Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Shags have a crest which is only really apparent in the summer. Nevertheless, this bird is called the 'tufted cormorant' in Dutch. Actually, shag is an old name meaning tufted. Shags nest in colonies along the North Sea and Mediterranean Sea. Their neighbors are often guillemots, auks, kittiwakes, fulmars and herring gulls. Shags make their nest on bare rock. They soften it up using seaweed and other objects that wash ashore.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Like the cormorant, the shag mainly feeds on fish, but it fishes in deeper water (3) and prefers different prey species (2). It dives for fish from the surface of the water with a pronounced leap (1). The nest is located on offshore islands, rocky stacks and cliff ledges (8). It is made of twigs and rotting seaweed, and is said to have an extremely pungent smell that increases in intensity as the decomposition of the seaweed continues (3). After hatching, the chicks stay in the nest for 8 weeks (5). Shags tend not to travel great distances, adults usually remain within 100km of the breeding area, but juveniles move up to 200 km (2). Occasionally a phenomenon known as a 'wreck' occurs, when adverse weather conditions drift birds inland, where they become stranded in unusual habitats. This results in very high mortality for immature birds (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This bird is very similar in general appearance to the cormorant (Phalacrocorax carbo), but is smaller and slightly slimmer (1). In breeding condition, adults develop a green gloss to the black plumage, and a black crest develops on the head (1). Outside of the breeding season, the plumage is duller and the bill is more yellow in colour (1), although there is a yellow patch at its base throughout the year (3). Juveniles have dark brown upperparts and pale underparts with a white chin (1). A variety of grunting and clicking calls are produced (1). The common name originates from the Old Norse word 'skegg' meaning beard, and refers to the crest (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 65-80 cm, envergure 90-105 cm, poids 1,4-2,3 kg.

Il habite les côtes rocheuses et aime les eaux relativement profondes. Il ne s’éloigne pourtant guère de la côte, ne dépassant pas les limites du plateau continental. Pour la pêche, il recherche des eaux protégées, évitant toutefois les estuaires et globalement les eaux douces ou saumâtres. Il partage rarement les sites de reproduction du Grand Cormoran Phalacrocorax carbo, préférant les fissures et corniches ombragées et bien protégées.

Le Cormoran huppé se nourrit de poissons qu’il avale sous la surface, ainsi que de quelques mollusques, crustacés et polychètes. Ses proies sont majoritairement des lançons et des Gadidés de moins de 20 cm de long, qu’il pêche près du fond, à une profondeur pouvant dépasser 40 mètres. Il peut faire plusieurs captures lors d’une seule plongée.

Il est moins grégaire que le Grand Cormoran, étant souvent solitaire en hiver et à distance des colonies. L’espèce est monogame (rares cas de bigamie) et s’installe en petites colonies lâches (en général quelques dizaines de couples). Le mâle choisit le site de nid et parade pour y attirer une femelle. Seul le territoire du nid est défendu par les adultes. Il est réutilisé d’une année sur l’autre.

Le nid est un amoncellement de débris végétaux, notamment de fougères et d’algues à la base. Il est souvent construit à l’abri d’un creux ou à l’entrée d’une petite grotte. La ponte unique de 3 œufs (extrêmes : 1 à 8) est déposée à partir de mars. L’incubation dure 1 mois et les jeunes s’envolent à l’âge moyen de 53 jours. Ils sont encore nourris durant quelques semaines avant d’être complètement indépendants.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The European Shag can be found along the entire Atlantic coast of Europe as far north as Finland and including Iceland, as far south as the coast of Morocco, and ranges in the entire Mediterranean nesting on parts of the coastline of most European (e.g. Italy, Turkey) and north African countries (e.g. Algeria, Libya), as well as parts of the Black Sea coast (e.g. Ukraine) (del Hoyo et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

European shags are found throughout western Europe, from Iceland, the British Isles, Portugal, Gibraltar, and northern Africa east to Greece and north into the Ukraine and as far north as Norway. There are 3 recognized subspecies: P. a. aristotelis occurs from Iceland to Scandinavia and south to the Iberian Peninsula, P. a. desmarestii occurs in the central Mediterranean to the Black Sea, and P. a. riggenbachi occurs along the coast of North Africa.

