Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

The redshank is a meadow bird, however is regularly seen on marshes and tidal flats. In the Netherlands, it makes its nest on damp grasslands and alongside ditches. The greatest numbers are seen in August and September. Afterwards, a percentage of the birds migrate south to spend the winter in the Mediterranean area. During this period, redshanks nesting in Iceland come to the Netherlands to spend the winter, so that one sees redshanks here throughout the year.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

accidental shore bird from Eurasia, reported in Newfoundland
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Length: 25-28 cm. Plumage: above mottled dull greyish brown; below white with light greyish brown streaking on neck and breast; forehead grey with white line from base of bill to just over eye; distinct white wedge on trailing edge of spread wing; white wedge on back seen in flight; tail finely barred grey; breeding bird more cinnamon-brown with heavy streaking on underparts. Immature buffier than adult below. Bare parts: iris brown; bill black with basal half red or orange-red; feet and legs orange-red, yellow-orange in immature. Habitat: coastal creeks, mudflats, estuaries and lagoons; inland waters. Palearctic migrant. <389><391><393>
  • Urban, E.K., C.H. Fry & S. Keith (1986). The Birds of Africa, Volume II. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Most populations of this species are fully migratory and travel on a broad front over land and along coasts, some Icelandic and Western European populations remaining close to their breeding grounds (del Hoyo et al. 1996). It breeds from March to August (Hayman et al. 1986) in solitarily pairs or in loose colonies (Hayman et al. 1986, del Hoyo et al. 1996), departing the breeding grounds from June to October, and returning from the wintering grounds again between February and April (Hayman et al. 1986). Outside of the breeding season the species forages singly, in small groups (del Hoyo et al. 1996) or occasionally in larger flocks of up to c.1,000 individuals (Snow and Perrins 1998) especially at roosting sites (Hayman et al. 1986) or when feeding on fish (del Hoyo et al. 1996). Habitat Breeding The species breeds on coastal saltmarshes, inland wet grasslands with short swards (del Hoyo et al. 1996) (including cultivated meadows) (Johnsgard 1981), grassy marshes, swampy heathlands (del Hoyo et al. 1996) and swampy moors (Johnsgard 1981). Non-breeding On passage the species may frequent inland flooded grasslands (del Hoyo et al. 1996) and the silty shores of rivers and lakes (Flint et al. 1984), but during the winter it is largely coastal (del Hoyo et al. 1996), occupying rocky, muddy and sandy beaches, saltmarshes, tidal mudflats, saline and freshwater coastal lagoons (del Hoyo et al. 1996), tidal estuaries (Johnsgard 1981), saltworks and sewage farms (del Hoyo et al. 1996). Diet Breeding When breeding its diet consists of insects, spiders and annelid worms (del Hoyo et al. 1996). Non-breeding During the non-breeding season the species takes insects, spiders and annelid worms (del Hoyo et al. 1996), as well as molluscs, crustaceans (especially amphipods e.g. Corophium spp.) (del Hoyo et al. 1996) and occasionally small fish and tadpoles (del Hoyo et al. 1996). Breeding site The nest s a shallow scrape or hollow (Snow and Perrins 1998) on a hummock or at the base of a tuft (Flint et al. 1984) of grass (del Hoyo et al. 1996), often well hidden by overhanging leaves (del Hoyo et al. 1996). The species usually nests solitarily inland (less than 10 pairs/km2) but in loosely colonial groups (up to 100-300 pairs/km2) on the coast (del Hoyo et al. 1996). Management information Optimal breeding conditions for this species may be provided by creating a mosaic of unflooded grassland, winter-flooded grassland and shallow pools (Ausden et al. 2002). Winter flooding of grasslands is beneficial to the species as it helps to keep the sward height short and open and also creates pools which provide a source of aquatic invertebrates in the spring (Ausden et al. 2002, Olsen and Schmidt 2004). Such shallow pools on coastal grazing marshes should be maintained until the end of June (Ausden et al. 2003). The number of breeding pairs on improved grassland was successfully increased on a reserve in Wales by the implementation of a two-year rotation of chisel ploughing, as well as a seasonal sheep and cattle grazing regime and a controlled increase in the water-level (Squires and Allcorn 2006). At Lower Lough Erne in Northern Ireland the breeding population of the species increased considerably as a result of cutting rush beds in mid-winter (although the species nested on uncut areas, chicks benefited from the presence of adjacent short, open areas for feeding) (Robson and Allcorn 2006). Low-level grazing of salt marshes (e.g. c.1 cow per hectare) does not appear to affect the species and may even be beneficial to breeding populations (Norris et al. 1997, Ausden et al. 2005), although cattle should not be put onto the marsh until towards the end of the nesting season (e.g. late-May or early-June) to minimise the risk of nest trampling (Norris et al. 1997). There is also evidence that too heavy grazing can be detrimental (Evans 1986). The species is known to show increased hatching success when ground predators have been excluded by erecting protective fences around nesting areas (Jackson 2001), and in the UK there is evidence that the removal of Spartina anglica from tidal mudflats using a herbicide is beneficial for the species (Evans 1986).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 30 specimens in 1 taxon.
Water temperature and chemistry ranges based on 21 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 8.989 - 12.200
  Nitrate (umol/L): 1.473 - 10.275
  Salinity (PPS): 33.479 - 35.258
  Oxygen (ml/l): 6.221 - 6.596
  Phosphate (umol/l): 0.344 - 0.700
  Silicate (umol/l): 1.720 - 4.619

