Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Distribution

Geographic Range

The Greater Yellowlegs breeds throughout a band in central Canada, from Newfoundland and eastern Nova Scotia to eastern British Columbia. The breeding range also extends into Alaska, along the southern Pacific coast. Though it has not been confirmed, it is believed to extend past these areas, farther into the Northwest Territories and south into Oregon.

This species winters along the ocean coasts of North America, from New York south along to the Gulf of Mexico and from California south to Central America.

Vagrant individuals of this species have been observed in Europe, with sightings recorded in Belgium, Denmark, France, Norway and Spain. Rare observations of the species have been reported from Russia, Japan, Micronesia and once in South Africa.

(Elphick and Tibbits 1998)

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: from southern Alaska, central British Columbia, and southern Mackenzie east across northern and central parts of Canadian Provinces to Labrador, northeastern Nova Scotia, southern Quebec, and Newfoundland. NON-BREEDING: from Oregon, central California, Arizona, New Mexico, Texas, southern South Carolina through Mexico and Central America to Tierra del Fuego, including West Indies; rare in Hawaii. The Guianas are the major coastal nonbreeding areas in South America (Morrison and Ross 1989). Nonbreeders sometimes summer in winter range, especially in coastal U.S. and West Indies (AOU 1983). Fairly common throughout most of range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Greater Yellowlegs is a medium-sized (approximately 36 cm long) shorebird with distinctive long, bright yellow legs. Its white tail is crossed with thin, black bars, adding to its cryptic coloration. It has a long, thin, slightly upturned, dark bill with a paler base. The bill length is about 1.5 times the length of the head. Males and females look alike and the juveniles have plumage like that of the adults.

Adults in basic (winter) plumage have pale heads and necks with a few brown streaks on them. The breast and flanks are spotted and streaked grayish-brown. Greater Yellowlegs have a dark brown back with lighter featheredges.

Adults in alternate (breeding) plumage have their heads, necks and chests streaked with black. The bill is also black. Their pale flanks are barred with black. The white belly has sparse dark bars. The back and upperwings are dark brown, spotted with black and white. They also have off-white supercilium (line above the eye) and eye-ring, and smoky-colored lores.

This species is often confused with the Lesser Yellowlegs, Tringa flavipes. The most obvious difference between the two is that of size, with the Greater Yellowlegs weighing 171 grams versus the Lesser Yellowlegs at 81 grams.

(Elphick and Tibbits 1998, National Geographic Society 1999)

Average mass: 171 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 36 cm

Weight: 171 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

In its breeding range, the Greater Yellowlegs can be found throughout the boreal zone in wet bogs with small islands and in coniferous forests with many clearings. They are found in wet areas, covered with mosses and lichens. The breeding areas usually have many small lakes and ponds and trees to be used as perches. Subarctic tundra and subalpine scrub, however, may also serve as breeding sites.

In its wintering range, this species may be found in a variety of wetland habitats, both freshwater and saline. When the feeding habitats are tidal, a Greater Yellowlegs will roost on offshore rocks and reefs. Greater Yellowlegs that have settled along the coast are often found on shallow lagoons and tidal flats. Inland in the southern United States and into South America, these birds will use flooded rice fields.

Elphick, Chris S. and T. Lee Tibbits. 1998. Greater Yellowlegs. The Birds of North America 355:1-23.

  1. Field Guide to the Birds of North America. National Geographic Society, Washington D.C.

Terrestrial Biomes: taiga

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 20 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 6.466 - 7.576
  Nitrate (umol/L): 1.191 - 3.449
  Salinity (PPS): 30.132 - 31.303
  Oxygen (ml/l): 7.098 - 7.228
  Phosphate (umol/l): 0.480 - 0.684
  Silicate (umol/l): 1.892 - 6.431

