Overview

Brief Summary

Biology

Breeding in the bristle-thighed curlew probably starts around May, when the bird can be found on the Alaskan tundra (2). They are monogamous birds, forming long-term bonds, and are not only faithful to a partner, but also to breeding and wintering sites, returning to the same place year after year (5). Generally, four eggs are laid into a simple, bare depression in mossy vegetation, and both sexes will incubate the eggs for about 25 days (2) (6). The chicks leave the nest shortly after hatching, and continue to receive parental care, initially from both parents, and then just the male as the female deserts the brood before the chicks fledge (2) (6). Whilst breeding, the adults aggressively defend the eggs and chicks, and often attack potential predators or perform displays to distract them (6). After the breeding season juveniles and adults congregate on the Yukon River delta. Here they feed on berries, insects and other foods in preparation for the migration to their wintering grounds; an impressive journey in which they fly non-stop for over 4000 kilometres (2) (6). They arrive at the oceanic islands in late August to early September, where they will undergo a moult. During this moult, over 50 percent of adults become completely flightless, for a period of two weeks (2). Whilst on their wintering grounds, the curlews are opportunistic feeders, taking crustaceans, insects, spiders, snails, small fish, scorpions and the eggs of seabirds (2) (6). They show remarkable ingenuity by using rocks to crack the thick egg shells, a rare example of tool use by birds (6). Occasionally they also feed on seabird carrion and fish regurgitated by seabirds and lizards (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This medium-sized shorebird possesses a long, down curved, touch-sensitive bill; a unifying characteristic of all curlews. The curlew's genus name Numenius means 'of the new moon' and refers to the long, crescent-shaped bill. It has plumage that is mostly flesh-coloured to pale brown, with darker brown broad stripes on the head, and the upperparts are spotted cinnamon and dark brown. The underparts are streaked buff, the belly and feathers under the tail are whitish, and the legs are a pale blue-grey (2) (4). Their name comes from the bristle-like extensions at the base of their legs, although these are generally inconspicuous and can only be seen when close up. Females are heavier than males and have longer wings and a shorter bill. Juveniles are similar to adults except for the presence of larger cinnamon-buff spots on the upperparts, and virtually unstreaked underparts (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Breeds w Alaska; winters Hawaii and Micronesia to Polynesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

New Zealand Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Numenius tahitiensis breeds on the lower Yukon River and central Seward Peninsula in western Alaska, USA. Suggestions that it breeds in Russia are unsupported5. It winters on oceanic islands, including the Hawaiian Islands (USA), US Minor Outlying Islands, Northern Mariana Islands (to USA), Federated States of Micronesia, Marshall Islands, Nauru, Kiribati, Tuvalu, Tokelau (to New Zealand), Fiji, Tonga, Niue (to New Zealand), Samoa, American Samoa, Cook Islands, and French Polynesia, also reaching the Solomon Islands, Norfolk Island (to Australia), Kermadec Islands (New Zealand), Pitcairn Islands (to UK) (notably Oeno) and Easter Island (Chile)1,3,10,11. The breeding population is c.7,000 birds, but c.3,000 subadults over-summer on Pacific islands2,9.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurs (regularly, as a native taxon) in multiple nations, but breeds in a single state or province

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-200,000 square km (about 8000-80,000 square miles)) Breeding range encompasses remote mountainous regions of western Alaska in the Andreafsky Wilderness Area north of the Yukon River mouth and on the central Seward Penninsula (McCaffery and Peltola 1986, Kessel 1989, Gill et al. 1990, Marks et al. 2002). Nonbreeding individuals occur in summer on coastal tundra from Kotzebue Sound south to Hooper Bay and occasionally in the Hawaiian Islands (AOU 1998).

Critical migration staging areas in Alaska include the coastal portions of the central and southern Yukon-Kuskokwim River Delta. The only currently known critical stopover site south of Alaska is the Northwestern Hawaiian Islands. Other possible migration stopover areas include the southern Line Islands, and the Phoenix, or Marshall island groups (Palmisano 1993).

During the nonbreeeding season, this species occurs on Pacific Ocean islands and atolls from the Hawaiian (most commonly from Midway east to French Frigate Shoals) and Marshall islands south to the Fiji, Tonga, Samoa, Marquesas, and Tuamotu islands (Gill and Redmond 1992, AOU 1998, Marks et al. 2002). Bristle-thighed curlew is unique among migratory shorebirds in wintering on remote islands (Marks et al. 1990). Subadults may remain in the Pacific until they are nearly 3 years old (Collar et al. 1992).

