Articles on this page are available in 3 other languages: Spanish (8), Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

With its relatively long slightly curved sensitive bill and good eyesight, the dunlin finds its food by both sight and feel. When it finds a good spot to forage, it pricks the bottom like a sewing machine. Dunlins are the most common sandpiper species in Europe. You can find enormous groups in the wadden and delta regions, swirling through the air in synchronized flight.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Calidris alpina

While many North Americans know this medium-sized (8-9 inches) sandpiper as a plain, gray bird of the winter shoreline, the Dunlin has a summer plumage which is much more striking. During the breeding season, this sandpiper is rusty-red speckled with brown above with a white eye-stripe, long black bill, black legs, and black breast patch. In winter, this species sheds its summer colors and becomes gray above with a white breast and gray throat. Male and female Dunlins are similar in summer and winter plumages. The Dunlin breeds across arctic and subarctic regions of the Northern Hemisphere. In North America, this species breeds primarily along northwestern portions of the Hudson Bay, with smaller populations breeding in Alaska and the islands in the Canadian arctic. Most Dunlin breeding in North America winter along both coasts of the continent south to central Mexico. In the Old World, this species breeds across northern Russia, Northern Europe, and Iceland, wintering as far south as the Mediterranean Sea, West Africa, South Asia, and the Oceania. In summer, Dunlins breed on relatively wet, boggy tundra. During the winter, this species primarily inhabits shorelines of sandy beaches, although some birds winter on agricultural land in California’s Central Valley. The diet of the Dunlin is comprised mostly of small aquatic invertebrates such as crustaceans and mollusks, although insects may also be eaten when available. Due to its remote breeding habitat, most birdwatchers never see the Dunlin during the summer. In winter, this species may be observed in groups probing the sand for food with their bills and running to avoid incoming waves. Dunlins are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Iceland, New Zealand Exclusive Economic Zone, North West Atlantic, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lives in summer from 53°N untill the Polar Circle
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: northern Alaska, northern Mackenzie, northeastern Keewatin, and southern Somerset Island south to coastal western Alaska, Southampton Island, northeastern Manitoba, and northern Ontario; eastern Greenland, Iceland, Sptizbergen, Novaya Zemlya, arctic coast of Siberia, Kamchatka Peninsula, and Sakhalin Island south to British Isles, Baltic region, northern Russia, and northern China (AOU 1983, Browning 1991). WINTERS: along Pacific coast from southeastern Alaska south to Baja California and Sonora, on Atlantic-Gulf-Caribbean coast from Massachusetts south to Florida, west to Texas, south to Yucatan Peninsula; in Old World from southern Europe and southern Asia to Cape Verde Islands, northern Afria, Arabia, Indian coast, and Formosa (AOU 1983); occasionally in Hawaii. Nonbreeders often summer in winter range. The Yukon-Kuskokwim Delta, Alaska, is an important migration stop in western North America (Handel and Gill 1992). See Browning (1991) for information on the distribution of subspecies in northern Alaska and eastern Siberia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Canadian Arctic to Atlantic and Pacific coasts of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 22 cm