Graphical representation

Temperature range (°C): 6.466 - 7.576

Nitrate (umol/L): 1.191 - 3.449

Salinity (PPS): 30.132 - 31.303

Oxygen (ml/l): 7.098 - 7.228

Phosphate (umol/l): 0.480 - 0.684

Silicate (umol/l): 1.892 - 6.431
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Nonbreeding: marshes, ponds, lakes, stream margins and sand and gravel bars, lagoons, salinas, and coastal mudflats (AOU 1983, Stiles and Skutch 1989). Nests in muskeg country or at other wetlands, on the ground in a slight depression in moss or dry peat, usually near water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates throughtout North America south of breeding range. Arrives in northern U.S. April-May or June during northward migration. Departures from breeding areas begin in mid-July (Hayman et al. 1986). Most common in fall in Puerto Rico and Virgin Islands (Raffaele 1983). Migrates through Costa Rica Aug. or September-October and April-May (Stiles and Skutch 1989). Usually migrates in small flocks, day or night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The Greater Yellowlegs primarily eat small aquatic and terrestrial invertebrates, small fish, frogs and seeds or berries. Greater Yellowlegs will, at times, eat insects along the shore or snatch them out of the air.

(Elphick and Tibbits 1998)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds on small fishes, insects and their larvae, snails, crabs, worms, and tadpoles. Wades through water and pecks at food with bill or skims suface with lower mandible.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

100,000 - 1,000,000 individuals

Comments: The total population has been roughly estimated to be at least 100,000 (Morrison et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Generally not as gregarious as lesser yellowlegs; nonbreeding: usually solitary or in small groups.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Foraged with comparable frequency during day and night in northeastern Venezuela (Robert et al. 1989). May migrate day or night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

There is little data on the reproductive behavior of Greater Yellowlegs, but the mating system is presumed to be monogamous with an even sex ratio. The courting male runs in circles around a female and poses while quivering its up-held wings. In an established pair, the male does this for only a few seconds, while the "dance" must be done longer when attempting to create a pair. Eventually the male mounts the female's back and copulation occurs.

There is also no information on the duration or maintenance of the pair bond. There is evidence of joint care of the young, which indicates that the pair persists at least into the chick-rearing period. This bird has one brood per season and has 3-4 eggs in its clutch. There is no evidence of a second brood in the season, though individuals may renest after losing a clutch. The incubation period is 23 days while it takes 18-20 days to fledge.

There is no information on nest building, however, nest location has been studied. The nests are generally found on the ground at the base of short, coniferous trees and are placed in a moss-covered hummock. The nest structure is a scrape or depression in the moss, sometimes lined with leaves. Shrubs and small trees generally shade these nests.

The eggs are ovate pyriform in shape and have variable color. The background colors range from smoky-gray to an olive color. The spots are always some shade of brown, from light to dark. The spots are irregularly shaped and vary in size. They have a slightly glossy surface texture.

(Elphick and Tibbits 1998)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding begins in late May or early June (Harrison 1978). Usually 4 eggs are incubated (probably by both sexes) for 23 days (Terres 1980). Nestlings are precocial. Young are tended by both adults; capable of first flight in about 18-20 days.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tringa melanoleuca