Graphical representation

Temperature range (°C): 8.989 - 12.200

Nitrate (umol/L): 1.473 - 10.275

Salinity (PPS): 33.479 - 35.258

Oxygen (ml/l): 6.221 - 6.596

Phosphate (umol/l): 0.344 - 0.700

Silicate (umol/l): 1.720 - 4.619
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Tringa totanus (Tringa totanus redshank) preys on:
Crangon crangon
Nereis diversicolor
Corophium volutator
Gammarus
Hydrobia ulvae
Littorina saxatilis
Macoma balthica
Chironomidae

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Tringa totanus (Tringa totanus redshank) is prey of:
Himasthla elongata
Cryptocotyle jejuna
Maritrema subdolum
Levinseniella
Apophallus lerouxi
Levinseniella brachysoma
Maritrema humile
Hymenolepis
Spelotrema clariforma

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 26.9 years (wild) Observations: In the wild, these animals may live up to 26.9 years (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Tringa totanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Tringa totanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTTTTATTAACCGATGATTATTCTCAACCAACCACAAAGATATCGGCACCCTATATCTAATCTTCGGAGCATGAGCCGGTATAATCGGAACTGCCCTCAGCCTTCTCATCCGCGCAGAATTAGGTCAGCCGGGAACTTTACTAGGAGACGACCAAATTTACAATGTAATCGTCACCGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCAATTATAATTGGTGGTTTCGGAAATTGACTAGTTCCACTCATAATCGGCGCCCCCGACATAGCATTCCCCCGTATAAATAACATAAGCTTTTGACTACTCCCCCCATCATTCCTACTACTATTAGCATCCTCAACAGTAGAGGCAGGAGCTGGTACAGGATGAACAGTATACCCCCCTCTCGCCGGTAACCTAGCCCATGCCGGTGCTTCAGTAGATCTAGCTATCTTCTCTCTCCATTTAGCAGGTGTCTCTTCTATCCTAGGCGCCATCAACTTCATCACAACTGCTATTAACATAAAACCTCCAGCCCTCTCCCAATACCAAACTCCCCTATTTGTATGATCAGTACTTATTACTGCCGTTCTTCTCCTACTCTCCCTTCCAGTCCTCGCTGCCGGCATCACTATACTTCTAACAGATCGAAACTTAAACACCACATTCTTTGATCCCGCAGGAGGAGGGGACCCAGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTTTACATCCTCATTCTACCAGGTTTTGGAATTATCTCCCATGTTGTAGCCTACTATGCAGGCAAAAAAGAACCATTTGGATATATAGGAATAGTATGAGCTATACTATCCATCGGATTCCTAGGCTTTATTGTATGAGCCCACCACATATTTACAGTAGGAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is estimated to number c.960,000-2,600,000 individuals (Wetlands International, 2006), while national population estimates include: < c.10,000 individuals on migration and c.1,000-10,000 wintering individuals in China; c.1,000-10,000 individuals on migration and c.1,000-10,000 wintering individuals in Taiwan; c.50-10,000 wintering individuals in Korea; c.100-10,000 breeding pairs and c.50-1,000 individuals on migration and c.1,000-10,000 wintering individuals in Japan and c.100-10,000 breeding pairs and c.50-1,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is threatened by the loss of breeding and wintering habitats through agricultural intensification, wetland drainage, flood control, afforestation, land reclamation, industrial development (del Hoyo et al. 1996), encroachment of Spartina spp. on mudflats (Evans 1986, del Hoyo et al. 1996), improvement of marginal grasslands (del Hoyo et al. 1996) (e.g. by drainage, inorganic fertilising and re-seeding) (Baines 1988), coastal barrage construction (Burton 2006), and heavy grazing (e.g. of saltmarshes) (Norris et al. 1998). The species is also threatened by disturbance on intertidal mudflats from construction work (UK) (Burton et al. 2002a) and foot-traffic on footpaths (Burton et al. 2002b). It is vulnerable to severe cold periods on its Western European wintering grounds (del Hoyo et al. 1996) and suffers from nest predation by introduced predators (e.g. European hedgehog Erinaceus europaeus) on some islands (Jackson 2001). The species is also susceptible to avian influenza so may be threatened by future outbreaks of the viurs (Melveille and Shortridge 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common redshank

For the plant called "redshank", see Persicaria maculosa.