Weight: 60 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 21 cm., Wingspan: 42.5 cm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is a fully migratory circumpolar breeder with several sub-populations that employ a number of migration strategies, from short coastal flights to long, non-stop flights overland on a broad front1. The sub-population that breeds in north-east Greenland migrates through Iceland, Britain and western France to arrive in its West African wintering grounds (specifically Banc d'Arguin in Mauritania) from late-July, returning again between March and early-April1. European birds may gather in large congregations from the beginning of July in areas such as the Wadden Sea or the Wash to moult1, and some juveniles may remain in the non-breeding range all year1. The species breeds dispersed or aggregated in loose colonies, and travels in group sizes of up to 1,500 on passage, remaining in large groups (up to hundreds of thousands of birds) throughout the non-breeding season1, 2. The species is active both diurnally and nocturnally1, 2, 3. Habitat Breeding In the breeding season this species frequents moist boggy ground interspersed with surface water, such as tussock tundra and peat-hummock tundra in the arctic, as well as wet coastal grasslands, salt marshes and wet upland moorland1, 2. Non-breeding In the non-breeding season this species mainly prefer estuarine mudflats, but also frequent a wide variety of freshwater and brackish wetlands1, 2, both coastal and inland, including lagoons, muddy freshwater shores, tidal rivers, flooded fields, sewage farms, salt-works, sandy coasts1, 2, lakes and dams4. For roosting during high tides and at night this species prefers large fields of naturally fertilised short pasture or soil-based crops with few vertical structures that could be used by predators3. Diet Breeding This species is omnivorous during the breeding season, consuming mostly adult and larval insects (dipteran flies, beetles, caddisflies, wasps, sawflies and mayflies), and also spiders, mites, earthworms, snails, slugs and plant matter (usually seeds)1, 2. Non-breeding It is also omnivorous during the non-breeding season, consuming mostly polychaete worms and small gastropods, as well as insects (dipteran flies and beetles), crustaceans, bivalves, plant matter and occasionally small fish1, 2. Breeding site Its nest is a scrape or shallow depression in the ground, concealed in vegetation and sometimes in a tuft or tussock (and thus raised slightly off the ground)1, 2. Management information The provision of well-surfaced paths in breeding areas that recieve > 30 visitors a day has been shown to reduce the impact of human disturbance on this species' reproductive performance7. It is also known to show increased hatching successes when ground predators have been excluded by erecting protective fences around nesting areas9.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 154 specimens in 1 taxon.
Water temperature and chemistry ranges based on 33 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 0.664 - 12.736
  Nitrate (umol/L): 1.402 - 7.811
  Salinity (PPS): 30.100 - 35.391
  Oxygen (ml/l): 6.076 - 7.958
  Phosphate (umol/l): 0.256 - 1.104
  Silicate (umol/l): 0.987 - 4.454

Graphical representation

Temperature range (°C): 0.664 - 12.736

Nitrate (umol/L): 1.402 - 7.811

Salinity (PPS): 30.100 - 35.391

Oxygen (ml/l): 6.076 - 7.958

Phosphate (umol/l): 0.256 - 1.104

Silicate (umol/l): 0.987 - 4.454
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Nonbreeding: mudflats, estuaries, marshes, flooded fields, sandy or gravelly beaches, and shores of lakes, ponds, and sloughs (AOU 1983, Smith and Connors 1993). In central California, movements from coastal habitats to inland habitats occurred in conjunction with winter storms (heavy rain) (Warnock et al. 1995). On the Yukon-Kuskokwim Delta, Alaska, major diurnal roost sites were adjacent to intertidal feeding areas, provided a unobstructed view of predators, and were close to shallow waters used for bathing (Handel and Gill 1992). Nests in wet coastal tundra (AOU 1983), grass or sedge tundra with pools and bogs. Nests on the ground, usually in drier sites such as strangmoor ridges.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tidal flats, beaches, muddy pools, wet marshy tundra.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates mainly along coasts, smaller numbers in interior North America. Begins migrating northward along Atlantic and Pacific coasts of North America in March-April, arrives in northern Alaska in late May. After fledging, juveniles move to coastal habitat in late July and early August in northern Alaska; adults move to upland areas. Departs breeding grounds late August or September. Breeders banded at Point Barrow, Alaska, were recaptured in October at Cape Lazarev, Siberia, and Sakhalin Island (see Browning 1991). Postbreeders roost in large flocks and feed on expansive intertidal mudflats of the Yukon-Kuskokwim Delta, Alaska, from July until early October, then to southeastern Asia and California (Handel and Gill 1992). Southbound migrants reach central California coast by mid-October. Often migrates in large flocks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migrates short distances from the Canadian Arctic to the coast.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: During the breeding season feeds primarily on larvae of flies and mosquitoes. During the rest of the year feeds on crustaceans, marine worms, mollusks, and insects. Migrants in spring in south-central Alaska relied heavly on clams, Macoma balthica (Senner et al. 1989). Consumes large numbers of horseshoe crab eggs in spring at Delaware Bay (Castro and Myers 1993). Runs around feeding areas probing mud and sand with bill.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Insects, crustaceans, marine worms, snails, mollusks, amphipods, small fish, sometimes plant material.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Calidris alpina (Calidris alpinea dunlin) preys on:
Littorina
Hydrobia
Corophium
Cardium
Macoma
Nereidae
Nereis diversicolor
Corophium volutator
Hydrobia ulvae
Mytilus edulis

