Articles on this page are available in 2 other languages: Chinese (Simplified) (7), Dutch (1) (learn more)

Overview

Brief Summary

Great crested grebes are known for their elaborate mating dance. They stretch their neck towards each other, rising out of the water breast to breast. In the spring, you often see them swimming with their young on their backs. When sensing danger, great crested grebes dive underwater, with the chicks clinging to their back.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

The great crested grebe dives for fish, insects and invertebrate larvae, chasing prey under water by strongly swimming with its feet (5). Pairs begin to form during the middle of winter, and nesting can start in January, providing that conditions are mild (5). This grebe is well known for its elaborate courtship display, in which pairs raise and shake their head plumes, and approach each other with weed in their bills, rising up breast to breast in the water and turning their heads from side to side (4). The nest is either a hidden mound of reeds and other vegetation or else a floating platform anchored to vegetation (4). After May (4), between 1 and 9 (but usually 4) eggs are laid (6), which take 27-29 days to incubate (6). Both parents are involved in incubation; when they leave the nest they cover the eggs with rotting vegetation to keep them warm (4). After hatching, the stripy chicks are carried around on the backs of their parents, they fledge at around 71-79 days of age (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The great crested grebe is the largest grebe in Europe (2). It is a graceful bird, with its long neck, long bill and slender outline. In summer, the adults of both sexes are adorned with beautiful head-plumes (2), which are reddish-orange in colour with black tips (4); there is also an erectile black crown (2). The sexes are similar in appearance, but juveniles can be distinguished by the possession of blackish stripes on the cheeks (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 46-51 cm, envergure 85-90 cm, poids moyen 570-810 g.

Il habite préférentiellement les eaux stagnantes, douces ou saumâtres, de profondeur comprise entre 50 cm et 5 m. Les couples apprécient les berges en pente douce, les fonds vaseux ou sableux et une végétation aquatique non flottante ou limitée aux berges.

C’est le seul grèbe européen à se nourrir essentiellement de poissons. Du printemps à l’automne, des insectes et des larves complètent l’alimentation.

Le Grèbe huppé est faiblement grégaire. En dehors de la saison de reproduction, il est souvent solitaire, notamment en pêche, mais peut former des groupes de plus de 100 individus. Il arrive par ailleurs qu’il tienne un petit territoire alimentaire au cours de l’hiver, alors que certains couples restent sur leur territoire de nidification tout au long de l’année. La formation du couple débute au cœur de l’hiver, avant le choix du site et l’occupation du territoire. Cette période d’appariement peut être longue et le couple instable, en partie du fait des compétitions pour les sites de nid. La plupart des couples se séparent lorsque les jeunes s’émancipent et que la femelle part effectuer sa mue postnuptiale partielle. Toutefois, certains se réapparient en fin d’été et restent associés jusqu’en début d’hiver, voire jusqu’à la saison de reproduction suivante. Les spectaculaires rituels aquatiques ont surtout lieu lors de la formation du couple et de la délimitation du territoire.