The common redshank or simply redshank (Tringa totanus) is an Eurasian wader in the large family Scolopacidae.

Description and systematics[edit]

Bird (non-breeding) in flight (Laguna di Venezia, Italy)

Common redshanks in breeding plumage are a marbled brown color, slightly lighter below. In winter plumage they become somewhat lighter-toned and less patterned, being rather plain greyish-brown above and whitish below. They have red legs and a black-tipped red bill, and show white up the back and on the wings in flight.

The spotted redshank (T. erythropus), which breeds in the Arctic, has a longer bill and legs; it is almost entirely black in breeding plumage and very pale in winter. It is not a particularly close relative of the common redshank, but rather belongs to a high-latitude lineage of largish shanks. T. totanus on the other hand is closely related to the marsh sandpiper (T. stagnatilis), and closer still to the small wood sandpiper (T. glareola). The ancestors of the latter and the common redshank seem to have diverged around the Miocene-Pliocene boundary, about 5-6 million years ago. These three subarctic- to temperate-region species form a group of smallish shanks with have red or yellowish legs, and in breeding plumage are generally a subdued light brown above with some darker mottling, and have somewhat diffuse small brownish spots on the breast and neck.[2]

Subspecies[edit]

Several subspecies have been identified. These include:

  • T. t. robusta: identified by Schiøler,[3] 1919 found in Iceland and the Faroe Islands.
  • T. t. ussuriensis: identified by Buturlin[4] 1934 found in southern Siberia, Mongolia and east Asia
  • T. t. terrignotae: identified by Meinertzhagen, R & Meinertzhagen, A, 1926 found in southern Manchuria and eastern China
  • T. t. craggi: identified by Hale, 1971 found in north west China
  • T. t. eurhina: identified by Oberholser,[5] 1900 found in Tajikistan, north India and Tibet[6][7]

Ecology[edit]

It is a widespread breeding bird across temperate Eurasia. It is a migratory species, wintering on coasts around the Mediterranean, on the Atlantic coast of Europe from Great Britain southwards, and in South Asia. They are uncommon vagrants outside these areas; on Palau in Micronesia for example, the species was recorded in the mid-1970s and in 2000.[8]

Two redshanks on a stone pillar

They are wary and noisy birds which will alert everything else with their loud piping call. Like most waders, they feed on small invertebrates. Redshanks will nest in any wetland, from damp meadows to saltmarsh, often at high densities. They lay 3-5 eggs.

The common redshank is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

It is widely distributed and quite plentiful in some regions, and thus not considered a threatened species by the IUCN.[9]

Footnotes[edit]

  1. ^ BirdLife International (2013). "Tringa totanus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Pereira & Baker (2005)
  3. ^ Schiøler, E. L., (1919). Om den Islandske Redben (Totunus calidris robustus). Dansk. orn. Foren. XIII: 207-211
  4. ^ Buturlin, S. A., (1934). Polnyi Opredelitel Ptitsy SSSR, I: 88.
  5. ^ Oberholser, H. C., (1900) Birds from Central Asia. Proc. U.S. natn. Mus., XXII: 207-208.
  6. ^ IOC World Bird List VERSION 3.4 (Accessed August 2013)
  7. ^ Hale, W. G. (1971). A revision of the taxonomy of the Redshank Tringa totanus. Zoological Journal of the Linnean Society, 50(3), 199-268.
  8. ^ Wiles et al. (2006)
  9. ^ BLI (2008)

References[edit]

  • Pereira, Sérgio Luiz & Baker, Alan J. (2005): Multiple Gene Evidence for Parallel Evolution and Retention of Ancestral Morphological States in the Shanks (Charadriiformes: Scolopacidae). Condor 107(3): 514–526. DOI:10.1650/0010-5422(2005)107[0514:MGEFPE]2.0.CO;2 PDF fulltext
  • Wiles, Gary J.; Johnson, Nathan C.; de Cruz, Justine B.; Dutson, Guy; Camacho, Vicente A.; Kepler, Angela Kay; Vice, Daniel S.; Garrett, Kimball L.; Kessler, Curt C. & Pratt, H. Douglas (2004): New and Noteworthy Bird Records for Micronesia, 1986–2003. Micronesica 37(1): 69-96. HTML abstract
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!