Based on studies in:
Scotland, Ythan estuary (Littoral, Mudflat)
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • H. Milne and G. M. Dunnet, Standing crop, productivity and trophic relations of the fauna of the Ythan estuary. In: The Estuarine Environment, R. S. K. Barnes and J. Green, Eds. (Applied Science Publications, Edinburgh, Scotland, 1972), pp. 86-106, from
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Calidris alpina (Calidris alpinea dunlin) is prey of:
Himasthla elongata
Levinseniella brachysoma
Maritrema gratiosum
Spelotrema clariforma

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Morrison et al. (2001) estimated the global population to be at least 3,934,000, with North American populations ranging up to 1,525,000 individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Nonbreeding: often in large flocks, which in some roosting areas may include 10,000s (Handel and Gill 1992). Often seen in association with sanderlings and other shorebirds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Spring migrants in south-central Alaska rested during high tides and fed most heavily during falling tides (Senner et al. 1989). On the Yukon-Kuskokwim Delta, Alaska, roosting varied with time of day, tide level, and season (Handel and Gill 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 28.8 years (wild) Observations: In the wild, average lifespan is around 5 years (John Terres 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Breeding begins late May to early June in the Western Hemisphere (clutches completed mainly mid-June in Beaufort Sea area). Both sexes, in turn, incubate 4 eggs for 21-22 days. Nestlings are precocial and downy. Young are independent in about 25 days (Harrison 1978). Often nests near other pairs of dunlins. In northern Alaska, up to 15 nests per sq km have been recorded in several areas of coastal tundra and sites a few miles inland.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nest is built in a well-hidden location on the ground. 4 eggs incubated by both partners for 20-23 days. Young can feed themselves and are tended by both parents. First flight occurs at 18-26 days old.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calidris alpina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTATACCTAATCTTCGGCGCATGAGCTGGTATAGTTGGAACCGCCCTTAGCCTACTCATTCGTGCAGAACTAGGTCAACCTGGGACTCTTTTAGGAGATGACCAAATTTACAATGTTATTGTCACCGCACATGCCTTTGTAATAATCTTCTTCATAGTAATACCAATCATAATTGGTGGCTTCGGAAACTGACTGGTCCCACTTATAATCGGTGCCCCTGACATAGCATTCCCTCGCATAAACAACATAAGCTTCTGACTACTACCCCCATCATTCCTACTACTACTGGCATCATCTACAGTAGAAGCAGGTGCAGGTACAGGATGAACAGTATATCCTCCACTTGCTGGCAACTTAGCCCATGCCGGAGCTTCCGTAGACCTAGCTATCTTCTCTCTCCACTTAGCAGGTGTCTCCTCCATCCTAGGTGCTATTAATTTTATCACAACTGCTATTAACATAAAACCCCCAGCCCTCTCCCAATACCAAACACCCCTATTCGTATGATCAGTACTCATTACCGCTGTCTTACTATTACTCTCTCTCCCAGTCCTCGCTGCTGGTATTACTATGCTACTAACAGACCGAAACCTAAACACTACATTCTTCGACCCCGCCGGAGGAGGAGACCCAGTTCTATATCAACATCTCTTCTGATTCTTTGGCCACCCAGAAGTCTACATCCTAATTCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Calidris alpina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A population decline has been noted recently. There is no official conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Breeding This species is significantly threatened by the loss of its breeding habitat though afforestation of moorland1, 8. It may also suffer from nest predation by introduced mammals (e.g. European hedgehog Erinaceus europeaus) on some islands9. Non-breeding In the winter this species is restricted to a small number of estuaries, so it is vulnerable to any changes in this habitat for example through land reclamation (drainage)1, and the invasion of alien plant species (such as the grass Spartina anglica which has spread on British mudflats, resulting in the reduction in size of feeding areas available)1. The species is also threatened by disturbance on intertidal mudflats from construction work (UK)10 and foot-traffic on footpaths11. Important migratory stop-over habitats on the Baltic Sea coastline adjacent to the Kaliningrad region of Russia are threatened by petroleum pollution, wetland drainage for irrigation, peat-extraction, reedbed mowing and burning, and abandonment and changing land management practices leading to scrub and reed overgrowth6. The species is also susceptible to avian influenza (strain H5N1 in particular) and is therefore threatened by outbreaks of the virus5.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dunlin

