Articles on this page are available in 3 other languages: Spanish (9), Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

Biology

The red knot is a long-distance migrant, covering between 5,000 and 15,000 kilometres, and stopping at least once along the way to feed and build up body fat and protein stores. It probes amongst the sand of estuaries and on shorelines for intertidal invertebrates, mainly small molluscs, but feeds also on crustaceans, horseshoe crab eggs and insects (2). Molluscs are ingested whole and cracked with their muscular gizzard. The size of its gizzard varies flexibly throughout the year, as a consequence of energetic demands and food quality (8). Red knots have unique sensory organs in their bill tips enabling them to detect buried prey without touching them, via water pressure differences in the sediment (comparable to the echolocation of bats) (9). Knots often form mixed species flocks with other shorebird species such as godwits (Limosa species), dunlins (Calidris alpina) and dowitchers (Limnodromus species) (5). Breeding in the tundra of the Arctic Circle, the red knot constructs a nest in a dip between lichen-covered rocks and lays three to four buff-coloured eggs spotted with brown. Both sexes incubate the eggs for 21 to 22 days, but the female departs immediately after hatching. The male takes care of the chicks up to fledging, which takes 18 to 20 days, and then leaves the tundra before the young, to head south to the wintering grounds. At the tundra, knots eat insects, beetles, spiders, small crustaceans, snails and worms (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Red knots are plump sandpipers with a short neck and sturdy legs. They are totally specialized in finding shellfish, Baltic tellins being their favorite. When they look for food, you see them slowly moving over the flats with their head bent down and the tip of their bill pushed into the mud. All of the red knots combined eat around 1.5 million kilograms of shellfish meat per year from the Dutch tidal flat bottom.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The red knot has a more conspicuous plumage during the breeding season than in the winter months. The bill is long, thick, straight and black, and the legs are black or dull green. Throughout the winter, the upperparts are pale grey with blackish primaries and a white stripe across the wing. The head is grey, with white areas above the eye and on the throat. The breast and tail are pale grey, but the flanks, belly and undertail feathers are white. However, during the breeding season the head becomes reddish with brownish mottling on the forehead, crown and back of the neck. The underparts also become red, and the tail develops a dark grey-brown stripe. Juveniles are varying shades of grey with dark edgings on the feathers, a white stripe across the wings and dark grey primaries (2) (5). Following migration the usually plump body is considerably leaner (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Iceland, Irish Exclusive economic Zone, Kenya, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Somalia, Spanish Exclusive Economic Zone, Tanzania, United Kingdom Exclusive Economic Zone, Wadden Sea, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Nesting range in North America is in northwestern and northern Alaska, and Canadian arctic islands east to Ellesmere and south to southern Victoria and Southhampton islands, probably also on Adelaide Peninsula and Mansel Island; nesting also occurs in the northern Palearctic.

During the boreal winter, the range in the New World extends mainly from coastal regions of southern California, Gulf Coast and Massachusetts south to Tierra del Fuego; generally rare north of southern South America; major South American nonbreeding areas are Tierra del Fuego and Patagonian coast of Argentina, especially Bahia Lomas (Morrison and Ross 1989). New World red knots principally occupy two areas: about 100,000 birds along Atlantic coast of southern Argentina, about 10,000 along Florida Gulf Coast, with no evidence of interchange between the 2 groups (Harrington et al. 1988). In the Old World, most red knots are in southern Europe, southern Asia, Africa, and the Australasian region during the boreal winter.

Nonbreeders occasionally summer in the winter range.

Delaware Bay is the most important spring migration stopover in the eastern United States (Clark et al. 1993, Botton et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Six subspecies of the red knot are recognised, all of which breed on the Northern tundra areas and winter at temperate or tropical coastal areas. The American subspecies (Calidris canutus rufa) has the longest migration route, breeding in the Canadianarctic and flying via the eastern American coast to Patagonia and Terra del Fuego. The other American subspecies (C. c. rooselari) breeds in Alaska and winters in Florida. The C. c. islandica subspecies breeds in Canada and Greenland and winters in Europe along the coasts of the United Kingdom, France and the Wadden Sea. C. c. canutus breeds in West-Siberia and flies via Europe to West- and South-Africa, where the mudflats of the Banc d'Arguin in Mauritania are an important wintering area. The last two subspecies both breed in eastern Siberia and migrate south via the Chinese and Korean coasts; C. c. piersmai winters in north-west Australia and C. c. rogersi winters in New Zealand (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 27 cm

