Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Shags have a crest which is only really apparent in the summer. Nevertheless, this bird is called the 'tufted cormorant' in Dutch. Actually, shag is an old name meaning tufted. Shags nest in colonies along the North Sea and Mediterranean Sea. Their neighbors are often guillemots, auks, kittiwakes, fulmars and herring gulls. Shags make their nest on bare rock. They soften it up using seaweed and other objects that wash ashore.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Like the cormorant, the shag mainly feeds on fish, but it fishes in deeper water (3) and prefers different prey species (2). It dives for fish from the surface of the water with a pronounced leap (1). The nest is located on offshore islands, rocky stacks and cliff ledges (8). It is made of twigs and rotting seaweed, and is said to have an extremely pungent smell that increases in intensity as the decomposition of the seaweed continues (3). After hatching, the chicks stay in the nest for 8 weeks (5). Shags tend not to travel great distances, adults usually remain within 100km of the breeding area, but juveniles move up to 200 km (2). Occasionally a phenomenon known as a 'wreck' occurs, when adverse weather conditions drift birds inland, where they become stranded in unusual habitats. This results in very high mortality for immature birds (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This bird is very similar in general appearance to the cormorant (Phalacrocorax carbo), but is smaller and slightly slimmer (1). In breeding condition, adults develop a green gloss to the black plumage, and a black crest develops on the head (1). Outside of the breeding season, the plumage is duller and the bill is more yellow in colour (1), although there is a yellow patch at its base throughout the year (3). Juveniles have dark brown upperparts and pale underparts with a white chin (1). A variety of grunting and clicking calls are produced (1). The common name originates from the Old Norse word 'skegg' meaning beard, and refers to the crest (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 65-80 cm, envergure 90-105 cm, poids 1,4-2,3 kg.

Il habite les côtes rocheuses et aime les eaux relativement profondes. Il ne s’éloigne pourtant guère de la côte, ne dépassant pas les limites du plateau continental. Pour la pêche, il recherche des eaux protégées, évitant toutefois les estuaires et globalement les eaux douces ou saumâtres. Il partage rarement les sites de reproduction du Grand Cormoran Phalacrocorax carbo, préférant les fissures et corniches ombragées et bien protégées.

Le Cormoran huppé se nourrit de poissons qu’il avale sous la surface, ainsi que de quelques mollusques, crustacés et polychètes. Ses proies sont majoritairement des lançons et des Gadidés de moins de 20 cm de long, qu’il pêche près du fond, à une profondeur pouvant dépasser 40 mètres. Il peut faire plusieurs captures lors d’une seule plongée.

Il est moins grégaire que le Grand Cormoran, étant souvent solitaire en hiver et à distance des colonies. L’espèce est monogame (rares cas de bigamie) et s’installe en petites colonies lâches (en général quelques dizaines de couples). Le mâle choisit le site de nid et parade pour y attirer une femelle. Seul le territoire du nid est défendu par les adultes. Il est réutilisé d’une année sur l’autre.

Le nid est un amoncellement de débris végétaux, notamment de fougères et d’algues à la base. Il est souvent construit à l’abri d’un creux ou à l’entrée d’une petite grotte. La ponte unique de 3 œufs (extrêmes : 1 à 8) est déposée à partir de mars. L’incubation dure 1 mois et les jeunes s’envolent à l’âge moyen de 53 jours. Ils sont encore nourris durant quelques semaines avant d’être complètement indépendants.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

European shags are found throughout western Europe, from Iceland, the British Isles, Portugal, Gibraltar, and northern Africa east to Greece and north into the Ukraine and as far north as Norway. There are 3 recognized subspecies: P. a. aristotelis occurs from Iceland to Scandinavia and south to the Iberian Peninsula, P. a. desmarestii occurs in the central Mediterranean to the Black Sea, and P. a. riggenbachi occurs along the coast of North Africa.

