gratto-Trevor, C. 1991. Parental care in Semipalmated Sandpipers Calidris pusilla: brood desertion by females. Ibis, 133/4: 394-399.
  • Hicklin, P., C. Gratto-Trevor. 2010. "The Birds of North America" (On-line). Semipalmated Sandpiper (Calidris pusilla). Accessed November 16, 2010 at http://bna.birds.cornell.edu/bna/species/006.
  • Peterson, R., M. DiGirgio, P. Lehmen, M. O'Brien, L. Rosche, B. Thompson III. 2009. Field Guide to Birds of North America. New York: Houghton Mifflin Books.
  • del Hoyo, J., A. Elliott, J. Sargatal. 1996. Handbook of Birds of the World Vol III. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The leaf and grass-lined nests of C. pusilla are typically built on wet arctic tundra near lakes or on grassy dunes at low elevations (Terres 1980). Eggs are yellow, tan or olive with cinnamon, hazel or chestnut colored spots (Terres 1980). Clutch size is generally four per nest, suggested by some studies as the maximum number of hatchlings that can be successfully protected by the parents (Safriel 1975). Both parents incubate the eggs until they hatch, a period of about 18-22 days, at which time the females usually vacate the nest and leave the males to brood the hatchlings (Safriel 1975; Terres 1980). Most young are capable of flight 14-19 days after hatching (Terres 1980).Voice: Semipalmated sandpipers emit a variety of calls, depending on the circumstance. During flight, vocal communication consists of a loud cherk, chert, or chut, which may be doubled. Breeding adults produce a "motorboat" song followed by buzzing. All calls are lower and lack the ee characteristic of the least and western sandpipers (Peterson 1980; Terres 1980; Paulson 2005). Temperature &
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
  • Audubon. 2010. Semipalmated Sandpiper. National Audubon Society. Online at http://web1.audubon.org/science/species/watchlist/profile.php?speciesCode=semsan (Date accessed: 08/10/2010).
  • Collazo, JA, O'Harra, DA & CA Kelly. 2002. Accessible habitat for shorebirds: factors influencing its availability and conservation implications. Waterbirds 25: 13-24.
  • McCurdy, DG, Forbes, MR & JS Boates. 1999. Evidence that the parasitic nematode Skrjabinoclava manipulates host Corophium behavior to increase transmission to the sandpiper, Calidris pusilla. Behav. Ecol. 19: 351-357.
  • Safriel, UN. 1975. On the significance of clutch size in nidifugous birds. Ecology 56: 703-708.
  • Schneider, DC & BA Harrington. 1981. Timing of shorebird migration in relation to prey depletion. The Auk 98: 801-811.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calidris pusilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNTATACCTAATCTTTGGTGCATGAGCCGGTATAGTCGGAACTGCCCTTAGCCTGCTCATTCGTGCAGAACTAGGTCAACCCGGAACCCTTTTAGGAGATGACCAGATCTACAATGTTATTGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATGCCAATTATAATTGGCGGCTTCGGAAATTGACTAGTCCCACTTATAATCGGTGCCCCTGACATAGCATTCCCTCGTATAAACAACATAAGCTTCTGACTACTACCCCCATCATTCCTACTACTACTAGCATCATCTACAGTAGAAGCCGGAGCAGGTACAGGATGAACAGTATATCCCCCACTTGCCGGCAACCTAGCTCATGCTGGAGCCTCCGTAGACCTAGCCATCTTCTCTCTCCATCTAGCAGGTGTCTCCTCCATTCTAGGTGCTATCAACTTCATCACAACCGCCATTAACATAAAACCTCCAGCCCTCTCCCAATACCAAACACCTCTATTCGTGTGATCAGTACTTATCACCGCTGTTCTACTTTTACTCTCTCTCCCAGTTCTTGCTGCCGGCATTACCATACTACTAACAGACCGAAACCTAAATACCACATTCTTCGATCCCGCCGGAGGAGGAGACCCAGTCCTATACCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTTTACATCCTAATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Calidris pusilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B - Apparently Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Taylor, J. & Butchart, S.

Contributor/s
Andres, B., Mizrahi, D., Brown, A. & Lesterhuis, A.