Coded range extent refers to breeding range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The bristle-thighed curlew breeds on the lower Yukon River and central Seward Peninsula in western Alaska, United States. It winters on many small oceanic islands in the South Pacific, from the Marshall and Hawaiian Islands, south to Santa Cruz, Fiji, Tonga, Samoa, Marquesas, Tuamotu Island and Pitcairn Island (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 43 cm

Weight: 489 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from the whimbrel (Numenius phaeopus) in being tawnier and by having a tawny unbarred rump, less streaking on the breast, and a paler bill. Bill is much shorter than that of long billed (Numenius americanus) and far eastern curlews (Numenius madagascariensis), longer, thicker, and more curved than in eskimo curlew (Numenius borealis; which averages 7 cm shorter).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Cotype for Numenius tahitiensis
Catalog Number: USNM A15379
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Female; Adult
Preparation: Skin: Whole
Collector(s): Collector Unknown
Year Collected: 1839
Locality: = Vincennes Island, Kauehi Atoll, Tuamotu Archipelago, South Pacific Ocean
  • Cotype: Peale. 1848. U.S. Exploring Expedition. 8 (mamm. and orn.): 233, pl. lxvi, fig. 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cotype for Numenius tahitiensis
Catalog Number: USNM A15377
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Female; Adult
Preparation: Skin: Whole
Collector(s): Collector Unknown
Year Collected: 1839
Locality: = Vincennes Island, Kauehi Atoll, Tuamotu Archipelago, South Pacific Ocean
  • Cotype: Peale. 1848. U.S. Exploring Expedition. 8 (mamm. and orn.): 233, pl. lxvi, fig. 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cotype for Numenius tahitiensis
Catalog Number: USNM A15727
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): Collector Unknown
Year Collected: 1839
Locality: = Vincennes Island, Kauehi Atoll, Tuamotu Archipelago, South Pacific Ocean
  • Cotype: Peale. 1848. U.S. Exploring Expedition. 8 (mamm. and orn.): 233, pl. lxvi, fig. 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cotype for Numenius tahitiensis
Catalog Number: USNM A15378
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Female; Adult
Preparation: Skin: Whole
Collector(s): Collector Unknown
Year Collected: 1839
Locality: = Vincennes Island, Kauehi Atoll, Tuamotu Archipelago, South Pacific Ocean
  • Cotype: Peale. 1848. U.S. Exploring Expedition. 8 (mamm. and orn.): 233, pl. lxvi, fig. 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cotype for Numenius tahitiensis
Catalog Number: USNM A15380
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Female; Adult
Preparation: Skin: Whole
Collector(s): Collector Unknown
Year Collected: 1839
Locality: = Vincennes Island, Kauehi Atoll, Tuamotu Archipelago, South Pacific Ocean
  • Cotype: Peale. 1848. U.S. Exploring Expedition. 8 (mamm. and orn.): 233, pl. lxvi, fig. 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It breeds in dwarf-shrub tundra at 100-350 m during May-July. Birds congregate in the Yukon-Kuskokwin Delta in August, and migrate south, mostly bypassing the Northwestern Hawaiian Islands to make landfall after 6,000 km or more4,7. It winters on coral reefs, sandy beaches, intertidal flats, rocky shores and in palm forests and dense vegetated understorey4,5. It is long-lived (15-23 years), forms long-term monogamous pairs, and is highly faithful to breeding and wintering sites4.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Breeding: Breeding occurs in the low, mountainous regions northeast of the lower Yukon River (Nulato Hills) and uplands of the Seward Peninsula, Alaska (Handel and Dau 1988, Marks et al. 2002). Physiography differs markedly between Seward Peninsula and Nulato Hills; the latter is characterized by lower relief, gentler slopes, more complex drainage patterns, and smaller areas of specific habitats (Marks et al. 2002). Breeding areas encompass a mosaic of subarctic and arctic tundra habitats including: low shrub/tussock tundra (Betula nana, Empetrum nigrum, Ledum palustre, Vaccinium spp., Salix spp.), mixed shrub thicket/tundra (Salix spp., Betula nana, and Alnus crispa over tussocks), tall shrubs (Salix alexensis, typically along water courses), and shrub meadow/tundra (species similar to low shrub/tussock tundra but lower and with more bare ground). Sedge (Carex aquatilis, C. bigelowii, Eriphorum spp.) and lichen meadows, though a small fraction of the overall land area, are also important habitats.