Weight: 148 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Length: 23-25 cm. Plumage: above grey with paler edges to feathers, below white mottled grey on flanks, breast, neck; rump and slender wing stripe whitish; breeding bird above mottled chestnut and black, below bright rufous chestnut. Bare parts: iris brown; bill heavy, short, and sometimes slightly down-curved, black; feet and legs olive, short. Habitat: seashore, mudflats. Uncommon palearctic migrant. <389><391><393>
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is a full long-distance migrant that utilises few stopover sites or staging areas1. The species breeds from June to August2 in solitary pairs1, travelling in flocks on migration2 and remaining highly gregarious in winter often foraging in flocks of 300-10,000 individuals1 at select feeding and roosting sites2. Habitat Breeding The species breeds in the high Arctic1 on dry upland tundra including weathered sandstone ridges, upland areas with scattered willows Salix spp., Dryas spp. and poppy, moist marshy slopes and flats in foothills, well-drained slopes hummocked with Dryas spp.3 and upland glacial gravel close to streams or ponds1. Non-breeding Outside of the breeding season the species is strictly coastal, frequenting tidal mudflats or sandflats, sandy beaches of sheltered coasts, rocky shelves, bays, lagoons and harbours, occasionally also oceanic beaches and saltmarshes1. Diet Breeding During the breeding season the species's diet consists predominantly of insects (mainly adult and larval Diptera, Lepidoptera, Trichoptera, Coleoptera and bees) as well as spiders, small crustaceans, snails and worms1. When it first arrives on the breeding grounds however, the species is dependant upon vegetation (including the seeds of sedges, horsetails Equisetum spp. and grass shoots) owing to the initial lack of insect prey3. Non-breeding Outside of the breeding season the species takes intertidal invertebrates such as bivalve and gastropod molluscs, crustaceans1 (e.g. horseshoe crab Limulus spp. eggs)8, annelid worms and insects, rarely also taking fish and seeds1. Breeding site The nest is an open shallow depression4 either positioned on hummocks surrounded by mud and water or on stony or gravelly ground3 on open vegetated tundra or stone ridges1.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 18 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.226 - 13.104
  Nitrate (umol/L): 1.865 - 7.963
  Salinity (PPS): 32.515 - 35.399
  Oxygen (ml/l): 6.089 - 6.688
  Phosphate (umol/l): 0.256 - 0.562
  Silicate (umol/l): 1.647 - 4.330

Graphical representation

Temperature range (°C): 9.226 - 13.104

Nitrate (umol/L): 1.865 - 7.963

Salinity (PPS): 32.515 - 35.399

Oxygen (ml/l): 6.089 - 6.688

Phosphate (umol/l): 0.256 - 0.562

Silicate (umol/l): 1.647 - 4.330
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Primarily seacoasts on tidal flats and beaches, less frequently in marshes and flooded fields (AOU 1983). On sandy or pebbly beaches, especially at river mouths; feeds on mudflats, loafs and sleeps on salinas and salt-pond dikes (Costa Rica, Stiles and Skutch 1989). Nests on ground in barren or stony tundra and in well-vegetated moist tundra.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The red knot breeds on tundra. Stopover and winter areas are preferably large tidal mudflats, but include also rocky shores and beaches (2) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Red knots migrate long distances between nesting areas in mid- and high arctic latitudes and southern nonbreeding habitats as far north as the coastal United States (low numbers) and southward to southern South America, and to southern Asia, Africa, and Australasian region. Subspecies rufa migrates from nesting areas in the central Canadian Arctic to wintering grounds at the southern tip of South America.. Subspecies islandica breeds in the northeastern Canadian High Arctic and Greenland and migrates to wintering areas in Europe. Subspecies roselaari breeds in Alaska and on Wrangel Island and is thought to comprise the population wintering in Florida and on coastlines of the Gulf of Mexico, the Caribbean, and northern South America (Piersma and Davidson 1992, Harrington 2001).

Red knots migrate in large flocks northward through the contiguous United States mainly April-June, southward July-October (Bent 1927). Arrival in breeding areas occurs in late May or early June; most have departed breeding areas by mid-August. The species is more abundant in migration along the U.S. Atlantic coast than on the Pacific coast. Knots that visit Delaware Bay in spring come mostly from South America, and these have strong fidelity to migration stopover sites; those that winter in Florida are underrepresented during migration in New Jersey and Massachusetts. Migration through Costa Rica occurs late August-October and mainly mid-March to late April (Stiles and Skutch 1989). This species typically makes long flights between stops (Hayman et al. 1986). See Piersma and Davidson (1992) for information on knot migration.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly mollusks, eggs of crab and horseshoe crab, insects, some seeds and small fishes; pecks and snatches at sand or mud, or probes. Horseshoe crab eggs are an important source of food for north-bound migrants at Delaware Bay (Botton et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Global population estimated to be 1,291,000 individuals (Rose and Scott 1997); North American portion is thought to be on the order of 400,000 (Morrison et al. 2001).

