Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

Calidris minutilla

One of the smallest sandpipers in the Americas, the Least Sandpiper may be identified by its small size (5-6 ½ inches), short wings, and yellow legs. In summer, this species is mottled brown above with a white belly, streaked breast and throat, and pale white eye-stripes. In winter, the Least Sandpiper becomes darker and duller than in summer. Males and females are similar to one another in all seasons. The Least Sandpiper has one of the southernmost breeding ranges of all North American sandpipers. This species breeds from the high arctic south to Nova Scotia and British Columbia and from Alaska east to Newfoundland. The Least Sandpiper is also one of the most widespread winter sandpipers in North America, wintering along the coast from Oregon and New Jersey south to Central America and the West Indies. This species also winters in northern South America. Least Sandpipers breed in a variety of freshwater habitats, particularly in bogs. During the winter, this species may be found in freshwater and saltwater along beaches, lagoons, estuaries, and other wet habitats near bodies of water. Least Sandpipers feed primarily on small mud-dwelling invertebrates. Least Sandpipers are most easily observed along the water’s edge, probing the mud for food with their bills. They may also be seen in small flocks flying above the surf, frequently mingling with other species of waders. This species is most active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: western Alaska and northern Yukon east through southern Keewatin and Southampton Island to northern Quebec and northern Labrador, south to southern Alaska, northwestern British Columbia, northern Saskatchewan, northeastern Manitoba, northern Ontario, eastern Quebec, Nova Scotia (Sable Island) and Newfoundland, also at Monomoy, Massachusetts (AOU 1983). NORTHERN WINTER: Oregon, California, Nevada, Arizona, southen Utah, New Mexico, Texas, Gulf states, and North Carolina south through Middle America, West Indies, and South America (to northern Chile, eastern Peru, Brazil); uncommon but regular in Hawaii. Nonbreeders summer in winter range, primarily in North America south to California and Gulf Coast (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Labrador, Newfoundland, and Nova Scotia, throughout the summer
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeds n N America; winters to s S America and Hawaiian Is..

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 15 cm

Weight: 21 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Nonbreeding: wet meadows, mudflats, flooded fields, shores of pools and lakes, narrow channels, edge of salt marsh, river sandbars, sometimes sandy beaches. Nests in mossy or wet grassy tundra, in lush vegetation near pond, occasionally in drier areas with sparse vegetation or scattered bushes. In boggy site, nest usually on or inside moss hummock or plant tuft. In dry site, nest often near a plant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 6.186 - 6.483
  Nitrate (umol/L): 1.306 - 2.517
  Salinity (PPS): 30.653 - 30.701
  Oxygen (ml/l): 7.413 - 7.553
  Phosphate (umol/l): 0.412 - 0.580
  Silicate (umol/l): 2.582 - 4.529

Graphical representation

Temperature range (°C): 6.186 - 6.483

Nitrate (umol/L): 1.306 - 2.517

Salinity (PPS): 30.653 - 30.701

Oxygen (ml/l): 7.413 - 7.553

Phosphate (umol/l): 0.412 - 0.580

Silicate (umol/l): 2.582 - 4.529
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Most migrate northward through U.S. in late April and early May, arriving in nesting areas May-June. At Sable Island, Nova Scotia, begins to arrive by mid-May; females begin to migrate south by late June, males in early July, fledglings later. In British Columbia, southward adult migration was late June to early August, juvenile migration was late July to late September (Butler and Kaiser 1995, Wilson Bull. 107:413-422). Migrates through Costa Rica early August-October and early March-early May (Stiles and Skutch 1989). Arrives in northern South America by mid- to late July (juveniles first arrive mid-August), most depart by early April (Hilty and Brown 1986). May migrate from southeastern Canada directly to South America over western Atlantic (Hayman et al. 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats small insects, crustaceans, mollusks, and worms obtained from surface of shallow water, mud, or ground, or by probing into mud (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