Habitat use changes during the breeding season. During pre-nesting, curlews tend to be found primarily in shrub meadow/tundra (33%) and low shrub/tussock (47%); during nesting the birds shift their activities mostly to shrub meadow/tundra; and during brood rearing, adults attending young increase their use of sedge meadows. Younger broods tend to use habitats with a moderate level of tussocks and shrub cover; after fledging they prefer sedge and lichen meadows (Gill et al. 1990).

Foraging microhabitat: Foraging occurs primarily in dwarf-shrub meadow tundra on slopes and ridges, also in wetlands and medium-shrub (0.5-1.0 meters tall) habitats including marshy streambeds, stream shorelines, shallow lakes, moss or grass/sedge understory along margins (rarely interiors) of willow thickets, and lingonberry and Labrador tea (Ledum spp.) understory around dwarf birch thickets. On staging grounds, foraging birds are most common in tundra/meadow mosaic (Marks et al. 2002).

Staging: Staging prior to primary migration occurs on the coastal fringe of the Yukon-Kuskokwim Delta and coastal lowlands of the Seward Peninsula, Alaska. Staging habitats include sedge and graminoid meadows and upland tundra (Handel and Dau 1988). Annual variation in standing crop of fruits of black crowberry and ericaceous shrubs appears to be a major determinant of habitat use. Southward migrants on the central Yukon Delta roost at night in shallow brackish pond edges surrounded by large wet-sedge meadows (Marks et al. 2002).

Nonbreeding: Winter habitats are primarily throughout Polynesia in the Central and South Pacific. This species is unique among migratory shorebirds in that the entire population is confined to islands during the nonbreeding season (Marks et al. 1990). Subadults may remain in the Pacific until they are nearly three years old (Collar et al. 1992). Habitats include ocean terraces or reef flats, ocean beaches, inter-islet channels, lagoon sand beaches, lagoon coral reefs, mudflats, saltpans, coconut groves, and vegetated clearings (Pratt et al. 1987, Gill and Redmond 1992).Gill and Redmond (1992) found that wintering birds were associated principally with saltpans (36%) and inter-islet channels (27%). During molt, flightless birds take shelter during the day in dense stands of bunchgrass (Eragrostis variabilis) (Marks et al. 1990). In the Tuamotu Archipelago, curlews were found on all atolls surveyed, regardless of rat presence or absence. Most birds were detected in coastal habitats either on the ocean (44%) or lagoon shores (41%; Tibbitts et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

During the breeding season it can be found on exposed hilly tundra. Over winter, it occurs on oceanic islands, generally in the interior amongst dense vegetation, but sometimes on sandy beaches, rocky shores, tidal mudflats and exposed reefs (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Flies at least 4,000 km nonstop between Alaska and the northern end of the nonbreeding range in the northwestern Hawaiian Islands. Apparently most curlews residing in the Central and South Pacific fly over Hawaii during northward and southward migrations, undertaking nonstop flights of more than 6,000 kilometers twice each year (one of the longest nonstop flights known for any bird) (Marks et al. 2002). Birds departing the Laysan Islands leave in small flocks (1-22 individuals, mean = 10.7), 25 percent of which are in the company of Pacific Golden-Plovers. Most birds that remain year-round on the Pacific islands are subadults (Marks and Redmond 1994b).

Most northbound migrants arrive at breeding areas in Alaska during first three weeks of May. At Mountain Village, Alaska, the southern end of breeding range, first birds seen 9-18 May from 1944-1947. More recently, first arrivals 3-6 May 1988-1991 in Nulato Hills, 32 km north of Mountain Village, and 8-18 May 1990-1992 at Neva Creek, suggesting earlier arrival for southern population (Marks et al. 2002).