See also information for subspecies rufa.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Nonbreeding: usually in compact flocks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: See Robert et al. (1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 25.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Lays clutch of usually 4 eggs, June-July. Incubation lasts about 20-25 days, by both sexes. Young are tended mostly by male (female leaves before fledging), leave nest soon after hatching, can fly at about 18 days (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calidris canutus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTATACCTAATCTTCGGTGCATGAGCTGGTATAGTTGGAACCGCCCTTAGCCTACTCATTCGCGCAGAACTAGGCCAACCCGGAACCCTCTTAGGAGATGACCAAATTTATAATGTAATTGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATGGTAATGCCAATTATAATTGGTGGTTTCGGAAACTGACTAGTCCCCCTTATAATCGGCGCCCCCGACATAGCATTCCCTCGCATAAATAACATAAGCTTCTGACTTCTTCCCCCATCATTCCTCCTACTACTAGCATCCTCTACAGTAGAAGCTGGAGCAGGTACAGGATGAACAGTATACCCCCCACTCGCTGGTAACCTAGCCCATGCTGGAGCTTCCGTAGACCTAGCTATTTTCTCCCTCCACCTGGCAGGTGTCTCCTCTATTCTAGGTGCTATCAACTTCATCACAACTGCCATCAACATGAAGCCCCCAGCCCTATCTCAATACCAAACACCCCTATTTGTATGATCAGTACTTATTACCGCTGTTCTACTCTTACTTTCCCTTCCAGTCCTTGCCGCTGGCATTACTATACTACTAACAGACCGAAACCTAAACACTACATTCTTCGACCCAGCTGGAGGAGGAGACCCAGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATTCTAATCCTACCAGGATTTGGAAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Calidris canutus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B - Apparently Secure

United States

Rounded National Status Rank: N3N,N4B : N3N: Vulnerable - Nonbreeding, N4B: Apparently Secure - Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1), and listed under Appendix II of the Convention on Migratory Species (3). It is also listed under Annex II of the African-Eurasian Waterbird Agreement (AEWA) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Global Long Term Trend: Increase of 10-25% to decline of 50%

Comments: Population trend estimates at Delaware Bay and eastern Canadian migration stopover sites for subspecies rufa have been consistently negative over the past several decades, though some of the decline data were not statistically significant (Howe et al. 1989, Clark et al. 1993, Morrison et al. 1994, Morrison, Aubry et al. 2001).

Recent population surveys showed a dramatic decline of the population that winters primarily in South America (main wintering areas on the coasts of Patagonia and Tierra del Fuego, Argentina and Chile, corresponding with subspecies rufa, which comprises a portion of the North American nesting population) (González et al. 2004, Morrison et al. 2004). Totals in 2003 were about 30,000 compared to 67,500 in the mid-1980s. Numbers at the principal wintering site, Bahia Lomas, fell by approximately 50%, from 45,300 in 2000 to 22,000-25,000 in 2002-2003. Numbers at peripheral sites on the coast of Patagonia declined dramatically, decreasing 98% compared to numbers in the mid-1980s. The declines at core sites did not result from a shift of birds within the known wintering (or other) areas, but reflected a general population decline, with most birds now restricted to key sites in Tierra del Fuego (Morrison et al. 2004). These data do not include red knot populations that nest: (1) in the northeastern Canadian arctic (i.e., Queen Elizabeth Islands, Ellesmere Island) or Greenland, which winter in the Old World (C. c. islandica), (2) in northwestern Alaska and Wrangel Island (subspecies roselaari; winter range poorly documented, may include the Pacific coasts of North, Central, and South America, the northern tropical Atlantic coast of South America, the Texas coast, and Florida), or (3) in the Palearctic.

Subspecies roselaari breeds in Alaska and is presumed to include those knots that winter on the Pacific coast of the U.S. and Mexico (Niles et al. 2007). Two other red knot wintering populations of uncertain subspecific status exist in the Western Hemisphere: one in the southeastern United States (about 7,000 birds) and one on the north coast of Brazil (about 7,500 birds); these populations apparently have not suffered the same catastrophic decline as has occurred in the rufa population that winters in Tierra del Fuego (Niles et al. 2007).

Calidris c. islandica populations increased from the late 1970s until 2000; steep decrease since 2000 (Delany and Scott 2002).