Le nid est généralement en pleine eau, caché au sein des roseaux ou d’autres plantes aquatiques. Il est parfois à découvert sur la berge ou sur une vasière émergente. C’est un amoncellement de végétation aquatique, flottant ou attaché à la rive. La ponte de 1 à 6 œufs (max. 9) est déposée à partir de la mi-février, plus fréquemment en avril. Les dates varient selon la disponibilité des sites et notamment selon l’émergence de la végétation aquatique flottante. L’incubation dure 4 semaines et les jeunes sont volants à l’âge de 10 ou 11 semaines. Les secondes couvées sont occasionnelles et un nouveau nid est alors construit.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Great Crested Grebe is found across most of Europe and central Asia, though it also winters in parts of southern Asia (e.g. northern India). Colonies can also be found scattered through Africa, from Tunisia and Egypt in the north, through a few scattered colonies in central Africa to South Africa. Nesting colonies are also found in southern Australia and New Zealand, with individuals wintering in eastern and northern Australia (del Hoyo et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The great crested grebe has a wide distribution in Britain, but occurs sparsely (3). Breeding occurs in Europe from Britain, Spain and Ireland across to Russia, but the distribution is rather patchy (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Length: 46-56 cm. Colour: adult: Face, neck and underparts white. Face with chestnut and black frills. Crest, back of neck, and upperparts brown; juvenile: as adult, but head and neck striped light and dark without chestnut and black frills on face. Neck long, bill long, grey to reddish-brown, legs blackish-brown. Eye crimson. Habitat: Occasionally at sea. (<316><318>)
  • Brown, L.H., E.K. Urban & K. Newman (1982). The Birds of Africa, Volume I. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour The majority of this species is fully migratory although some populations may only undergo local dispersive movements (del Hoyo et al. 1992). It breeds between April and September in Europe, in all months of the year in Africa (peaking during long rainy season) and from November to March in Australasia, nesting either in solitary, dispersed pairs or in loose colonies (del Hoyo et al. 1992) (forming only where safe nesting sites are few and feeding areas are extensive) (Fjeldsa 2004). After breeding (from August to October) (Fjeldsa 2004) adults may disperse locally to large lakes and reservoirs to undergo a flightless moulting period (del Hoyo et al. 1992), during which gatherings of hundreds of individuals(occasionally even greater than 10,000) may form (Fjeldsa 2004). During the winter the species largely remains solitary (Snow and Perrins 1998), especially when feeding (Fjeldsa 2004), but temporary congregations (Snow and Perrins 1998) of up to 5,000 individuals may form in some areas (Fjeldsa 2004).Habitat Breeding The species breeds on fresh or brackish waters with abundant emergent and submerged vegetation (del Hoyo et al. 1992, Snow and Perrins 1998), showing a preference for non-acidic eutrophic waterbodies with flat or sloping banks and muddy or sandy substrates (Snow and Perrins 1998), usually 0.5-5 m deep (Snow and Perrins 1998) and with large areas of open water (del Hoyo et al. 1992). Suitable habitats include small pools or lakes, backwaters of slow-flowing rivers and artificial waterbodies (e.g. reservoirs, fish-ponds, gravel pits and ornamental lakes) (del Hoyo et al. 1992). In Australia the species also utilises swamps, reservoirs, lagoons, salt-fields, estuaries and bays (Marchant and Higgins 1990), and in tropical Africa and New Zealand it may breed on montane, subalpine and alpine lakes up to 3,000 m (del Hoyo et al. 1992). Non-breeding The species overwinters on large exposed ice-free (Fjeldsa 2004) lakes and reservoirs (del Hoyo et al. 1992, Snow and Perrins 1998), moving to sheltered coastal inshore waters (Snow and Perrins 1998) less than 10 m deep (Fjeldsa 2004) such as brackish estuaries (del Hoyo et al. 1992, Snow and Perrins 1998), deltas, tidal channels and tidal lagoons (Snow and Perrins 1998) during cold spells (Fjeldsa 2004). In addition it frequents large saline lakes in Australia (Marchant and Higgins 1990). Diet Its diet consists predominantly of large fish as well as insects, crustaceans (e.g. crayfish, shrimps) and molluscs, occasionally also adult and larval amphibians (del Hoyo et al. 1992). The species's invertebrate consumption is highest during the breeding season (del Hoyo et al. 1992). Breeding site The nest is a platform of aquatic plant matter either floating on water and anchored to emergent vegetation or built from the lake bottom in shallow water (del Hoyo et al. 1992). Typical nest sites include reedbeds or flooded thickets as well as more open sites such as floating mats of water-weed or kelp fronds (Fjeldsa 2004).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 164 specimens in 2 taxa.
Water temperature and chemistry ranges based on 43 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.803 - 12.224
  Nitrate (umol/L): 1.249 - 10.668
  Salinity (PPS): 5.715 - 34.849
  Oxygen (ml/l): 6.291 - 8.295
  Phosphate (umol/l): 0.240 - 0.630
  Silicate (umol/l): 3.881 - 10.453