From June-August, gathers on the coastal lowlands of the Seward Peninsula, the coastal fringe of the Yukon-Kuskokwim Delta and the Nushagak Peninsula of Bristol Bay, Alaska, prior to southward migration over ocean (R. Gill, pers. comm. 1998). Birds spend from a few weeks to two months on the staging grounds (Handel and Dau 1988, Gill 1998). Limited information suggests length of stay on Yukon Delta staging area is 2-3 weeks, where birds fatten on fruits that provide energy to fuel southward migration. Juveniles head for staging grounds slightly after adults and leave Alaska from mid-August to early September, unaccompanied by their parents (Marks et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Breeding and staging: Upon arrival on breeding grounds, consumes previous summer's black crowberries (Empetrum nigrum), lingonberries (Vaccinium vitis-idaea), and bog cranberries (Vaccinium oxycoccus), less frequently bog blueberries (Vaccinium uliginosum) and alpine bearberries (Arctostaphylos alpina); also spiders, beetles, moths, and butterflies. Previous year's berry crop dwindles as season progresses; by early summer curlews switch to blueberry flowers (available in good quantities for 2-3 weeks in June-early July). Insects are probably the most important food for parents and young chicks. By mid-July, adults and older chicks move to areas with plentiful ripening bog blueberries. Migrants on Yukon Delta eat bog blueberries, black crowberries, cloudberries, and a variety of aquatic and terrestrial insects (Marks et al. 2002). After snow melts, shallowly probes tundra for invertebrates, picks individual fruits and flowers off low and prostrate shrubs, occasionally snatches insects off lake surfaces or out of air, shakes pupae out of cocoons, and searches for invertebrates by pulling up and vigorously thrashing small clumps of lichen and moss (clumps then tossed to ground and examined.) Fall staging birds pick berries and glean insects from dwarf shrubs and probe wet meadows, mudflats, slough banks, and bases of water plants for invertebrates (Gabrielson and Lincoln 1959, Gill et al. 1990, McCaffery 1990, Marks et al. 2002).

Non-breeding: Forages principally in terrestrial habitats consuming spiders, land crabs, insects, seabird eggs, lizards, and carrion (Marks 1993). Food too large to be swallowed whole, such as ghost crabs (Ocypode laevis, O. ceratophthalma), are thrown against the ground until broken. Throws pieces of coral against Black-footed (Phoebastria nigripes) and Laysan albatross (P. immutabilis) eggs to break them open and eat them. Smaller, thinned-shelled eggs of shearwaters (Puffinus spp.), petrels (Pterodroma spp.), and terns (Sterna spp.) are broken open by pecking or picking them up and dropping them to the ground (Marks and Hall, 1992). Also eats eggs of frigate birds (Fregata spp.) and boobies (Sula spp.; Johnsgard 1981). Stomach contents of 14 curlews collected in Polynesia contained vegetation, crustaceans, insects, gastropods, and scorpions (Johnsgard 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: Two known and one suspected breeding areas exist in Alaska, but the number of distinct occurrences has not been determined using standardized criteria. Four key staging areas are known (on the Yukon-Kuskokwim Delta) (Gill and Tibbitts 1990). The number of wintering ground occurrences is uncertain due to the wide dispersion of the birds on South Pacific Islands (Gill and Redmond 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

2500 - 10,000 individuals

Comments: Total population is approximately 10,000 birds (range 7,500-11,800; Morrison et al. 2001). Total breeding population is among the smallest of all North American shorebirds, estimated at 3,200 breeding pairs based on surveys of suitable habitat in the two Alaska breeding areas; approximately 60% in Nulato Hills and 40% on Seward Peninsula (Marks et al. 2002). A third population may exist north of Kotzebue, but is believed to number fewer than 100 pairs. Migration counts have recorded a maximum of 5,000 birds at post-breeding staging areas on the Yukon-Kuskokwim Delta of western Alaska (USFWS 1987). Breeding population, as of the early 1990s, was estimated at about 7,000; population trend is unknown (Collar et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Breeding territories encompass approximately 0.5-1.5 square kilometers (Gill et al. 1990) and average densities range from 0.45 birds per square kilometer in early July to 0.04 birds per square kilometer in late July (Gill and Handel 1987). Territory size varies with topography, particularly configuration of drainages, and is smaller for southern population (40-100 ha in Nulato Hills) than for northern population (150-275 ha at Neva Creek). During incubation, adults at Neva Creek regularly travel from nesting territories to communal feeding and roosting areas up to 7 km away. Adults with broods move away from nesting sites, traveling on average 0.3-1.0 km in first week, 0.5-1.6 km (up to 4.4 km) in second and third weeks, and 0.6-1.0 km (up to 2.6 km) in fourth and fifth weeks (Lanctot et al.1995).