Use of Massachusetts Bay as a migration stop evidently has declined from the historical situation (Harrington 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is vulnerable to extensive land reclamation projects that encroach upon staging areas in Western Europe1, and is threatened by the over-exploitation of shellfish1, 6 which leads directly and indirectly to reductions in prey availability1. The species also suffers from disturbance in the non-breeding season as a result of tourism6, foot-traffic on beaches7, recreational activities and over-flying aircraft, which together reduce the size of available foraging areas1. It is also potentially threatened by industrial pollution and oil exploration (Argentina)6, and is susceptible to avian influenza so may be threatened by future outbreaks of the virus5. Utilisation The species is hunted illegally in New Zealand1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Increased commercial harvest of horseshoe crabs (for use as bait in eel and conch fisheries; especially in the Delaware Bay region in the 1990s; Walls et al. 2002, Morrison et al. 2004), a reduction in horseshoe crab populations, and a consequent reduction in red knot food resources (horseshoe crab eggs), body condition during spring migration, and annual survival (Baker et al. 2004) are major concerns for population that migrate along the U.S. Atlantic coast (González et al. 2006, Niles et al. 2007).

Actions to conserve horseshoe crabs have included reduced harvest quotas, more efficient use of crabs as bait, closure of the harvest in certain seasons and places, and the designation of a sanctuary off the mouth of Delaware Bay (Niles et al. 2007). The latest information is that the crab population may have stabilized, but there is no evidence of recovery (Niles et al. 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The red knot was once the most numerous shorebird in North America, but during the 1800s and early 1900s, it was put under severe hunting pressure on its migration routes (5), becoming far less common. However, the decline has continued despite a massive drop in hunting. Numbers fell in New Jersey from 90,000 in 1989 to 36,000 in 2001, and other counts suggest declines of at least 30 percent in the last 12 years. Whilst this decline in North America is not fully understood, it is thought to be related to the decline in horseshoe crabs, the eggs of which are consumed by migrating red knots (10) (11). Other subspecies also show a serious decline in numbers. As with the American subspecies, this is often thought to be related to declines in prey species, numbers and quality in the wintering and/or stopover areas. For example, it has been shown that shellfisheries in the Wadden Sea negatively affected the survival of red knots (12).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Listed as a high priority species on the U.S. National Shorebird Conservation Plan, the red knot is also a U.S. Fish and Wildlife Service species of conservation significance, and is on the Audubon WatchList, which aims to encourage people to help reduce the decline of bird species at risk of extinction (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: See information for subspecies rufa.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red Knot

The Red Knot (Calidris canutus) (just Knot in Europe), is a medium sized shorebird which breeds in tundra and the Arctic Cordillera in the far north of Canada, Europe, and Russia. It is a large member of the Calidris sandpipers, second only to the Great Knot.[2] Six subspecies are recognised.

Their diet varies according to season; arthropods and larvae are the preferred food items at the breeding grounds, while various hard-shelled molluscs are consumed at other feeding sites at other times. North American breeders migrate to coastal areas in Europe and South America, while the Eurasian populations winter in Africa, Papua New Guinea, Australia and New Zealand. This species forms enormous flocks when not breeding.

Contents

Taxonomy, systematics and evolution

This Red Knot was first described by Linnaeus in the landmark 1758 tenth edition of his Systema Naturae as Tringa canutus.[3] One theory is that it gets its name and species epithet from King Canute, Knot being another form of Canute; the name would refer to the knot's foraging along the tide line and the story of Canute and the tide.[4] Another etymology is that the name is onomatopoeic, based on the bird's grunting call note.[5]

 


Population relatedness and divergence
 

canutus


 
 

roselaari



rufa



islandica



 

piersmai



rogersi





The diversification events may be associated with the Wisconsinan (Weichselian) glaciation 18,000 to 22,000 years ago; the opening of the ice-free corridor in North America 12,000 to 14,000 years ago; and the Holocene climatic optimum 7,000 to 9,000 years ago.[6]

The Red Knot and the Great Knot were originally the only two species placed in the genus Calidris but many other species of sandpiper were subsequently added.[7] A 2004 study found that the genus was polyphyletic, and that the closest relative of the two knot species is the Surfbird (currently Aphriza virgata).[8]

There are six subspecies, in order of size;

  • C. c. roselaari Tomkovich, 1990 (largest)
  • C. c. rufa (Wilson, 1813)
  • C. c. canutus (Linnaeus, 1758)
  • C. c. islandica (Linnaeus, 1767)
  • C. c. rogersi (Mathews, 1913)
  • C. c. piersmai Tomkovich, 2001 (smallest)