100,000 - 1,000,000 individuals

Comments: The population is estimated to be at least 600,000, perhaps considerably more (Morrison et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Mortality of young high at Sable Island, mostly due to herring gull predation. Adults and fledglings tend to flock assortatively in late summer (Miller 1983). Nonbreeding: usually in small groups, singly, or from late winter onward in pairs (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding Category

Vagrant
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: See Robert et al. (1989). Migrates at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 16 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Clutches are completed from late May tolate June. Clutch size is 4. Incubation, mostly by male (female at night), lasts about 19-22 days. Male attends young an average of about 3 weeks; female attendance averages about 1 week. Chicks fly strongly by 2 weeks (Miller 1985). Broods may amalgamate in habitat patches where families congregate after hatching (Can. J. Zool. 70:403).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Calidris minutilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Calidris minutilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNCTATACCTAATCTTCGGTGCATGAGCCGGTATAGTCGGAACTGCCCTTAGCCTGCTCATTCGTGCAGAACTAGGTCAACCCGGAACCCTTTTAGGAGATGACCAAATCTACAACGTTATTGTCACTGCCCACGCTTTTGTAATAATCTTCTTCATAGTAATGCCAATCATAATTGGTGGCTTTGGAAACTGACTAGTCCCACTTATAATCGGCGCCCCTGACATAGCATTTCCTCGTATAAACAATATAAGCTTCTGATTGTTGCCCCCATCATTCCTACTACTACTAGCATCATCCACAGTAGAAGCCGGAGCAGGTACAGGATGAACAGTATACCCCCCACTCGCTGGTAACCTAGCCCATGCTGGAGCCTCCGTAGACTTAGCTATCTTCTCCCTCCACCTAGCAGGTGTCTCCTCCATCCTAGGCGCTATCAACTTCATTACAACCGCCATTAACATAAAACCTCCAGCCCTCTCCCAATACCAAACACCCCTATTCGTATGATCAGTACTTATCACCGCTGTCCTACTCTTACTCTCCCTCCCAGTCCTTGCCGCCGGCATCACTATACTGCTAACAGACCGAAACCTAAACACTACATTCTTCGACCCCGCCGGAGGAGGAGATCCAGTCCTATACCAGCACCTCTTCTGATTCTTTGGTCACCCAGAAGTCTACATCTTAATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

IUCN Red List Category

Least Concern
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Least Sandpiper

The least sandpiper (Calidris minutilla) is the smallest shorebird.

Description[edit]

This species has greenish legs and a short, thin, dark bill. Breeding adults are brown with dark brown streaks on top and white underneath. They have a light line above the eye and a dark crown. In winter, Least sandpipers are grey above. The juveniles are brightly patterned above with rufous colouration and white mantle stripes.

This bird can be difficult to distinguish from other similar tiny shorebirds; these are known collectively as "peeps" or "stints". In particular, least sandpiper is very similar to its Asian counterpart, long-toed stint. It differs from that species in its more compact, shorter-necked appearance, shorter toes, somewhat duller colours, and stronger wingbar.

Breeding and migration[edit]

Their breeding habitat is the northern North American continent on tundra or in bogs. They nest on the ground near water. The female lays four eggs in a shallow scrape lined with grass and moss. Both parents incubate; the female leaves before the young birds fledge and sometimes before the eggs hatch. The young birds feed themselves and are able to fly within two weeks of birth.

They migrate in flocks to the southern United States and northern South America. They occur as very rare vagrants in western Europe.[2]

Feeding[edit]

These birds forage on mudflats, picking up food by sight, sometimes by probing. They mainly eat small crustaceans, insects and snails.

References[edit]

  1. ^ BirdLife International (2012). "Calidris minutilla". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Harrison, Graham; Harrison, Janet (2005). The New Birds of the West Midlands. West Midland Bird Club. ISBN 0-9507881-2-0. Archived from the original on 23 January 2009. 

Further reading[edit]

Identification[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!