Biogeographic Regions: palearctic (Native )

  • BirdLife International 2008, 2008. "Phalacrocorax aristotelis" (On-line). IUCN Red List of Threatened Species. Version 2009.1. Accessed July 09, 2009 at http://www.iucnredlist.org/details/144652/0.
  • del Hoyo, J., A. Elliott, J. Sargatal. 1992. Handbook of the Birds of the World, Volume I. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The European Shag can be found along the entire Atlantic coast of Europe as far north as Finland and including Iceland, as far south as the coast of Morocco, and ranges in the entire Mediterranean nesting on parts of the coastline of most European (e.g. Italy, Turkey) and north African countries (e.g. Algeria, Libya), as well as parts of the Black Sea coast (e.g. Ukraine) (del Hoyo et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The shag is generally a coastal bird, and occurs inland less often than the cormorant. It has a wide distribution around the coastline of Britain (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

European shags are from 65 to 80 cm in length and 90 to 105 cm in wingspan. They average 2 kg in mass. They have black plumage overall with greenish iridescent hues. They have black feet, legs, and bill, with bright yellow skin at the base of the bill and bright turquoise eyes. They have a small, single, black crest that develops in the breeding season, when they also develop their most intense green hues to the plumage. Non-breeding adults have duller plumage with a pale chin, mottled plumage on the throat, and the bill becomes yellowish. Juveniles are uniformly brown and have pale areas on the head and underparts. They are similar in appearance to great cormorants (Phalacrocorax carbo), but are overall smaller.

Average mass: 2 kg.

Range length: 65 to 80 cm.

Range wingspan: 90 to 105 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

European shags are found along rocky, marine coastlines and islands and are never found very far from land or very far inland. Preferred foraging grounds are in clear, protected waters over sand or rocky substrates, such as in bays or coastal channels. They avoid fresh, brackish, or muddy water.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour The European Shag is a coastal species that shows high nesting site fidelity. It feeds exclusively diurnally, and one bird is always present with the clutch or brood during the breeding season. The species breeds in colonies (del Hoyo et al. 1992) that can hold more than a thousand well-spaced pairs (Snow and Perrins 1998, Nelson 2005). It is largely sedentary (del Hoyo et al. 1992), although immatures may undergo post-breeding dispersive movements over short distances (del Hoyo et al. 1992). Some birds undergo short-distance migrations during winter. Individuals often forage alone when away from nesting colonies and in winter (del Hoyo et al. 1992, Snow and Perrins 1998), but may follow dense shoals of fish in flocks of several hundred individuals (Nelson 2005). Habitat It occupies marine habitats but does not usually occur far from land (del Hoyo et al. 1992). It shows a strong preference for rocky coasts and islands (del Hoyo et al. 1992) with adjacent deep, clear water (Nelson 2005), and forages over sandy and rocky seabeds (del Hoyo et al. 1992). It also prefers sheltered fishing grounds such as bays and channels, although it generally avoids estuaries, shallow or muddy inlets and fresh or brackish waters (Wanless and Harris 1997). Diet The species feeds on a wide range of benthic, demersal and schooling, pelagic fish. Sandeels (Ammodytidae) are the dominant prey of birds in British and some Spanish populations (Wanless et al 1997, Velando and Friere 1999, BirdLife International 2000, Velando et al. 2005), and are consistently present in the species' diet in most other locations studied. These are usually caught at, or near, the sea bed (Wanless et al 1997). Other prey species include fish of the families Gadidae, Clupeidae, Cottidae, Labridae, and Trisopterus spp. (del Hoyo et al. 1992), although birds also take small numbers of polychaetes, cephalopods, other molluscs and small benthic crustaceans (Wanless and Harris 1997). Adults provision their chicks with sandeels, but consume a broader variety of prey for themselves (BirdLife International 2000). The Mediterranean subspecies feeds mainly on coastal fishes, caught from the bottom or mid water over rocky or sandy seabeds, but economically important fish seem to form a very small part of the diet (Aguilar and Fernandez 1999). Breeding site The nest is constructed of marine vegetation and flotsam (del Hoyo et al. 1992, Nelson 2005), from just above the high water level to over 100 m high (Snow and Perrins 1998) on ledges, in crevices or in caves on sea cliffs, rocks and stacks, and at the base of sea cliffs amongst boulders (del Hoyo et al. 1992). Foraging range At Islas Cíes, Spain, birds foraged within 20 km of the colony all year round (Velando et al. 2005). During the breeding season, the foraging range was typically within 4 km of the colony, and birds foraged in groups of 300-1000 individuals (Velando et al. 2005). Foraging areas tend to coincide with areas of sandy benthic sediment (Wanless et al 1991, BirdLife International 2000, Velando et al. 2005), and occur where depth is less than 80 m (Wanless et al 1991, Velando and Friere 1999). At the Isle of May, Scotland, over 90% of foraging occurred within 13 km of the colony, and the maximum distance recorded was 17 km (Wanless et al 1991). Foraging individuals visited more than one area during a trip, often feeding at sites several kilometres apart (Wanless et al 1991). Birds were often found feeding in areas of strong tidal flow (Wanless et al 1991). The available data on European Shag feeding habitat suggest that, within the inshore zone as a whole, the species is fairly plastic in its habitat requirements. In some areas, the birds' foraging range is considerably less than 20 km; the small number of birds breeding at Hirta, Scotland, all appeared to forage within a 2 km radius (BirdLife International 2000). Similarly, birds were only present within 3 km of North Rona, Scotland (BirdLife International 2000).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9956 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2166 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.938 - 12.736
  Nitrate (umol/L): 1.402 - 10.668
  Salinity (PPS): 27.525 - 35.363
  Oxygen (ml/l): 6.069 - 6.963
  Phosphate (umol/l): 0.256 - 0.710
  Silicate (umol/l): 0.987 - 5.008