Studies based on mitochondrial sequence divergence and models of paleoclimatic changes during the glacial cycles suggest that canutus is the most basal population, separating about 20,000 years ago (95% confidence interval: 60,000–4,000 years ago) with two distinct lineages of the American and Siberian breeders emerging about 12,000 years ago (with a 95% confidence interval: 45,000–3,500 years ago).[6][9]

Distribution and migration

Large flocks of C. c. islandica winter in the coastal marshes of Britain, along with other waders. The Wash, Norfolk

In the breeding season the Red Knot has a circumpolar distribution in the high Arctic, then migrates to coasts around the world from 50° N to 58° S. The red knot has one of the longest migrations of any bird. Every year it travels more than 9,000 miles from the Arctic to the southern tip of South America.[10] The exact migration routes and wintering grounds of individual subspecies are still somewhat uncertain. The nominate race C. c. canutus breeds in the Taymyr Peninsula and possibly Yakutia and migrates to the Western Europe and then down to western and southern Africa. C. c. rogersi breeds in the Chukchi Peninsula in eastern Siberia, and winters in eastern Australia and New Zealand.[7] Small and declining numbers[11] of rogersi (but possibly of the later described piersmai) winter in the mudflats in the Gulf of Mannar and on the eastern coast[12] of India.[13] The recently split race C. c. piersmai breeds in the New Siberian Islands and winters in north-western Australia.[14] C. c. roselaari breeds in Wrangel Island in Siberia and north-western Alaska, and it apparently winters in Florida, Panama and Venezuela. C. c. rufa breeds in the Canadian low Arctic, and winters South America, and C. c. islandica breeds in the Canadian high Arctic as well as Greenland, and winters in Western Europe.

Birds wintering in west Africa were found to restrict their daily foraging to a range of just 2–16 km2 of intertidal area and roosted a single site for several months. In temperate regions such as the Wadden Sea they have been found to change roost sites each week and their feeding range may be as much as 800 km2 during the course of a week.[15]

Description and anatomy

Nonbreeding adult

An adult Red Knot is the second largest Calidris sandpiper, measuring 23–26 cm (9–10 in) long with a 47–53 cm (18.5–21 in) wingspan. The body shape is typical for the genus, with a small head and eyes, a short neck and a slightly tapering bill that is no longer than its head.[16] It has short dark legs and a medium thin dark bill. The winter, or basic, plumage becomes uniformly pale grey, and is similar between the sexes. The alternate, or breeding, plumage is mottled grey on top with a cinnamon face, throat and breast and light-coloured rear belly. The alternate plumage of females is similar to that of the male except it is slightly lighter and the eye-line is less distinct. canutus, islandica and piersmai are the "darker" subspecies. Subspecies rogersi has a lighter belly than either roselaari or piersmai, and rufa is the lightest in overall plumage. The transition from alternate to basic plumages begins at the breeding site but is most pronounced during the southwards migration. The molt to alternate plumage begins just prior to the northwards migration to the breeding grounds, but is mostly during the migration period.[16]

The large size, white wing bar and grey rump and tail make it easy to identify in flight. When feeding the short dark green legs give it a characteristic 'low-slung' appearance. When foraging singly, they rarely call, but when flying in a flock they make a low monosyllabic knutt and when migrating they utter a disyllabic knuup-knuup. They breed in the moist tundra during June to August. The display song of the male is a fluty poor-me. The display includes circling high with quivering wing beats and tumbling to the ground with the wings held upward. Both sexes incubate the eggs, but the female leaves parental care to the male once the eggs have hatched.[2]

Juvenile birds have distinctive submarginal lines and brown coverts during the first year. In the breeding season the males can be separated with difficulty (<80% accuracy in comparison to molecular methods[17]) based on the more even shade of the red underparts that extend towards the rear of the belly.[2]

The weight varies with subspecies, but ranges between 100 and 200 g (45–91 oz). Red Knots can double their weight prior to migration. Like many migratory birds they also reduce the size of their digestive organs prior to migration. The extent of the atrophy is not as pronounced as species like the Bar-tailed Godwit, probably because there are more opportunities to feed during migration for the Red Knot.[18] Red Knots are also able to change the size of their digestive organs seasonally. The size of the gizzard increases in thickness when feeding on harder foods on the wintering ground and decreases in size while feeding on softer foods in the breeding grounds. These changes can be very rapid, occurring in as little as six days.[19][20]

Behaviour

Diet and feeding

On the breeding grounds, Knots eat mostly spiders, arthropods, and larvae obtained by surface pecking, and on the wintering and migratory grounds they eat a variety of hard-shelled prey such as bivalves, gastropods and small crabs that are ingested whole and crushed by a muscular stomach.[16]