Justification
This species has been uplisted to Near Threatened because it is estimated to have undergone a moderately rapid decline over the past three generations (22 years). Over-exploitation in the non-breeding range (in particular in Suriname) may be the principal driver of declines, with eastern-breeding populations also potentially declining due to reduced food supply at key staging sites, but further information on the rate and drivers of declines is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Semipalmated Sandpipers are not threatened, however population surveys starting in 1986 have showed a slight decrease in overall population size. The decline is suspected to be a result of human activity. Specific impacts by people include destruction and manipulation of shorelines and wetlands which are habitats for semipalmated sandpipers during both breeding and nonbreeding seasons. Large scale baitworm harvest along coastal areas in known stopping grounds for semipalmated sandpipers has been shown to negatively affect the birds feeding habits due to scarcity of food resources. Poaching of semipalmated sandpipers still occurs on their wintering grounds in South America and is suspected to have a significant effect on populations. Pollution is also suspected to have a negative effect.

Canada and the United States have created detailed conservation plans to protect and enhance staging grounds for migratory shorebirds, including semipalmated sandpipers.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population was formerly estimated at 3.5 million individuals, but this was revised downwards to 2.2 million individuals in 2006 (Morrison et al. 2006, A. Lesterhuis in litt. 2009) assuming annual declines of 5% in 75% of the North American population.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Hunting of shorebirds in northern South America, which is legal in French Guiana but illegal in Suriname, is widespread and thus a potential threat to C. pusilla. Shorebirds killed by hunters in Suriname are estimated to number several tens of thousands annually, involving mainly C. pusilla and Tringa flavipes: if 20,000 C. pusilla were removed from a population of two million annually (1% decrease, net after recruitment), the decline would amount to some 26% over 30 years, independent of other mortality, suggesting hunting could be a significant factor in the observed declines (Morrison et al. 2012). Poaching in Suriname may have increased over the last c.20 years owing to improvements in weaponry and transportation. Another potential threat is the harvesting of horseshoe crabs Limulus polyphemus in Delaware Bay, an area which reportedly sees the passage of c.60% of the total population of C. pusilla during the spring migration. The species feeds primarily on horseshoe crab eggs during episodes of rapid mass accumulation, but harvest pressure from 1995-2005 dramatically reduced egg availability (Mizrahi et al. 2012). Significant changes in the intertidal profile, for unknown reasons, have taken place along the coast of the Guianas, although numbers of birds were also lower in areas with no obvious changes in mudflat area (Morrison et al. 2012). Use of pesticides in agricultural areas such as rice fields may affect shorebirds using those habitats directly, and drainage of pesticides into coastal areas and onto mudflats also has the potential to affect shorebirds (Morrison et al. 2012). Small-scale gold mining has increased considerably in the northern South American wintering range, and mercury, which is used in the extraction process and can reach the coast via the rivers, has the potential to affect shorebirds in coastal areas (Morrison et al. 2012). Oil exploration has also begun in Suriname and Guyana, with spills representing a further potential threat. Increasing frequency and severity of hurricanes during southbound migration may be causing increased mortality during this period (Morrison et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
No species-specific actions are known. Hunting of shorebirds is illegal in Suriname, but this is poorly enforced. An adaptive management plan for Delaware Bay was formally adopted by the Atlantic States Marine Fisheries Commission in 2012. The plan links harvest decisions to information on the welfare of both horseshoe crab and Red Knot Calidris canutus population levels as well as the use of crabs for bait and by the medical industry, and calls for crab harvest levels to be regularly adjusted in response to data on Red Knot and horseshoe crab populations.