Graphical representation

Temperature range (°C): 7.938 - 12.736

Nitrate (umol/L): 1.402 - 10.668

Salinity (PPS): 27.525 - 35.363

Oxygen (ml/l): 6.069 - 6.963

Phosphate (umol/l): 0.256 - 0.710

Silicate (umol/l): 0.987 - 5.008
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds in loose colonies (1) on rocky coastal cliffs and islands (2). Nests are made in crevices, under boulders or in small caves (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

European shags often forage alone, but will form large foraging flocks of several hundred when prey conditions allow. They eat almost exclusively small fish, although they will also eat crustaceans, cephalopods, and polychaete worms. Common fish prey include Gadidae, Clupeidae, Cottidae, Labridae, Ammodytes, and Trisopterus species. European shags don't hunt cooperatively and generally dive and pursue their prey under water. They perform a distinctive "leap" before diving into the water. European shags forage in deeper water and tend to eat different types of fish than great cormorants (Phalacrocorax carbo), with which they co-occur.

Animal Foods: fish; mollusks; aquatic or marine worms; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

European shags are susceptible to Newcastle disease. They are important predators of small fish in their coastal habitats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

European shags are preyed on by introduced American mink (Neovison vison) at some nesting colonies. Other predators are not reported, but probably include coastal raptors, like white-tailed eagles (Haliaeetus albicilla, and avian nest predators such as gulls or corvids. Their nesting habits on steep, rocky, coastal cliffs, prevent some predation.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

European shags produce a variety of grunting and clicking vocalizations, which can be heard at the   RSPB site. Other forms of communication are not well documented, but European shags may use visual displays in mating like other cormorants.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Maximum lifespan is not reported for European shags, but studies demonstrate that most mortality occurs in the first year of life as a direct result of lower foraging efficiency. Other significant sources of mortality are accidental and intentional deaths through entanglement in fishing gear and persecution by humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30.6 years (wild) Observations: In the wild, these animals may live up to 30.6 years (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

European shags are monogamous and pair-bonds often last over successive years. Pairs re-use their nests regularly.