While feeding in mudflats during the winter and migration Red Knots are tactile feeders, probing for unseen prey in the mud. Their feeding techniques include the use of shallow probes into the mud while pacing along the shore. When the tide is ebbing, they tend to peck at the surface and in soft mud they may probe and plough forward with the bill inserted to about a centimetre depth. The bivalved mollusc Macoma is their preferred prey on European coasts, swallowing them whole and breaking them up in their gizzard.[21][22] In Delaware Bay, they feed in large numbers on the eggs of horseshoe crabs which spawn just as the birds arrive in mid-summer.[23] They are able to detect molluscs buried under wet sand from changes in the pressure of water that they sense using Herbst corpuscles in their bill.[24] Unlike many tactile feeders their visual field is not panoramic (allowing for an almost 360 degree field of view), as during the short breeding season they switch to being visual hunters of mobile, unconcealed prey, which are obtained by pecking.[25] Pecking is also used to obtain some surface foods in the wintering and migratory feeding grounds, such as the eggs of horseshoe crabs.[16]

Breeding

Red Knot in breeding plumage

The Red Knot is territorial and seasonally monogamous; it is unknown if pairs remain together from season to season. Males and females breeding in Russia have been shown to exhibit site fidelity towards their breeding locales from year to year, but there is no evidence as to whether they exhibit territorial fidelity. Males arrive before females after migration and begin defending territories. As soon as males arrive, they begin displaying, and aggressively defending their territory from other males.[16]

The Red Knot nests on the ground, near water, and usually inland. The nest is a shallow scrape lined with leaves, lichens and moss.[10] Males construct three to five nest scrapes in their territories prior to the arrival of the females. The female lays three or more usually four eggs, apparently laid over the course of six days. The eggs measure 43 x 30 mm (1.7 x 1.2 in) in size and are ground coloured, light olive to deep olive buff, with a slight gloss. Both parents incubate the eggs, sharing the duties equally. The off duty parent forages in flocks with others of the same species. The incubation period lasting around 22 days. At early stages of incubation the adults are easily flushed from the nest by the presence of humans near the nest, and may not return for several hours after being flushed. However in later stages of incubation they will stay fast on the eggs. Hatching of the clutch is usually synchronised. The chicks are precocial at hatching, covered in downy cryptic feathers. The chicks and the parents move away from the nest within a day of hatching and begin foraging with their parents. The female leaves before the young fledge while the males stay on. After the young have fledged, the male begins his migration south and the young make their first migration on their own.[16]

Status

The Red Knot has an extensive range, estimated at 0.1–1.0 million square kilometres (0.04–0.38 million square miles), and a large population of about 1.1 million individuals. The species is not believed to approach the thresholds for the population decline criterion of the IUCN Red List (i.e., declining more than 30% in ten years or three generations), and is therefore evaluated as Least Concern.[1] However many local declines have been noted such as the dredging of intertidal flats for edible cockles (Cerastoderma edule) which led to reductions in the wintering of islandica in the Dutch Wadden Sea.[26] The quality of food at migratory stopover sites is a critical factor in their migration strategy.[27]

This is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.[28] This commits signatories to regulate the taking of listed species or their eggs, to establish protected areas to conserve habitats for the listed species, to regulate hunting and to monitor the populations of the birds concerned.[29]

Threats to the American subspecies

Large numbers of brown, white and reddish birds dip their heads into in shallow water behind the carapace of a large crab-like creature
Red Knot feeding on horseshoe crab eggs in Delaware Bay

Towards the end of the 19th century, large numbers of Red Knot were shot for food as they migrated through North America. It is hypothesized that more recently, the birds have become threatened as a result of commercial harvesting of horseshoe crabs in the Delaware Bay which began in the early 1990s. Delaware Bay is a critical stopover point during spring migration; the birds refuel by eating the eggs laid by these crabs (with little else to eat in the Delaware Bay).[30] If horseshoe crab abundance in the Bay is reduced there may fewer eggs to feed on which could negatively affect knot survival.[31][32][33]

In 2003, scientists projected that at its current rate of decline the American subspecies might become extinct as early as 2010, but as of April 2011 the subspecies is still extant. Several environmental groups have petitioned the U.S. government to list the birds as endangered,[23] but thus far their requests have not been granted. In New Jersey, state and local agencies are taking steps to protect these birds by limiting horseshoe crab harvesting and restricting beach access. In Delaware, a two-year ban on the harvesting of horseshoe crabs was enacted but struck down by a judge who cited insufficient evidence to justify the potential disruption to the fishing industry but a male-only harvest has been in place in recent years.[citation needed]