Conservation Actions Proposed
Carry out systematic monitoring in breedng areas, key staging sites and wintering sites. Evaluate key threats, in particular mortality from hunting. Campaign for better enforcement of hunting regulations and the introduction of these where they do not currently exist. Support adaptive management plan for horseshoe crab harvest in Delaware Bay.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Spring migration of semipalmated sandpipers is critically dependent upon food resource availability on the staging grounds. Delaware Bay, among other east coast locations, is considered an essential stopover for the 3000 to 4000 km journey. Spring migration coincides with the spawning of horseshoe crabs which provides millions of energy-rich eggs to resting semipalmated sandpipers. Unfortunately, the horseshoe crab industry ultimately depends on these eggs as well. Semipalmated sandpipers then compete with the horseshoe crab industry and can impact the economic well-being of the industry.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Historically semipalmated sandpipers were hunted as game birds, however this is now illegal in the United States under the Migratory Bird Treaty Act of 1918. The mass migration of semipalmated sandpipers and other shorebirds is a major attraction, bringing avid birders to coastal staging areas in spring and fall.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats & Conservation: Unlike the related red knot, Calidris canutus rufa, populations of the semipalmated sandpiper are strong and no special status has been issued for the species. However, C. pusilla is protected under the Migratory Bird Treaty Act of 1918, which prohibits the harassment, capture, kill and/or possession of listed migratory species (e.g. USFWS 2010). In addition, further conservation efforts by The Western Hemisphere Shorebird Reserve Network are ongoing through the protection of key nesting and stopover sites (Audubon 2010).
  • Farrand Jr., J (Ed.). 1983. The Audubon Society Master Guide to Birding Volume 1: Loons to Sandpipers. Alfred A. Knopf. New York. USA. 447 pp.
  • Kale II, HW & DS Maehr. 1990. Florida's Birds. Pineapple Press. Sarasota, FL. USA. 288 pp.
  • Paulson, D. 2005. Shorebirds of North America: A Photographic Guide. Princeton Univ. Press. Princeton, NJ. USA. 361 pp.
  • Peterson, RT. 1980. A Field Guide to the Birds: A Completely New Guide to All the Birds of Eastern and Central North America. Houghton Mifflin. Boston, MA. USA. 384 pp.
  • Terres, JK. 1980. The Audubon Society Encyclopedia of North American Birds. Alfred A. Knopf. New York. USA. 1109 pp.
  • USFWS. 2010. Migratory Birds and Habitat Programs. U.S. Fish and Wildlife Service. Online at http://www.fws.gov/laws/lawsdigest/migtrea.html (Date accessed: 08/10/2010).
  • Audubon. 2010. Semipalmated Sandpiper. National Audubon Society. Online at http://web1.audubon.org/science/species/watchlist/profile.php?speciesCode=semsan (Date accessed: 08/10/2010).
  • Collazo, JA, O'Harra, DA & CA Kelly. 2002. Accessible habitat for shorebirds: factors influencing its availability and conservation implications. Waterbirds 25: 13-24.
  • McCurdy, DG, Forbes, MR & JS Boates. 1999. Evidence that the parasitic nematode Skrjabinoclava manipulates host Corophium behavior to increase transmission to the sandpiper, Calidris pusilla. Behav. Ecol. 19: 351-357.
  • Safriel, UN. 1975. On the significance of clutch size in nidifugous birds. Ecology 56: 703-708.
  • Schneider, DC & BA Harrington. 1981. Timing of shorebird migration in relation to prey depletion. The Auk 98: 801-811.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Semipalmated Sandpiper

The semipalmated sandpiper (Calidris pusilla) is a very small shorebird. It is sometimes separated with other "stints" in Erolia, but, although these apparently form a monophyletic group, the present species' old genus Ereunetes had been proposed before Erolia.

Description[edit]

Adults have black legs and a short, stout, straight dark bill. The body is dark grey-brown on top and white underneath. The head and neck are tinged light grey-brown. This bird can be difficult to distinguish from other similar tiny shorebirds, in particular the western sandpiper; these are known collectively as "peeps" or "stints".

Breeding and habitat[edit]

Their breeding habitat is the southern tundra in Canada and Alaska near water. They nest on the ground. The male makes several shallow scrapes; the female chooses one and adds grass and other material to line the nest. The female lays 4 eggs; the male assists in incubation. After a few days, the female leaves the young with the male; the young feed themselves.

These birds forage on mudflats, picking up food by sight and feel (bill). They mainly eat aquatic insects and crustaceans.

Status and migration[edit]

They are long distance migrants and winter in coastal South America, with some going to the southern United States. They migrate in flocks which can number in the hundreds of thousands, particularly in favoured feeding locations such as the Bay of Fundy and Delaware Bay. This species is a rare but regular vagrant to western Europe.

Although very numerous, these birds are highly dependent on a few key stopover habitats during their migration, notably Mary's Point and Johnson's Mills along Shepody Bay, an arm of the Bay of Fundy.[2] During the months of July and August, the Nature Conservancy of Canada runs an information center about these shorebirds in Johnson's Mills, New Brunswick.[3]

Long Island, NY, April 2004. By Tony Phillip.

Problems playing this file? See media help.

References[edit]

Further reading[edit]

Identification[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: C. PUSILLA and C. MAURI are often placed in the genus EREUNETES (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!