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
BROM078-06|JGS 1633|Tringa melanoleuca| AATCGATGACTATTCTCAACCAACCACAAAGATATCGGCACCCTATACCTAATCTTTGGTGCATGAGCTGGCATAATCGGAACTGCCCTC---AGCCTCCTCATTCGCGCAGAATTAGGTCAACCGGGAACCCTATTAGGAGAC---GACCAAATCTACAATGTAATCGTCACCGCCCATGCCTTCGTAATAATTTTCTTCATAGTAATACCAATTATAATTGGTGGCTTCGGAAACTGACTAGTCCCACTCATA---ATCGGCGCCCCCGATATAGCATTTCCACGTATAAACAACATAAGCTTCTGACTACTTCCCCCATCATTCCTATTACTACTAGCATCCTCAACAGTAGAAGCCGGAGCTGGTACAGGGTGGACAGTATATCCCCCTCTTGCTGGTAACCTAGCTCATGCTGGCGCCTCAGTAGACCTC---GCTATCTTCTCTCTTCACCTAGCAGGTGTCTCCTCCATCCTTGGTGCTATCAACTTCATCACAACCGCCATCAACATAAAACCCCCAGCTCTCTCCCAATATCAAACCCCTCTATTTGTATGATCAGTTCTTATTACCGCCGTCCTTCTTCTACTCTCCCTTCCAGTCCTTGCCGCT---GGTATCACCATATTACTAACAGACCGAAACTTAAACACCACATTCTTCGATCCGGCTGGAGGAGGAGATCCAGTCCTATACCAACACCTTTTCTGATTTTTCGGCCACCCAGAAGTTTACATCCTCATTCTACCAGGCTTTGGAATTATCTCCCATGTTGTAGCATACTATGCAGGCAAAAAA---GAGCCATTTGGGTATATGGGAATAGTATGAGCCATACTATCCATCGGATTCCTAGGCTTTATCGTATGAGCCCACCATATATTCACAGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tringa melanoleuca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Species: 12
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Greater Yellowlegs were considered an important game bird in the early 20th century, due to its difficulty in being found. This hunting greatly reduced its numbers until the introduction of the Migratory Bird Treaty Act in 1918. Since 1927, this bird has been fully protected in the United States and Canada under this act. It is assumed that population numbers have increased since then, though this is not certain. DDE and PCBs have been studied in this species and have not been found to have an effect on the population numbers. Heavy metals have also been studied and selenium has been found to be the only one of concern. The main threat these birds have to their habitat is the loss of wetlands throughout their wintering range. The population numbers of the Greater Yellowlegs is thought to be stable and of little conservation concern, but there is little accurate data on this.

(Elphick and Tibbits 1998)

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

None known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The Greater Yellowlegs is a tentative species, so it is difficult to observe. Many birding tourists will go to both its breeding and wintering grounds in order to view it.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Greater Yellowlegs

The Greater Yellowlegs, (Tringa melanoleuca), is a large North American shorebird, similar in appearance to the smaller Lesser Yellowlegs. Its closest relative, however, is the Greenshank, which together with the Spotted Redshank form a close-knit group. Among them, these three species show all the basic leg and foot colors found in the shanks, demonstrating that this character is paraphyletic (Pereira & Baker, 2005). They are also the largest shanks apart from the Willet, which is altogether more robustly built. The Greater Yellowlegs and the Greenshank share a coarse, dark, and fairly crisp breast pattern as well as much black on the shoulders and back in breeding plumage.

Adults have long yellow legs and a long, thin, dark bill which has a slight upward curve and is longer in length than the head. The body is grey brown on top and white underneath; the neck and breast are streaked with dark brown. The rump is white. It ranges in length from 29 to 40 cm (11.5-16 inches) and in weight from 111 to 250 grams (3.9 to 9 oz).

Juvenile

Their breeding habitat is bogs and marshes in the boreal forest region of Canada and Alaska. They nest on the ground, usually in well-hidden locations near water. The three to four eggs average 50 mm (2 inches) in length, 33 mm (1.3 inches) in breadth and weigh about 28 grams (1 oz). The incubation period is 23 days. The young leave the nest within 24 hours of hatching and then leave vicinity of the nest within 2 days.

They migrate to the Atlantic and Pacific coasts of the United States and south to South America. They are very rare vagrants to western Europe.

These birds forage in shallow water, sometimes using their bill to stir up the water. They mainly eat insects and small fish, as well as crustaceans and marine worms. It often walks in sand or mud and leaves clear tracks; it can be possible to gather information about this species using its tracks.

The call is harsher than that of the Lesser Yellowlegs.

Footnotes

  1. ^ "Tringa melanoleuca". IUCN Red List of Threatened Species. Version 2007. International Union for Conservation of Nature. 2004. http://www.iucnredlist.org/apps/redlist/details/49056. Retrieved 30 July 2007.  Database entry includes justification for why this species is of least concern

References

  • Pereira, S. L., & Baker, A. J. (2005). Multiple Gene Evidence for Parallel Evolution and Retention of Ancestral Morphological States in the Shanks (Charadriiformes: Scolopacidae). Condor 107 (3): 514–526. DOI: 10.1650/0010-5422(2005)107[0514:MGEFPE]2.0.CO;2 Abstract.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!