Mating System: monogamous

European shags build nests of sticks, seaweed, and other marine debris on rocky ledges, cliffs, or stacks. Nests have been found from just above the high water level to 100 m above the sea. Nesting areas host large concentrations of these birds, who nest in close proximity. Nests are said to have an intense, unpleasant smell, especially as the seaweed rots. Larger nests have higher success rates than smaller nests and nests on narrow cliffs are less successful than those in other areas. Breeding season varies regionally, with southern populations (Tunisia) breeding from November to February, Black Sea populations breeding from January to March, and northern Atlantic populations breeding from March through June. Females lay from 1 to 6 eggs (usually 3), usually begin incubation after laying the 2nd egg, and incubate them for 30 to 31 days. Hatchling European shags fledge at about 53 days, remain in the nest for 8 weeks after hatching, and are cared for by their parents for 15 to 50 days after they fledge. Within 30 days of hatching males are generally larger than females and the hatchling from the last egg laid is generally smaller. Females may breed as early as their 2nd year.

Breeding interval: European shags breed once yearly.

Breeding season: Breeding season varies with region, occuring between November and June throughout their range.

Range eggs per season: 1 to 6.

Average eggs per season: 3.

Range time to hatching: 30 to 31 days.

Average fledging age: 53 days.

Range time to independence: 68 to 103 days.

Range age at sexual or reproductive maturity (female): 2 (low) years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

European shag hatchlings are naked at hatching and develop brown down. They fledge at about 53 days old. Both adults protect and provide for their young, incubating them between their feet and breast and alternating duties. They continue to provide food for another 15 to 50 days after the young have fledged. At one site hatching success was from 69 to 73% and fledging success was from 67 to 95%. Most mortality of young is associated with food shortages.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Male, Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phalacrocorax aristotelis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGCATAGTCGGAACTGCCCTCAGCCTACTTATCCGCGCAGAACTAGGTCAACCAGGAACCCTCCTAGGAGACGACCAAATCTACAACGTAATTGTCACCGCTCATGCTTTCGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGATTCGGAAACTGACTGGTTCCCCTCATAATCGGCGCCCCCGACATAGCATTTCCACGTATAAACAACATAAGCTTCTGACTCCTTCCACCATCATTCCTCCTCCTATTAGCCTCCTCTACAGTAGAAGCAGGCGCAGGCACAGGATGAACTGTATATCCGCCCCTAGCTGGAAACCTAGCCCATGCCGGTGCCTCAGTCGACCTAGCCATCTTCTCCCTCCACCTAGCAGGGGTGTCCTCAATCCTGGGAGCAATCAACTTCATCACAACTGCCATTAACATAAAACCCCCAGCCCTATCACAATACCAAACCCCACTATTCGTCTGATCAGTACTAATCACTGCAGTTTTACTCCTACTCTCACTCCCCGTCCTCGCTGCTGGAATCACCATACTCCTAACCGATCGAAATCTAAACACAACATTCTTTGACCCTGCTGGAGGAGGAGACCCAGTCCTGTATCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTCTACATCCTAATCCTCCCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phalacrocorax aristotelis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

European shags have a large range and population estimates are approximately 260,000 to 290,000 individuals. Large population declines have not been documented and they are considered "least concern" by the IUCN. They are often entangled and killed in fishing gear and nets or are intentionally killed by fishermen. They are vulnerable to the impacts of coastal pollution, such as oil spills.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Receives general protection under the Wildlife and Countryside Act 1981. Classified as a species of conservation concern by the UK Biodiversity Action Plan, although not a priority species (2). Included in the Birds of Conservation Concern Amber List (medium conservation concern) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species is persecuted (e.g. shot, intentionally drowned or poisoned) at commercial fisheries and fish farms as it is perceived to be a threat to fish stocks (Carss 1994, Wanless and Harris 1997). It also suffers predation at nesting colonies by introduced American mink Neovison vison (Wanless and Harris 1997), is vulnerable to coastal oil pollution (Wanless and Harris 1997, Velando et al. 2005), locally suffers from accidental entanglement and subsequent drowning in gill-nets (fishing nets) (Wanless and Harris 1997, Velando and Freire 2002), and is susceptible to the Newcastle disease so may be threatened by future outbreaks of the virus (Kuiken 1999). Utilisation Eggs, chicks and adults are taken from colonies for food (Wanless and Harris 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Shags are not threatened at present; however, manmade disasters such as oil spills are potentially extremely damaging, and can result in high local mortality (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