Graphical representation

Temperature range (°C): 7.803 - 12.224

Nitrate (umol/L): 1.249 - 10.668

Salinity (PPS): 5.715 - 34.849

Oxygen (ml/l): 6.291 - 8.295

Phosphate (umol/l): 0.240 - 0.630

Silicate (umol/l): 3.881 - 10.453
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Britain, this species breeds in large shallow water bodies, where there is a fringe of vegetation (3). In winter it can also be found in gravel-pits, estuaries, deep lakes, coastal pools, reservoirs and off the coast in inshore waters (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 19.2 years (wild) Observations: Maximum longevity from banding studies is 19.2 years (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Podiceps cristatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTCTCAACCAACCACAAAGATATCGGCACTCTATACTTAATCTTTGGTGCATGAGCCGGCATAGTCGGCACCGCCCTAAGCTTACTCATCCGCGCAGAACTGGGCCAGCCAGGAACCCTCCTAGGAGAC---GACCAAATCTACAATGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTCATACCAATCATAATTGGAGGATTTGGAAACTGATTAGTCCCCCTAATAATTGGAGCCCCCGACATAGCATTCCCCCGCATAAACAACATAAGCTTCTGACTCCTTCCCCCATCCTTCCTACTCCTCCTAGCCTCATCAACAGTAGAAGCCGGAGCAGGCACAGGATGAACTGTATACCCACCATTAGCCGGTAACCTAGCCCATGCTGGCGCCTCAGTAGACCTAGCCATTTTCTCACTCCATCTAGCAGGTGTATCCTCCATCCTAGGGGCAATTAACTTCATCACAACCGCCATCAACATAAAACCACCAGCTCTTTCACAGTACCAAACCCCCCTATTCGTATGGTCCGTACTTATCACTGCCGTCCTACTATTACTTTCACTTCCAGTCCTTGCCGCCGGCATCACCATGCTATTAACAGACCGAAACCTAAATACCACATTCTTTGACCCCGCTGGAGGCGGAGACCCAGTCCTATATCAACACCTCTTCTGATTCTTTGGCCACCCAGAAGTCTATATCCTAATCCTCCCAGGCTTCGGAATCATCTCCCACGTAGTAACGTACTACGCAGGTAAAAAAGAACCATTCGGCTATATAGGGATAGTATGAGCCATACTATCAATCGGATTCTTAGGATTCATCGTATGAGCCCACCACATATTCACCGTCGGAATGGACGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Podiceps cristatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Former breeder and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Receives general protection under the Wildlife and Countryside Act 1981 (3). Included in the Birds of Conservation Concern Green List (low conservation concern) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.920,000-1,400,000 individuals (Wetlands International 2006), while national population estimates include: c.100-10,000 breeding pairs, c.50-1,000 individuals on migration and c.1,000-10,000 wintering individuals in China; < c.50 individuals on migration and c.50-1,000 wintering individuals in Taiwan; c.100-10,000 breeding pairs, c.50-1,000 individuals on migration and c.1,000-10,000 wintering individuals in Korea; c.100-10,000 breeding pairs, c.50-1,000 individuals on migration and c.1,000-10,000 wintering individuals in Japan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species suffered declines in the nineteenth century as a result of hunting for the plume trade (this is no longer a threat) (del Hoyo et al. 1992). The species was also hunted in the past for food in New Zealand, a threat that although past is still limiting to the New Zealand population when combined with the modern threats of low food availability, modification of lakes for recreational purposes (del Hoyo et al. 1992), hydroelectric development and the introduction of competitors (e.g. trout) and predators (e.g. weasels, cats and rats) (Fjeldsa 2004). The species is commonly drowned accidentally in monofilament gill-nets (fishing nets) (del Hoyo et al. 1992, Fjeldsa 2004) with mesh sizes greater than 5 cm (Quan et al. 2002). It may also be threatened by future coastal oil spills (Gorski et al. 1977), and is susceptible to avian influenza so may be threatened by future outbreaks of the virus (Melville and Shortridge 2006). Utilisation The species is hunted for commercial (food) and recreational purposes in Iran (Balmaki and Barati 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This attractive species was persecuted in Britain during Victorian times to such an extent that it was reduced to just 42 pairs in 1860 (7), and was on the brink of extinction (8). The breast plumage, known as 'grebe fur', and the head plumes were highly prized in hat trimmings and other clothing (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

