Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

Belgium, Djibouti, Eritrea, Kenya, Madagascar, Mozambique, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Red Sea, Somalia, South Africa (country), Spanish Exclusive Economic Zone, Tanzania, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Palearctic; winters to s Africa, c Asia, Philippines and Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Actitis hypoleucos, often referred to as common sandpipers, can be found throughout the world from western Europe, eastward across Asia to Japan, extending south to Africa and Australia. During the spring and summer when it is breeding season, they are typically found in the northern hemisphere ranging from the Atlantic Ocean to Japan, usually in temperate climates. Common sandpipers are migratory birds that overwinter in warmer climates throughout the Old World, specifically Africa, southern Asia, and Australia.

Biogeographic Regions: palearctic (Native ); oriental (Native ); ethiopian (Native ); australian (Native )

  • Malpas, L., J. Ekstrom, S. Butchart. 2004. Common Sandpiper (Actitis hypoleucos). Detailed Species Accounts from Birds in Europe.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Non-breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: BREEDS: Eurasia, from the British Isles and Scandinavia to Anadyrland and Kamchatka; eastern Africa. WINTERS: southern Europe, central Asia, and Phillipines south to southern Africa, islands in the Indian Ocean, Australia, and islands of the western Pacific Ocean (Sibley and Monroe 1990). Rare but regular migrant, usually in spring, in the outer Aleutians, Pribilofs, and St. Lawrence Island (NGS 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult, breeding common sandpipers are brownish-gray on their heads, napes and breast, which are all faintly streaked with dark brown. Their bellies and undertail coverts are unmarked white. Backs, wings and tails are overall darker brown, mottled with shades of tan and very dark brown. In addition, they often have a white ring around the eyes. Like many migrating birds, common sandpipers molt after the breeding season into their winter plumage. Winter plumage is a more drab version of the breeding plumage, and the streaking in particular fades or disappears completely. The young have white speckles also on the upper part. Juveniles look very similar to wintering adults, but have significantly more buff incorporated into their mottled upperparts. This species can be distinguished from the spotted sandpiper due to their longer tail feathers and darker legs. They are approximately 8 grams at hatching and their mass increases to about 40 grams when able to fly. In addition they grow to be about 20 cm long with bills measuring 21 mm in length. Their wingspan adult wingspan reaches 35 cm. This species displays no sexual dimorphism in plumage, but females tend to be a little larger than males.

Average mass: 40 g.

Range length: 18 to 24 cm.

Average length: 20 cm.

Average wingspan: 35 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; female larger

  • Chandler, R. 2009. Shorebirds of North America, Europe, and Asia: a Photographic Guide. New Jersey: Princeton University Press.
  • Holland, P., D. Yalden. 1991. Growth of Common Sandpiper Chicks. Wader Study Group, 62: 13-15.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 20 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Length: 19 cm. Plumage: above and on sides of neck and chest uniform dark brown; below white extending around bend of wing; white superciliary stripe; conspicuous white wingbar in spread wing, breeding bird has noticeable streaking above and on neck and breast. Immature like adult. Bare parts: iris brown; bill variable from grey or olive-grey to dark brown with ochre or pinkish base; feet and legs variable from greenish grey to yellowish olive. Habitat: almost any marine or freshwater shoreline. Palearctic migrant. <389><391><393>
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is a full migrant, migrating at night overland on a broad front across both deserts and mountains1. Small numbers may also remain in the northern maritime climatic zone (e.g. the British Isles, Mediterranean and Japan) throughout the year1, 2. The European population that overwinters in West Africa migrates south between mid-July and August (juveniles following one month later), and returns to the breeding grounds from late-March to April1, 2. Immature individuals may also remain in the winter range throughout the summer breeding season2. The species breeds from May to June in scattered single pairs 60-70 m apart in optimal breeding habitat1, and migrates singly or in small flocks1, although it usually remains solitary in its winter range3. It forages diurnally1 and may aggregate at night4 into roosts of over 100 individuals1. Habitat Breeding During the breeding season this species shows a preference for pebbly, sandy or rocky margins of fast-flowing rivers1, 2, as well as small ponds, pools2 and dams3, clear freshwater lake shores, sheltered sea coasts with rocky or sandy beaches, tidal creeks and estuaries3, and often forages in patches of dry meadow1. It occurs from sea level up to 4,000 m or more in the mountains, but generally avoid frozen, snow-clad or very hot areas2. Non-breeding In its winter range this species inhabits a wide variety of habitats, such as small pools, ditches, riverbanks1, 2, streams, dam shores5, marshy areas4, estuaries, freshwater seeps on coastal shores, tidal creeks in mangrove swamps and saltmarshes, harbours, docks2, 5 and filtration tanks of sewage works5. It will also forage on grassland along roadsides and occasionally in gardens1, 5, but it generally avoids large coastal mudflats1. Diet The diet of this species consists of adult and larval insects (such as beetles and Diptera), spiders, molluscs, snails, crustaceans, annelids, and occasionally frogs, toads, tadpoles and small fish, as well as plant material (including seeds)1, 3. Breeding site The nest is a shallow depression, sometimes amongst shrubs and trees1.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common sandpipers can live in a variety of habitats depending on season. During the breeding season, they tend to nest along sandy coasts and river banks preferably near fast-moving water. Their habitat can extend up into the mountains as high as the tree-line if the climate and environment is suitable. They are able to withstand heavy rain and a broad range of day-to-night temperatures to be expected in a temperate climate. In the winter when the breeding season has passed, common sandpipers tend to move south to more tropical climates where they prefer to live in wetlands. They generally choose ponds, rivers, canals, estuaries, and mangroves. As evidence by their habitat selection, common sandpipers avoid very hot climates, as well as frozen or snowy regions.