References

  1. ^ a b BirdLife International (2012). "Calidris canutus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b c Marchant, John; Hayman, Peter; Prater, Tony (1986). Shorebirds: an identification guide to the waders of the world. Boston: Houghton Mifflin. pp. 363–364. ISBN 0-395-37903-2. 
  3. ^ (Latin) Linnaeus, Carl (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). p. 149. "T. roftro laevi, pedibus cinerascentibus, remigibus primoribus ferratis." 
  4. ^ Holloway, Joel Ellis (2003). Dictionary of Birds of the United States: Scientific and Common Names. Portland, Oregon: Timber Press. p. 50. ISBN 0-88192-600-0. 
  5. ^ Higgins, Peter J.; Davies, S.J.J.F., ed. (1996). Handbook of Australian, New Zealand and Antarctic Birds. Volume 3: Snipe to Pigeons. Melbourne, Victoria: Oxford University Press. pp. 224–32. ISBN 0-19-553070-5. 
  6. ^ a b Buehler, Deborah M.; Baker, Allan J.; Piersma, Theunis (2006). "Reconstructing palaeoflyways of the late Pleistocene and early Holocene Red Knot Calidris canutus" (PDF). Ardea 94 (3): 485–98. 
  7. ^ a b Piersma, T; van Gils, J; Wiersma, P (1996). "Scolopacidae(Sandpipers And Allies)". In Josep, del Hoyo; Andrew, Sargatal; Jordi, Christie. Handbook of the Birds of the World. Volume 3, Hoatzin To Auks. Barcelona: Lynx Edicions. p. 519. ISBN 84-87334-20-2. 
  8. ^ Thomas, Gavin H.; Wills, Matthew A.; Székely, Tamás (2004). "A supertree approach to shorebird phylogeny". BMC Evolutionary Biology 4 (28): 1–18. doi:10.1186/1471-2148-4-28. PMC 515296. PMID 15329156. 
  9. ^ Buehler, Deborah M.; Baker, Allan J. (2005). "Population divergence times and historical demography in red knots and dunlins" (PDF). The Condor 107 (3): 497–513. doi:10.1650/0010-5422(2005)107[0497:PDTAHD]2.0.CO;2. 
  10. ^ a b "Red Knot Fact Sheet, Lincoln Park Zoo"
  11. ^ Boere, G.C., Galbraith, C.A. & Stroud, D.A. (eds). 2006. Waterbirds around the world. The Stationery Office, Edinburgh, UK.
  12. ^ Rao, P.; Mohapatra, K.K. (1993). "Occurrence of the Knot (Calidris canutus) in Andhra Pradesh in India". J. Bombay Nat. Hist. Soc. 90 (3): 509. 
  13. ^ Balachandran, S. (1998). "Population, status, moult, measurements, and subspecies of Knot Calidris canutus wintering in south India" (PDF). Wader Study Group Bull. 86: 44–47. 
  14. ^ Tomkovich, P.S. (2001). "A new subspecies of Red Knot Calidris canutus from the New Siberian Islands". Bulletin of the British Ornithologists' Club 121: 257–63. 
  15. ^ Leyrer, Jutta; Spaans, Bernard; Camara, Mohamed; Piersma, Theunis (2006). "Small home ranges and high site fidelity in red knots (Calidris c. canutus) wintering on the Banc d'Arguin, Mauritania" (PDF). J. Ornithol. 147 (2): 376–84. doi:10.1007/s10336-005-0030-8. 
  16. ^ a b c d e f Harrington, Brian (2001). "Red Knot". Birds of North America. Ithaca: Cornell Lab of Ornithology. doi:10.2173/bna.563. Retrieved 27 April 2009. 
  17. ^ Baker, AJ; T Piersma & AD Greenslade (1999). "Molecular vs. phenotypic sexing in red knots" (PDF). The Condor (Cooper Ornithological Society) 101 (4): 887–893. doi:10.2307/1370083. JSTOR 1370083. 
  18. ^ Piersma, Theunis (1998). "Phenotypic Flexibility during Migration: Optimization of Organ Size Contingent on the Risks and Rewards of Fueling and Flight?". Journal of Avian Biology (Blackwell Publishing) 29 (4): 511–20. doi:10.2307/3677170. JSTOR 3677170. 
  19. ^ Dekinga, A.; Dietz MW, Koolhaas A, Piersma T (2001). "Time course and reversibility of changes in the gizzards of red knots alternately eating hard and soft food". Journal of Experimental Biology 204 (12): 2167–73. 