On staging grounds, gathers in communal nocturnal roosts (in shallow water ponds) of up to approximately 120 individuals (Tibbitts 1990). The average diurnal flock size on the staging grounds is 3.1 birds (range 1-33; Handel and Dau 1988). Flock size in nonbreeding habitat ranges from a few to more than 100 individuals (Pratt et al. 1987). While on the Pacific islands, many birds lose so many primaries and secondaries during molt that they become flightless for about two weeks; during molt, birds are extremely secretive by day, hiding in dense vegetation (Marks 1993). Adults molt from July through December and juveniles throughout the year (Marks et al. 1990, Marks 1993). Estimated annual survivorship for wintering birds is 80-90% (Marks 1992). The oldest known individual was one killed on Laysan Island that had been banded 23 years, 10 months earlier (Marks 1992).

Potential predators on the breeding grounds include Golden Eagles (Aquila chrysaetos), Rough-legged Hawks (Buteo lagopus), Northern Harriers (Circus cyaneus), Merlins (Falco columbarius), Short-eared Owls (Asio flammeus), Long-tailed Jaegers, Short-tailed Weasels (Mustela erminea), red foxes, and brown bears (Ursus arctos; McCaffery 1990, Lanctot et al. 1995). On breeding grounds, known predators of adults include Gyrfalcon (Falco rusticolus); of eggs, Parasitic Jaeger (Stercorarius parasiticus) and Common Raven (Corvus corax); and of chicks, red fox (Vulpes vulpes), Northern Harrier (Circus cyaneus), Gyrfalcon (Falco rusticolis), Sandhill Crane (Grus canadensis), and Long-tailed Jaeger (McCaffery 1990, Lanctot et al. 1995, Marks et al. 2002)

Forms temporary associations with American and Pacific Golden-Plover (Pluvialis dominica and P. fulva), Whimbrel, Bar-tailed Godwit, Western Sandpiper and Long-tailed Skua (Stercorarius longicaudus). Curlews and other larger-bodied species commonly attack-mobbed predators together, whereas smaller-bodied species generally give alarm calls and circle predators (Lanctot et al.1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 23.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spring migrants usually arrive singly or in groups of two, occasionally in flocks. Males often precede mates by 1-6 days. Females rarely observed before mates in same year. Nest building begins within 1-3 days of arrival. At Nulato Hills (1987-1991), most nests initiated during last two weeks of May with successful nests hatching from 15-30 June. At Neva Creek, median clutch initiation was 24-31 May, about two weeks after arrival of females. Late clutches (initiated 9-18 June) attributed to late arriving females rather than renesting attempts. Median hatching dates 22-28 June with only a few nests hatching in July. Between 95-100% of pairs hatched nests within 8-10 days in two early years and 21-22 days in one late year at Neva Creek. Second brood per season not known to occur (Marks et al. 2002).

Clutch size is typically four eggs (Kyllingstad 1948, McCaffery and Peltola 1986) which are incubated by both sexes for 24-25 days (McCaffery and Gill 1992). In the Nulato Hills of the Yukon Delta National Wildlife Refuge, 80 percent of nests beneath tundra willows hatched, whereas only about 33 percent of nests in the open were successful. Curlew nests constructed near nest sites of aggressively defensive Long-tailed Jaegers (Stercorarius longicaudus) were more successful than those in more isolated areas (McCaffery and Gill 1992). Seven of 9 nests examined by McCaffery and Peltola (1987) in the Nulato Hills were lost to predation.

