Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) BREEDING: northern and western Alaska (Point Barrow and Seward Peninsula, possibly elsewhere) and northeastern Siberia. NON-BREEDING: from southern China south to Andaman and Nicobar Islands, East Indies, New Guinea, Bismarck and Solomon Islands, Australia, Tasmania, and New Zealand. MIGRATION: coastal northern Alaska, through Pribilofs and Aleutians, widely in coastal western and south-coastal Alaska, casually southward to California (AOU 1983). Accidental in Hawaii and northeastern U.S.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeds Siberia and Alaska; disperses to s Asia and Australasia.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 15 cm

Weight: 36 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Length: 13-16 cm. Plumage: above grey; below white with partial grey band on chest; white superciliary line; transitional dress above dark with paler edges to feathers; wing-coverts grey, throat, foreneck and breast washed pale rufous becoming bright rufous in breeding birds. Immature like adult but brighter above. Bare parts: iris dark brown; bill black; feet and legs black, toes long. Habitat: tidal lagoons, mudflats, saltpans. Rare palearctic migrant. <389><391><393>
  • Urban, E.K., C.H. Fry & S. Keith (1986). The Birds of Africa, Volume II. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: NON-BREEDING: tidal mudflats and beaches; migrant flocks may pause in open areas such as antenna fields and airstrips (AOU 1983, Pratt et al. 1987). BREEDING: Swampy or mossy tundra, especially with scattered willow scrub (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Total population estimated to be 471,000 (Morrison et al. 2001). Listed as "by far the most common stint" on Asian and Australian wintering grounds by Paulson (1993). A few dozen breed in Alaska (Morrison et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calidris ruficollis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACCTAATCTTCGGTGCATGAGCTGGTATAGTCGGAACCGCCCTCAGCCTGCTCATCCGTGCAGAACTAGGCCAGCCCGGAACCCTTCTAGGAGATGACCAAATCTATAACGTCATTGTCACCGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATGCCAATCATAATTGGTGGCTTCGGAAATTGACTAGTTCCACTTATAATTGGTGCCCCTGACATAGCATTCCCTCGCATGAACAACATAAGCTTTTGATTACTACCTCCATCATTCCTACTGCTTCTAGCATCATCTACAGTAGAAGCCGGAGCAGGTACAGGATGGACAGTATACCCCCCACTTGCTGGCAACTTAGCCCATGCCGGAGCTTCTGTAGACCTAGCTATCTTCTCCCTCCACCTAGCAGGTGTCTCTTCTATTCTAGGTGCTATTAACTTCATCACAACTGCCATTAATATAAAACCCCCAGCCCTCTCCCAATACCAAACACCCCTATTTGTATGATCAGTACTTATCACCGCCGTCCTACTTCTACTTTCTCTCCCAGTTCTCGCTGCTGGTATCACCATACTATTAACAGATCGAAATCTAAACACCACATTCTTTGACCCCGCTGGAGGCGGAGACCCAGTCCTATACCAACACCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Calidris ruficollis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3B - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Moderately large range, but no evidence of declines or major threat on either breeding or non-breeding grounds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.320,000 individuals (Wetlands International, 2006), while national population estimates include: < c.10,000 individuals on migration and c.1,000-10,000 wintering individuals in China; > c.1,000 individuals on migration and > c.1,000 wintering individuals in Taiwan; > c.1,000 individuals on migration in Korea; < c.10,000 individuals on migration and c.50-10,000 wintering individuals in Japan and c.100,000-1 million breeding pairs and > c.10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-necked stint

The red-necked stint (Calidris ruficollis) is a small migratory wader.

Description[edit]

These birds are among the smallest of waders, very similar to the little stint, Calidris minuta, with which they were once considered conspecific. The red-necked stint's small size, fine dark bill, dark legs and quicker movements distinguish this species from all waders except the other dark-legged stints. It measures 13–17 cm (5.1–6.7 in) in length, 28–37 cm (11–15 in) in wingspan and 21–51 g (0.74–1.80 oz) in body mass.[2] It can be distinguished from the western sandpiper and the semipalmated sandpiper in all plumages by its combination of a fine bill tip, unwebbed toes, and longer primary projection.

The breeding adult has an unstreaked orange breast, bordered with dark markings below, and a white V on its back. In winter plumage identification is difficult, although it is shorter legged and longer winged than the little stint. Juveniles have more contrasting mantle plumage and weaker white lines down the back than their relative. The call is a hoarse "stit".

Distribution and habitat[edit]

Red-necked stints are strongly migratory, breeding along the Arctic littoral of eastern Eurasia and spending the non-breeding season in South East Asia and Australasia as far south as Tasmania and New Zealand. They are rare vagrants to western Europe. They are often seen in western Alaska and occasionally elsewhere in the Americas.

Behaviour[edit]

Red-necked stints are highly gregarious, and will form flocks with other small Calidris waders, such as sharp-tailed sandpipers and curlew sandpipers in their non-breeding areas. See it here with curlew sandpiper.

Breeding[edit]

Their breeding habitat is tundra. They nest on the ground and breed from spring to summer.

Diet[edit]

They forage in wet grassland and soft mud, mainly picking up food by sight. In their non-breeding habitat they feed on intertidal mudflats and along the muddy margins of freshwater lakes. They mainly eat insects and other small invertebrates.

References[edit]

  1. ^ BirdLife International (2012). "Calidris ruficollis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!