The Dunlin (Calidris alpina) is a small wader, sometimes separated with the other "stints" in Erolia. It is a circumpolar breeder in Arctic or subarctic regions. Birds that breed in northern Europe and Asia are long-distance migrants, wintering south to Africa, southeast Asia and the Middle East. Birds that breed in Alaska and the Canadian Arctic migrate short distances to the Pacific and Atlantic coasts of North America, although those nesting in Northern Alaska overwinter in Asia. Many Dunlins winter along the Iberian south coast.

Contents

Behavior

Wintering on Florida's Gulf Coast.

The Dunlin is highly gregarious in winter, sometimes forming large flocks on coastal mudflats or sandy beaches. Large numbers can often be seen swirling in synchronized flight on stop-overs during migration or on their winter habitat.

This bird is one of the most common and best-known waders throughout its breeding and wintering ranges, and it is the species with which other waders tend to be compared. At 17–21 cm length and a 32–36 cm wingspan, it is similar in size to a Common Starling, but stouter, with a thick bill.

The Dunlin moves along the coastal mudflat beaches it prefers with a characteristic "sewing machine" feeding action, methodically picking small food items. Insects form the main part of the Dunlin's diet on the nesting grounds; it eats mollusks, worms and crustaceans in coastal areas.

On the East coast of England

Appearance

An adult Dunlin in breeding plumage shows the distinctive black belly which no other similar-sized wader possesses. The winter Dunlin is basically grey above and white below. Juveniles are brown above with two whitish "V" shapes on the back. They usually have black marks on the flanks or belly and show a strong white wingbar in flight.

The legs and slightly decurved bill are black. There are a number of subspecies differing mainly in the extent of rufous coloration in the breeding plumage and the bill length. It should, however, be noted that bill length varies between sexes, the females having longer bills than the males.

Nesting

The nest is a shallow scrape on the ground lined with vegetation, into which typically four eggs are laid and incubated by the male and female parents. Chicks are precocial, however are brooded during early development. They start to fly at approximately three weeks of age. The majority of brood care is provided by the male, as the female deserts the brood and often leaves the breeding area.

The call is a typical sandpiper "peep", and the display song a harsh trill.

The Dunlin is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Apparent hybrids between this species and the White-rumped Sandpiper as well as with the Purple Sandpiper have been reported from the Atlantic coasts of North America (McLaughlin & Wormington, 2000, and external link below) and Europe (Millington, 1994), respectively.

References

  • McLaughlin K. A. & Wormington, A. (2000): An apparent Dunlin × White-rumped Sandpiper hybrid. Ontario Birds 18(1): 8-12.
  • Martin-Löf, P. (1961). "Mortality rate calculations on ringed birds with special reference to the Dunlin Calidris alpina". Arkiv för Zoologi (Zoology files), Kungliga Svenska Vetenskapsakademien (The Royal Swedish Academy of Sciences) Serie 2 Band 13 (21).
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Browning (1991) for taxonomic information on dunlins from northern Alaska and eastern Siberia. Wenink et al. (1996) examined mtDNA variation among 15 breeding populations throughout the circumpolar range and found five major phylogeographic groups, each corresponding to a morphometrically defined subspecies, but other recognized subspecies were not supported by monophyletic mtDNA lineages within their purported ranges.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!