Chicks are precocial and leave the nest within 12 hours of hatching. Young can fly when 21-24 days old (Lanctot et al. 1995). When 1-4 weeks old, juveniles congregate in brood aggregations (Lanctot et al. 1995). These groups typically remain intact until juveniles depart for staging areas in early August. Brood aggregations generally consist of fewer than 20 juveniles, but can contain up to 30 (McCaffery and Gill 1992, Lanctot et al. 1995). Brood groups studied by Gill et al. (1990) contained an average of 6.5 young (range = 1-12) from a minimum of 1-3 different broods. However, aggregations can include young from as many as 10 broods (Lanctot et al. 1995). Brood aggregations are tended by up to 14 parent birds, sometimes even if the aggregation does not contain any of their own young (Gill et al. 1990, McCaffery and Gill 1992, Lanctot et al. 1995). Brood aggregations move up to two kilometers per day (McCaffery and Gill 1992). Males attend aggregations 10-14 days longer than females (Gill et al. 1990). Brood aggregations often include young of other birds such as Bar-tailed Godwit (Limosa lapponica), American Golden-Plover (Pluvialis dominica), Pacific Golden-Plover (Pluvialis fulva), Whimbrel, Long-tailed Jaeger, and Western Sandpiper (Calidris mauri) (Lanctot et al. 1995). Curlews become reproductively mature in their third year (Marks 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Numenius tahitiensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATCAATCGATGATTATTCTCAACCAACCACAAAGACATCGGTACCCTCTACCTAATCTTTGGTGCATGAGCTGGCATAGTCGGAACCGCCCTCAGTCTACTCATCCGCGCTGAACTAGGTCAGCCAGGGACCCTTTTAGGAGACGACCAGATCTATAATGTAATCGTCACTGCCCATGCCTTCGTAATAATCTTCTTTATAGTAATGCCAATTATAATTGGTGGCTTCGGAAATTGACTAGTCCCACTAATAATTGGCGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCTCCATCATTCCTGCTCCTACTAGCCTCATCAACAGTTGAAGCTGGGGCCGGTACAGGATGAACTGTATACCCCCCTCTCGCTGGCAACCTAGCCCACGCCGGAGCCTCGGTAGACTTAGCCATTTTCTCCCTTCACCTAGCAGGTGTCTCCTCCATCCTAGGAGCCATCAACTTCATCACGACTGCAATTAACATAAAACCACCAGCCCTCTCTCAGTACCAAACGCCCCTATTTGTATGATCAGTACTCATCACTGCCGTCCTACTCCTTCTATCCCTCCCAGTCCTTGCTGCTGGCATTACAATGCTACTAACAGACCGAAACCTAAACACCACATTCTTCGACCCCGCTGGAGGGGGTGACCCAGTTTTATATCAACACCTTTTCTGATTCTTTGGCCACCCAGAAGTCTACATCTTAATCCTACCAGGCTTTGGAATCATCTCGCACGTCGTAACCTACTATGC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Numenius tahitiensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
C2a(ii)

Version
3.1

Year Assessed
2008

Assessor/s
BirdLife International

Reviewer/s
Symes, A., Butchart, S.

Contributor/s
Gill, R., Vilina, Y., Donaldson, P.

Justification
This species is listed as Vulnerable because its population is now small and believed to be declining, largely as a result of predation on the wintering grounds, when perhaps more than 50% of adults are flightless during autumn moult.

History
  • 2006
    Vulnerable
  • 2004
    Vulnerable
  • 2000
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2B,NNRN : N2B: Imperiled - Breeding, NNRN: Unranked - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: Breeding population consists of only 3,200 pairs in small areas in Alaska; trend is unknown; wintering populations may be threatened by significant habitat loss, predation, and disturbance. GRANK needs further review; NatureServe Rank Calculator Version 6.2 yielded a rank of G3.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1) and listed on Appendix II of the Convention on the Conservation of Migratory Species (CMS) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Morrison et al. (2001) estimated 7,000 breeders and 3,000 immatures.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Unknown

Comments: No data are available on long-term or recent trends in the size of the breeding population, but studies on the Seward Peninsula in Alaska indicate that reproduction appears adequate to maintain the current breeding population.

Residents of Rangiroa Atoll in the Tuamotu Archipelago of French Polynesia have indicated that the population has declined in recent years (Gill and Redmond 1992). Fossil evidence suggests that the birds were once common among the main Hawaiian Islands, yet today they are uncommon during migration and rarely overwinter (Marks and Redmond 1994a). It is unclear, however, whether these observations (and other data for localized areas) represent population declines or shifts in island use (Marks et al. 2002).

Given the probable increase in curlew mortality due to widespread establishment of non-native predator populations in their winter range, it seems possible that the curlew population has declined. However, such losses do not necessarily affect the breeding population size, the trend of which is uncertain.

Global Long Term Trend: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Introduced cats, dogs and possibly pigs heavily predate flightless birds on wintering grounds. Hunting for food is localised, particularly previously in the Tuamotus, and recent reports suggest it may also be a threat in the Marshall Islands, Carolines, US Minor Outlying Islands and Hawaiian offshore islands12. Breeding birds are predated by several species of raptor, Parasitic Jaeger Stercorarius parasiticus, Common Raven Corvus corax and foxes. Gold mining is a potential future threat in Alaska5. Ingestion of lead paint on Midway Island needs to be investigated (it was recently identified as a problem in seabirds)5.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Breeding: Apparently no immediate anthropogenic threats exist in breeding habitat (Gill and Handel 1987, Marks et al. 2002). However, resurgence in gold mining on the Seward Peninsula could potentially affect habitat. Travel across the tundra in heavy machinery by mining personnel can lead to localized habitat damage (Lanctot 1990). Oil/mineral exploration is presently not a serious threat due to the financially important Bering Sea fisheries resource; however, oil/mineral exploration may one day replace fisheries as the most economically important commodity in the region (R. Gill, pers. comm. 1998).