In 1889 a group of women formed the 'Fur, Fin and Feather Folk' in order to protest against the massacre of birds purely for clothing (7). Within one year the group had more than 5000 members. From 1904 this group was known as the Royal Society for the Protection of Birds (RSPB), and is today one of Europe's largest and most influential conservation charities, with over 1 million members (8). The great crested grebe has since expanded greatly in numbers and range, and is one of the most resounding conservation successes that Great Britain has known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Great crested grebe

The great crested grebe (Podiceps cristatus) is a member of the grebe family of water birds noted for its elaborate mating display.

Description[edit]

The great crested grebe is the largest member of the grebe family found in the Old World, with some larger species residing in the Americas. They measure 46–51 cm (18–20 in) long with a 59–73 cm (23–29 in) wingspan and weigh 0.9 to 1.5 kg (2.0 to 3.3 lb).[2][3] It is an excellent swimmer and diver, and pursues its fish prey underwater. The adults are unmistakable in summer with head and neck decorations. In winter, this is whiter than most grebes, with white above the eye, and a pink bill. It is the largest European grebe.

The young are distinctive because their heads are striped black and white. They lose these markings when they become adults.

Distribution[edit]

The Great crested grebe breeds in vegetated areas of freshwater lakes. The subspecies P. c. cristatus is found across Europe and Asia. It is resident in the milder west of its range, but migrates from the colder regions. It winters on freshwater lakes and reservoirs or the coast. The African subspecies P. c. infuscatus and the Australasian subspecies P. c. australis are mainly sedentary.

Behaviour[edit]

The great crested grebe has an elaborate mating display. Like all grebes, it nests on the water's edge, since its legs are set relatively far back and it is thus unable to walk very well. Usually two eggs are laid, and the fluffy, striped young grebes are often carried on the adult's back. In a clutch of two or more hatchlings, male and female grebes will each identify their 'favourites', which they alone will care for and teach

Unusually, young grebes are capable of swimming and diving almost at hatching. The adults teach these skills to their young by carrying them on their back and diving, leaving the chicks to float on the surface; they then re-emerge a few feet away so that the chicks may swim back onto them.

The crested grebe feeds mainly on fish, but also small crustaceans, insects and small frogs.

This species was hunted almost to extinction in the United Kingdom in the 19th century for its head plumes, which were used to decorate hats and ladies' undergarments. The RSPB was set up to help protect this species, which is again a common sight.

The great crested grebe and its behaviour was the subject of one of the landmark publications in avian ethology: Julian Huxley's 1914 paper on The Courtship‐habits of the Great Crested Grebe (Podiceps cristatus).[4][5]

Gallery[edit]

References[edit]

  1. ^ BirdLife International (2012). "Podiceps cristatus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "Great crested grebe videos, photos and facts – Podiceps cristatus". ARKive. Retrieved 2012-06-27. 
  3. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  4. ^ Burkhardt Jr, R. W. (1992). Huxley and the rise of ethology. Julian Huxley. Biologist and statesman of science. Rice University Press, Houston, Texas, 127–149.
  5. ^ Huxley, J. S. (1914, September). 33. The Courtship‐habits* of the Great Crested Grebe (Podiceps cristatus); with an addition to the Theory of Sexual Selection. In Proceedings of the Zoological Society of London (Vol. 84, No. 3, pp. 491–562). Blackwell Publishing Ltd.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!