Range elevation: Sea level to 4,000 m.

Habitat Regions: temperate ; tropical ; terrestrial ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh ; swamp ; bog

Other Habitat Features: riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.605 - 10.196
  Nitrate (umol/L): 2.813 - 4.780
  Salinity (PPS): 33.777 - 35.082
  Oxygen (ml/l): 6.360 - 6.636
  Phosphate (umol/l): 0.371 - 0.446
  Silicate (umol/l): 1.816 - 3.454

Graphical representation

Temperature range (°C): 9.605 - 10.196

Nitrate (umol/L): 2.813 - 4.780

Salinity (PPS): 33.777 - 35.082

Oxygen (ml/l): 6.360 - 6.636

Phosphate (umol/l): 0.371 - 0.446

Silicate (umol/l): 1.816 - 3.454
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Streams, ponds, lakes; in migration, seacoasts and marshes (Sibley and Monroe 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Common sandpipers usually eat small invertebrates, crustaceans, aquatic and terrestrial insects, worms, and spiders, as well as scavenge on scraps from boats or from near shore. On occasion, they will eat small amphibians, tadpoles, fish and seeds. They locate live prey by running along the coastline and then run, swim, or dive to capture it. They break their prey into smaller pieces in order to feed. Typically, they feed individually or in pairs and avoid foraging in areas where other flocks feed to avoid competition and predation.

Animal Foods: amphibians; fish; insects; terrestrial non-insect arthropods; terrestrial worms; aquatic or marine worms; aquatic crustaceans; other marine invertebrates

Plant Foods: seeds, grains, and nuts

Primary Diet: carnivore (Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Actitis hypoleucos is one of three species within the family Scolopacidae that does not display a resistance to blood parasites. As a consequence, they tend to be carriers of blood parasites such as Haemoproteus contortus. Common sandpipers are also carriers of various other common avian parasites. They also play an important roles as predator and prey within their ecosystem.

Commensal/Parasitic Species:

  • blood parasites (Haemoproteus contortus)

  • Earle, R., L. Underhill. 1992. Absence of Haematozoa in Some Charadriformes Breeding in the Taimyr Peninsula, Russia. Ardea, 81/1: 21-24.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Young common sandpipers are particularly vulnerable to predation before fledging. Further enhancing their vulnerability, chicks tend to be weak and unable to escape predators. As a defense against predation, parents fly away in order to distract the predators and they gather in flocks to work together to provide defense. When near water, they can also dive for short periods of time when being chased. Like many sandpipers, their brown-mottled coloration serves as camouflage in their coastal habitats. Some known predators of common sandpipers include estuarine crocodiles, foxes, weasels, gulls and skuas.

Known Predators:

Anti-predator Adaptations: cryptic

  • Yalden, D., T. Dougall. 2004. Production, Survival, and Catchability of Chicks of Common Sandpipers Actitis hypoleucos. Wader Study Group, 104: 82-84.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Common sandpipers communicate with each other by vocalizations that resemble "Twee, wee, wee". These vocalizations are most common when they are flying in the air and trying to communicate. Common sandpipers are noisy when breeding or moving, but are very quiet when eating. In addition, they may use their wings and other forms of visual signaling. Like most birds, common sandpipers perceive their environments through visual, tactile, auditory and chemical stimuli.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Young sandpipers show a survival rate around 57%. With adults, this rate rises up to 85%. The average common sandpiper is able to live approximately 8 years in the wild. However, the oldest recorded individual was slightly over 14 years of age.