Biogeographic Regions: palearctic (Native )

  • BirdLife International 2008, 2008. "Phalacrocorax aristotelis" (On-line). IUCN Red List of Threatened Species. Version 2009.1. Accessed July 09, 2009 at http://www.iucnredlist.org/details/144652/0.
  • del Hoyo, J., A. Elliott, J. Sargatal. 1992. Handbook of the Birds of the World, Volume I. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The shag is generally a coastal bird, and occurs inland less often than the cormorant. It has a wide distribution around the coastline of Britain (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

European shags are from 65 to 80 cm in length and 90 to 105 cm in wingspan. They average 2 kg in mass. They have black plumage overall with greenish iridescent hues. They have black feet, legs, and bill, with bright yellow skin at the base of the bill and bright turquoise eyes. They have a small, single, black crest that develops in the breeding season, when they also develop their most intense green hues to the plumage. Non-breeding adults have duller plumage with a pale chin, mottled plumage on the throat, and the bill becomes yellowish. Juveniles are uniformly brown and have pale areas on the head and underparts. They are similar in appearance to great cormorants (Phalacrocorax carbo), but are overall smaller.

Average mass: 2 kg.

Range length: 65 to 80 cm.

Range wingspan: 90 to 105 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour The European Shag is a coastal species that shows high nesting site fidelity. It feeds exclusively diurnally, and one bird is always present with the clutch or brood during the breeding season. The species breeds in colonies (del Hoyo et al. 1992) that can hold more than a thousand well-spaced pairs (Snow and Perrins 1998, Nelson 2005). It is largely sedentary (del Hoyo et al. 1992), although immatures may undergo post-breeding dispersive movements over short distances (del Hoyo et al. 1992). Some birds undergo short-distance migrations during winter. Individuals often forage alone when away from nesting colonies and in winter (del Hoyo et al. 1992, Snow and Perrins 1998), but may follow dense shoals of fish in flocks of several hundred individuals (Nelson 2005). Habitat It occupies marine habitats but does not usually occur far from land (del Hoyo et al. 1992). It shows a strong preference for rocky coasts and islands (del Hoyo et al. 1992) with adjacent deep, clear water (Nelson 2005), and forages over sandy and rocky seabeds (del Hoyo et al. 1992). It also prefers sheltered fishing grounds such as bays and channels, although it generally avoids estuaries, shallow or muddy inlets and fresh or brackish waters (Wanless and Harris 1997). Diet The species feeds on a wide range of benthic, demersal and schooling, pelagic fish. Sandeels (Ammodytidae) are the dominant prey of birds in British and some Spanish populations (Wanless et al 1997, Velando and Friere 1999, BirdLife International 2000, Velando et al. 2005), and are consistently present in the species' diet in most other locations studied. These are usually caught at, or near, the sea bed (Wanless et al 1997). Other prey species include fish of the families Gadidae, Clupeidae, Cottidae, Labridae, and Trisopterus spp. (del Hoyo et al. 1992), although birds also take small numbers of polychaetes, cephalopods, other molluscs and small benthic crustaceans (Wanless and Harris 1997). Adults provision their chicks with sandeels, but consume a broader variety of prey for themselves (BirdLife International 2000). The Mediterranean subspecies feeds mainly on coastal fishes, caught from the bottom or mid water over rocky or sandy seabeds, but economically important fish seem to form a very small part of the diet (Aguilar and Fernandez 1999). Breeding site The nest is constructed of marine vegetation and flotsam (del Hoyo et al. 1992, Nelson 2005), from just above the high water level to over 100 m high (Snow and Perrins 1998) on ledges, in crevices or in caves on sea cliffs, rocks and stacks, and at the base of sea cliffs amongst boulders (del Hoyo et al. 1992). Foraging range At Islas Ces, Spain, birds foraged within 20 km of the colony all year round (Velando et al. 2005). During the breeding season, the foraging range was typically within 4 km of the colony, and birds foraged in groups of 300-1000 individuals (Velando et al. 2005). Foraging areas tend to coincide with areas of sandy benthic sediment (Wanless et al 1991, BirdLife International 2000, Velando et al. 2005), and occur where depth is less than 80 m (Wanless et al 1991, Velando and Friere 1999). At the Isle of May, Scotland, over 90% of foraging occurred within 13 km of the colony, and the maximum distance recorded was 17 km (Wanless et al 1991). Foraging individuals visited more than one area during a trip, often feeding at sites several kilometres apart (Wanless et al 1991). Birds were often found feeding in areas of strong tidal flow (Wanless et al 1991). The available data on European Shag feeding habitat suggest that, within the inshore zone as a whole, the species is fairly plastic in its habitat requirements. In some areas, the birds' foraging range is considerably less than 20 km; the small number of birds breeding at Hirta, Scotland, all appeared to forage within a 2 km radius (BirdLife International 2000). Similarly, birds were only present within 3 km of North Rona, Scotland (BirdLife International 2000).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9956 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2166 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.938 - 12.736
  Nitrate (umol/L): 1.402 - 10.668
  Salinity (PPS): 27.525 - 35.363
  Oxygen (ml/l): 6.069 - 6.963
  Phosphate (umol/l): 0.256 - 0.710
  Silicate (umol/l): 0.987 - 5.008