  20. ^ Piersma, Theunis; Dietz, M. W., Dekinga, A., Nebel, S., van Gils, J. A., Battley, P. F. & Spaans, B. (1999). "Reversible size-changes in stomachs of shorebirds: when, to what extent, and why?" (PDF). Acta Ornithologica 34: 175–81. 
  21. ^ Prater, A. J. (1972). "The Ecology of Morecambe Bay. III. The Food and Feeding Habits of Knot (Calidris canutus L.) in Morecambe Bay". Journal of Applied Ecology (British Ecological Society) 9 (1): 179–94. doi:10.2307/2402055. JSTOR 2402055. 
  22. ^ Zwarts, L; Blomert, A-M (1992). "Why knot Calidris canutus take medium-sized Macoma balthica when six prey species are available" (PDF). Marine Ecol. Progress. Series 83 (2–3): 113–28. doi:10.3354/meps083113. 
  23. ^ a b "Petition to List the Red Knot (Caladris canutus rufa) as Endangered and Request for Emergency Listing under the Endangered Species Act". Federal Wildlife Service. 2005-08-02. Retrieved 2009-03-27. 
  24. ^ Piersma, Theunis; Renee van Aelst; Karin Kurk; Herman Berkhoudt & Leo R M Maas (1998). "A new pressure sensory mechanism for prey detection in birds: the use of principles of seabed dynamics?" (PDF). Proceedings of the Royal Society B: Biological Sciences 265 (1404): 1377–83. doi:10.1098/rspb.1998.0445. 
  25. ^ Martin, Graham R.; Theunis Piersma (2009). "Vision and touch in relation to foraging and predator detection: insightful contrasts between a plover and a sandpiper". Proceedings of the Royal Society B 276 (1656): 437–45. doi:10.1098/rspb.2008.1110. PMC 2664340. PMID 18842546. 
  26. ^ van Gils, Jan A; Theunis Piersma, Anne Dekinga, Bernard Spaans and Casper Kraan (2006). "Shellfish Dredging Pushes a Flexible Avian Top Predator out of a Marine Protected Area". PLoS Biol. 4 (12): e376. doi:10.1371/journal.pbio.0040376. PMC 1635749. PMID 17105350. 
  27. ^ van Gils, Jan A; Phil F Battley, Theunis Piersma and Rudi Drent (2005). "Reinterpretation of gizzard sizes of red knots world-wide emphasises overriding importance of prey quality at migratory stopover sites". Proc. R. Soc. B 272 (1581): 2609–2618. doi:10.1098/rspb.2005.3245. PMC 1559986. PMID 16321783. 
  28. ^ "Annex 2: Waterbird species to which the Agreement applies" (PDF). Agreement on the conservation of African-Eurasian migratory Waterbirds (AEWA). AEWA. Retrieved 22 April 2008. 
  29. ^ "Annex 3: Waterbird species to which the Agreement applies" (PDF). Agreement on the conservation of African-Eurasian migratory Waterbirds (AEWA). AEWA. Retrieved 22 April 2008. 
  30. ^ Karpanty, Sarah; Fraser, James D.; Berkson, Jim; Niles, Lawrence J.; Dey, Amanda; Smith, Eric P. (2006). "Horseshoe crab eggs determine red knot distribution in Delaware Bay". Journal of Wildlife Management 70 (6): 1704–1710. doi:10.2193/0022-541X(2006)70[1704:HCEDRK]2.0.CO;2. JSTOR 4128104. 
  31. ^ Baker, Allan J.; Gonzalez, Patricia M.; Piersma, Theunis; Niles, Lawrence J.; do Nascimento, Ineˆs de Lima Serrano; Atkinson, Philip W.; Clark, Nigel A.; Minton, Clive D. T.; Peck, Mark K.; Aarts, Geert (2004). "Rapid population decline in red knots: fitness consequences of decreased refueling rates and late arrival in Delaware Bay". Proceedings of the Royal Society 271 (1541): 875–82. doi:10.1098/rspb.2003.2663. PMC 1691665. PMID 15255108. 
  32. ^ Niles, Lawrence J. et al. (2008) Status of the Red Knot (Calidris canutus rufa) in the Western Hemisphere Studies in Avian Biology No. 36. Cooper Ornithological Society.
  33. ^ Niles, L., Bart, J., Sitters, H., Dey, A., Clark, K., Atkinson, P., et al. (2009). "Effects of horseshoe crab harvest in Delaware Bay on red knots: are harvest restrictions working?". BioScience 59 (2): 153–164. doi:10.1525/bio.2009.59.2.8. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!