Range lifespan

Status: wild:
14 (high) years.

Average lifespan

Status: wild:
8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Common sandpipers are almost exclusively monogamous for each breeding season. The length of this pair bond is currently unknown. The male will defend his territory and his female by making threatening displays. A specific example is a salute where they throw out one or both wings as a warning that they are prepared to chase intruders off to defend the territory. On rare occasions, the female may join in displaying threats, but the female does not engage in fighting.

Mating System: monogamous

Common sandpipers typically breed in the northern hemisphere during May and June. Common sandpipers construct scrape nests, which are essentially shallow indentations on the ground and are typically left unlined. The female excavates a nest within 50 meters of water and then lays an average of 4 eggs per clutch. The incubation period lasts an average of 21 days and the chicks usually hatch within the first 10 days of June. The precocial young fledge after 22 to 28 days. Growth rate of chicks have been shown to correlate with weather, with higher growth rates associated with warmer temperatures. They tend to be fast growing, but as a result use up a lot of energy early on in development. Juvenile common sandpipers often remain on the wintering grounds for their first summer, and thus don't breed until almost 2 years of age.

Breeding interval: Common sandpipers breed once a year.

Breeding season: Breeding typically occurs during May and June.

Range eggs per season: 3 to 4.

Average eggs per season: 4.

Average time to hatching: 21 days.

Average birth mass: 8 g.

Range fledging age: 22 to 28 days.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

The female is responsible for building the nest. Once the eggs have been laid, both parents share incubation duties until the eggs hatch after 3 weeks. The young are fed and protected by both parents for several days after hatching. Young are semi-precocial at birth and are able to leave the nest soon after hatching to hide in nearby vegetation. The female typically departs before the young fledge at 22 to 28 days old.

Parental Investment: precocial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Mee, A., D. Whitfield, D. Thompson, T. Burke. 2004. Extrapair Paternity in the Common Sandpiper, Actitis hypoleucos, Revealed by DNA Fingerprinting. Animal Behaviour, 67/2: 333-342.
  • Tan, R. 2001. "Common Sandpiper Acititis hypoleucos" (On-line). Naturia. Accessed February 11, 2011 at http://www.naturia.per.sg/buloh/birds/Actitis_hypoleaucos.htm.
  • Yalden, D., T. Dougall. 1994. Habitat, Weather, and the Growth Rates of Common Sandpiper Actitis hypoleucos Chicks. Wader Study Group, 73: 33-35.
  • del Hoyo, J., A. Elliott, J. Sargatal. 1996. Handbook of the Birds of the World. Volume 3: Hoatzin to Auks.. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Actitis hypoleucos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTTTCATCAACCGATGATTATTTTCAACCAACCACAAAGATATCGGCACTCTGTACCTAATTTTTGGCGCATGAGCTGGCATAGTCGGAACTGCCCTTAGCCTACTCATTCGTGCAGAACTAGGCCAACCAGGGACCTTACTAGGTGACGACCAAATCTACAATGTAATCGTCACTGCCCATGCTTTCGTTATAATCTTTTTCATAGTAATACCAATCATGATTGGCGGCTTCGGAAATTGACTAGTCCCACTCATAATTGGCGCGCCCGATATAGCATTTCCTCGTATAAACAACATAAGCTTCTGACTACTTCCCCCATCATTCCTGTTACTTCTTGCATCATCCACAGTAGAAGCTGGGGCCGGTACAGGATGAACAGTATATCCCCCTCTTGCTGGTAACCTAGCCCATGCTGGGGCATCAGTAGACCTAGCTATCTTTTCCCTTCACCTAGCAGGTGTCTCCTCCATTCTTGGCGCCATCAACTTTATCACAACTGCTATCAACATAAAACCCCCAGCTCTCTCCCAATACCAAACCCCCCTATTTGTTTGATCAGTCCTTATTACTGCCGTCCTACTCCTACTTTCCCTCCCAGTCCTCGCTGCTGGCATTACCATACTATTAACAGATCGAAACCTAAATACTACATTCTTTGACCCAGCCGGGGGAGGAGATCCAGTCCTATATCAACACCTCTTCTGATTTTTTGGTCACCCAGAAGTTTACATTTTAATCCTACCAGGCTTCGGAATTATTTCCCATGTCGTAGCCTACTACGCAGGCAAAAAAGAACCATTCGGGTACATAGGAATAGTATGAGCTATACTATCTATCGGATTCCTAGGCTTCATCGTTTGAGCCCATCACATATTCACAGTAGGAATAGACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Actitis hypoleucos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Currently, common sandpipers are listed under the category of Least Concern by the International Union for the Conservation of Nature and Natural Resources (IUCN). They are presently one of the most widespread and adaptable shorebirds. There are estimated to be between 2,600,000 and 3,200,000 adults living worldwide. Their population has been declining recently, but their population size is large enough to not be vulnerable at this point. This decline in population is attributed to a decreasing breeding population as a result of those lost due to recreational fishing. Increased human development on coastal areas frequently disrupts the breeding activities of this, and many other shorebirds. Such disturbances during the breeding season result in failed nesting attempts, and an overall population decrease.