Graphical representation

Temperature range (°C): 7.938 - 12.736

Nitrate (umol/L): 1.402 - 10.668

Salinity (PPS): 27.525 - 35.363

Oxygen (ml/l): 6.069 - 6.963

Phosphate (umol/l): 0.256 - 0.710

Silicate (umol/l): 0.987 - 5.008
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

European shags are found along rocky, marine coastlines and islands and are never found very far from land or very far inland. Preferred foraging grounds are in clear, protected waters over sand or rocky substrates, such as in bays or coastal channels. They avoid fresh, brackish, or muddy water.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9956 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2166 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.938 - 12.736
  Nitrate (umol/L): 1.402 - 10.668
  Salinity (PPS): 27.525 - 35.363
  Oxygen (ml/l): 6.069 - 6.963
  Phosphate (umol/l): 0.256 - 0.710
  Silicate (umol/l): 0.987 - 5.008

Graphical representation

Temperature range (°C): 7.938 - 12.736

Nitrate (umol/L): 1.402 - 10.668

Salinity (PPS): 27.525 - 35.363

Oxygen (ml/l): 6.069 - 6.963

Phosphate (umol/l): 0.256 - 0.710

Silicate (umol/l): 0.987 - 5.008
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds in loose colonies (1) on rocky coastal cliffs and islands (2). Nests are made in crevices, under boulders or in small caves (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

European shags often forage alone, but will form large foraging flocks of several hundred when prey conditions allow. They eat almost exclusively small fish, although they will also eat crustaceans, cephalopods, and polychaete worms. Common fish prey include Gadidae, Clupeidae, Cottidae, Labridae, Ammodytes, and Trisopterus species. European shags don't hunt cooperatively and generally dive and pursue their prey under water. They perform a distinctive "leap" before diving into the water. European shags forage in deeper water and tend to eat different types of fish than great cormorants (Phalacrocorax carbo), with which they co-occur.

Animal Foods: fish; mollusks; aquatic or marine worms; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

European shags are susceptible to Newcastle disease. They are important predators of small fish in their coastal habitats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

European shags are preyed on by introduced American mink (Neovison vison) at some nesting colonies. Other predators are not reported, but probably include coastal raptors, like white-tailed eagles (Haliaeetus albicilla, and avian nest predators such as gulls or corvids. Their nesting habits on steep, rocky, coastal cliffs, prevent some predation.