There is no conservation action directly targeted at this species. However, many populations occur within protected reserves, and like all wild birds, the shag is protected by the Wildlife and Countryside Act (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

European shags are persecuted because of the perception that they interfere with commercial or subsistence fishing, although they eat mainly small fish so are unlikely to compete directly with humans for prey. They may interfere at hatcheries.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

European shag eggs, young, and adults are sometimes taken from nests or hunted for food.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

European shag

The European shag or common shag (Phalacrocorax aristotelis) is a species of cormorant. It breeds around the rocky coasts of western and southern Europe, southwest Asia and north Africa, mainly wintering in its breeding range except for northernmost birds. In Britain this seabird is usually referred to as simply the shag.[2]

Young European shag in Croatia
On the nest in Deerness, Orkney

Description[edit]

This is a medium-large black bird, 68 to 78 centimetres (27 to 31 in) long and with a 95-to-110-centimetre (37 to 43 in) wingspan. It has a longish tail and yellow throat-patch. Adults have a small crest in the breeding season. It is distinguished from the great cormorant by its smaller size, lighter build, thinner bill, and, in breeding adults, by the crest and metallic green-tinged sheen on the feathers. Among those differences are that a shag has a lighter, narrower beak; and the juvenile shag has darker underparts. The European shag's tail has 12 feathers, the great cormorant's 14 feathers. The green sheen on the feathers results in the alternative name green cormorant sometimes being given to the European shag.

Habitat[edit]

Shag in flight

It feeds in the sea, and, unlike the great cormorant, is rare inland. It will winter along any coast that is well-supplied with fish.

The European shag is one of the deepest divers among the cormorant family. Using depth gauges, European shags have been shown to dive to at least 45 metres (148 ft). European shags are preponderantly benthic feeders, i.e. they find their prey on the sea bottom. They will eat a wide range of fish but their commonest prey is the sand eel. shags will travel many kilometres from their roosting sites in order to feed.

In UK coastal waters, dive times are typically around 20 to 45 seconds, with a recovery time of around 15 seconds between dives; this is consistent with aerobic diving, i.e. the bird depends on the oxygen in its lungs and dissolved in its bloodstream during the dive. When they dive, they jump out of the water first to give extra impetus to the dive.

It breeds on coasts, nesting on rocky ledges or in crevices or small caves. The nests are untidy heaps of rotting seaweed or twigs cemented together by the bird's own guano. The nesting season is long, beginning in late February but some nests not started until May or even later. Three eggs are laid. Their chicks hatch without down and so they rely totally on their parents for warmth, often for a period of two months before they can fly. Fledging may occur at any time from early June to late August, exceptionally to mid-October.

Subspecies[edit]

There are three subspecies:

The subspecies differ slightly in bill size and the breast and leg colour of young birds. Recent evidence suggests that birds on the Atlantic coast of southwest Europe are distinct from all three, and may be an as-yet undescribed subspecies (Yésou et al., Brit. Birds 98: 369-370, 2005).

The name shag is also used in the Southern Hemisphere for several additional species of cormorants.

Example locations[edit]

European shags in breeding plumage, Snæfellsnes, Iceland

The European shag can be readily be seen at the following breeding locations in the season (late April to mid July): Farne Islands, England; Deerness and Fowlsheugh, Scotland; Runde, Norway; Iceland, Faroe Islands and Galicia.

The largest colony of European shags is in the Cies Islands, with 2,500 pairs (25% of the world's population).

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!