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3N - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Total regarded as a minimum by Wetlands International (2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The size of the breeding population in England is threatened by disturbance from recreational anglers5.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative effects of common sandpipers on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known positive economic effects of common sandpipers for humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common Sandpiper

The Common Sandpiper (Actitis hypoleucos) is a small Palearctic wader. This bird and its American sister species, the Spotted Sandpiper (A. macularia), make up the genus Actitis. They are parapatric and replace each other geographically; stray birds of either species may settle down with breeders of the other and hybridize. Hybridization has also been reported between the Common Sandpiper and the Green Sandpiper, a basal species of the closely related shank genus Tringa.

Contents

Description

The adult is 18–20 cm long with a 32–35 cm wingspan. It has greyish-brown upperparts, white underparts, short dark-yellowish legs and feet, and a bill with a pale base and dark tip. In winter plumage, they are duller and have more conspicuous barring on the wings, though this is still only visible at close range. Juveniles are more heavily barred above and have buff edges to the wing feathers.[2]

This species is very similar to the slightly larger Spotted Sandpiper (A. macularia) in non-breeding plumage. But its darker legs and feet and the crisper wing pattern (visible in flight) tend to give it away, and of course they are only rarely found in the same location.[2]

Ecology

It is a gregarious bird and is seen in large flocks, and has the distinctive stiff-winged flight, low over the water, of Actitis waders. The Common Sandpiper breeds across most of temperate and subtropical Europe and Asia, and migrates to Africa, southern Asia and Australia in winter. The eastern edge of its migration route passes by Palau in Micronesia, where hundreds of birds may gather for a stop-over. They depart the Palau region for their breeding quarters around the last week of April to the first week of May.[2][3]

Wintering bird foraging matakakoni-style, Puri (Odisha, India)

The Common Sandpiper forages by sight on the ground or in shallow water, picking up small food items such as insects, crustaceans and other invertebrates; it may even catch insects in flight. In the Nukumanu language of the Nukumanu Islands (Papua New Guinea), this species is usually called tiritavoi. Another Nukumanu name for it, matakakoni, exists, but this is considered somewhat taboo and not used when children and women are around. The reason for this is that matakakoni means "bird that walks a little, then copulates", in reference to the pumping tail and thrusting head movements the Actitis species characteristically perform during foraging.[2][4]

It nests on the ground near freshwater. When threatened, the young may cling to their parent's body to be flown away to safety.[2][5]

The Common Sandpiper is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

It is widespread and common, and therefore classified as a Species of Least Concern by the IUCN but is a vulnerable species in some states of Australia.[1]

References

  1. ^ a b BirdLife International (2012). "Actitis hypoleucos". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106003027. Retrieved 16 July 2012.
  2. ^ a b c d e Hayman, Peter; Marchant, John & Prater, Tony (1986): Shorebirds: an identification guide to the waders of the world. Houghton Mifflin, Boston. ISBN 0-395-60237-8
  3. ^ VanderWerf, Eric A.; Wiles, Gary J.; Marshall, Ann P. & Knecht, Melia (2006): Observations of migrants and other birds in Palau, April–May 2005, including the first Micronesian record of a Richard's Pipit. Micronesica 39(1): 11-29. PDF fulltext
  4. ^ Hadden, Don W. (2004): Birds of the northern atolls of the North Solomons Province of Papua New Guinea. Notornis 51(2): 91–102. PDF fulltext
  5. ^ Mann, Clive F. (1991): Sunda Frogmouth Batrachostomus cornutus carrying its young. Forktail 6: 77-78. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Constitutes a superspecies with Macularia (AOU 1998). Included in the genus Tringa by Sibley and Monroe (1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!