Known Predators:

  • American mink (Neovison vison)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

European shags produce a variety of grunting and clicking vocalizations, which can be heard at the   RSPB site. Other forms of communication are not well documented, but European shags may use visual displays in mating like other cormorants.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Maximum lifespan is not reported for European shags, but studies demonstrate that most mortality occurs in the first year of life as a direct result of lower foraging efficiency. Other significant sources of mortality are accidental and intentional deaths through entanglement in fishing gear and persecution by humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30.6 years (wild) Observations: In the wild, these animals may live up to 30.6 years (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

European shags are monogamous and pair-bonds often last over successive years. Pairs re-use their nests regularly.

Mating System: monogamous

European shags build nests of sticks, seaweed, and other marine debris on rocky ledges, cliffs, or stacks. Nests have been found from just above the high water level to 100 m above the sea. Nesting areas host large concentrations of these birds, who nest in close proximity. Nests are said to have an intense, unpleasant smell, especially as the seaweed rots. Larger nests have higher success rates than smaller nests and nests on narrow cliffs are less successful than those in other areas. Breeding season varies regionally, with southern populations (Tunisia) breeding from November to February, Black Sea populations breeding from January to March, and northern Atlantic populations breeding from March through June. Females lay from 1 to 6 eggs (usually 3), usually begin incubation after laying the 2nd egg, and incubate them for 30 to 31 days. Hatchling European shags fledge at about 53 days, remain in the nest for 8 weeks after hatching, and are cared for by their parents for 15 to 50 days after they fledge. Within 30 days of hatching males are generally larger than females and the hatchling from the last egg laid is generally smaller. Females may breed as early as their 2nd year.

Breeding interval: European shags breed once yearly.

Breeding season: Breeding season varies with region, occuring between November and June throughout their range.

Range eggs per season: 1 to 6.

Average eggs per season: 3.

Range time to hatching: 30 to 31 days.

Average fledging age: 53 days.

Range time to independence: 68 to 103 days.

Range age at sexual or reproductive maturity (female): 2 (low) years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

European shag hatchlings are naked at hatching and develop brown down. They fledge at about 53 days old. Both adults protect and provide for their young, incubating them between their feet and breast and alternating duties. They continue to provide food for another 15 to 50 days after the young have fledged. At one site hatching success was from 69 to 73% and fledging success was from 67 to 95%. Most mortality of young is associated with food shortages.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Male, Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phalacrocorax aristotelis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGCATAGTCGGAACTGCCCTCAGCCTACTTATCCGCGCAGAACTAGGTCAACCAGGAACCCTCCTAGGAGACGACCAAATCTACAACGTAATTGTCACCGCTCATGCTTTCGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGATTCGGAAACTGACTGGTTCCCCTCATAATCGGCGCCCCCGACATAGCATTTCCACGTATAAACAACATAAGCTTCTGACTCCTTCCACCATCATTCCTCCTCCTATTAGCCTCCTCTACAGTAGAAGCAGGCGCAGGCACAGGATGAACTGTATATCCGCCCCTAGCTGGAAACCTAGCCCATGCCGGTGCCTCAGTCGACCTAGCCATCTTCTCCCTCCACCTAGCAGGGGTGTCCTCAATCCTGGGAGCAATCAACTTCATCACAACTGCCATTAACATAAAACCCCCAGCCCTATCACAATACCAAACCCCACTATTCGTCTGATCAGTACTAATCACTGCAGTTTTACTCCTACTCTCACTCCCCGTCCTCGCTGCTGGAATCACCATACTCCTAACCGATCGAAATCTAAACACAACATTCTTTGACCCTGCTGGAGGAGGAGACCCAGTCCTGTATCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTCTACATCCTAATCCTCCCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phalacrocorax aristotelis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5