Open dumps in villages near the Yukon-Kuskokwim Delta have resulted in an unnaturally high population of Common Ravens, known predators of curlew eggs and chicks. However, predation is not known to be a significant threat.

Staging: Subsistence hunting may pose a threat to birds on the Yukon-Kuskokwim Delta. Hunter surveys indicate a substantial increase in the take of large shorebirds by Native Americans. Because hunter survey forms do not distinguish between curlews, whimbrels, and Bar-tailed Godwits, the extent of curlew harvest is unknown, but estimated from 2002 reports to be between 90 and 100 birds (fide B. McCaffery in R. Gill, pers. comm. 2004).

Nonbreeding: Potential threats include predation by a variety of introduced species, including rats (Rattus spp.), mongoose (Herpestes auropunctatus), feral pigs (Sus scrofa), dogs (Canis familiaris), and cats (Felis catus). Nonbreeding birds are most susceptible to predation during molt and are readily captured at this time by human subsistence hunters (Marks et al. 1990, Marks and Redmond 1994a). However, the degree of predation and its impact on the population are not known. Subsistence harvest is believed to be much lower now than in the past (see Marks et al. 2002). The presence of curlews on atolls in the Tuamotu Archipelago suggests they are resilient to the occurrence of Pacific rats and to the alteration of native habitats. However, lack of data on their historic numbers at these sites makes it difficult to assess the full affect of altered conditions (Tibbitts et al. 2003). Birds are also hunted and captured on steel hooks baited with pieces of coconut (Cocos nucifera; Gill 1998). Habitat is being lost to development of tourist facilities (Marks and Redmond 1994a), and some habitat has been degraded by introduced mammals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The fairly small population of bristle-thighed curlews is believed to be declining, primarily due to the impacts of introduced predators on their wintering grounds (1). The flightless period during the moult would have evolved during a time when there were no mammalian predators on the South Pacific islands where it spends the winter. Today, with the establishment of humans on these islands, and the subsequent introduction of mammals, moulting leaves the curlew in an extremely vulnerable position. Introduced cats, dogs and possibly pigs, prey heavily on the flightless curlews, causing a significant decline in numbers (4) (6). Hunting was a threat to this species in the past; on the Tuamotu islands it was traditionally caught for food. However, the possession and use of firearms is now restricted on these islands and therefore hunting no longer poses a significant threat (2). On their breeding grounds the curlew suffers predation by Arctic skuas, common ravens and foxes, and the expanding development of gold mines and mining roads on the Seward Peninsula is an increasing threat that could have a significant impact on this bird, due to its reliance on this small area for breeding (2) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
CMS Appendix II. Most breeding and staging grounds are well-protected4. The Hawaiian Islands National Wildlife Refuge protects several wintering and stop-over sites. Protection and management of habitat at Kahuku on O'ahu has facilitated an increase in the local wintering population2.

Conservation Actions Proposed
Survey key historical sites8,9. Monitor population trends2,8. Assess harvesting rate9. Identify sites with high concentrations of wintering birds8,9. Identify migratory stop-over sites8,9. Protect and manage key islands, atolls and other wintering sites2,8. Increase public awareness especially in its winter range9.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Restoration Potential: In the wintering range, will recolonize islands from which predators have been removed. For example, birds recolonized several Phoenix Islands within five months following eradication of domestic cats (Marks and Redmond 1994a).

Preserve Selection and Design Considerations: BREEDING: Because breeding territories are large and broods are very mobile, vast expanses of undisturbed tundra habitat are required to sustain the breeding population. NON-BREEDING: Requires predator-free islands that are uninhabited or sparsely populated by humans.

Management Requirements: Maintenance of predator-free islands and establishment and enforcement of regulations prohibiting harvest within the wintering range is critical (Marks and Redmond 1994a, Marks et al. 1990).

Management Research Needs: Need to determine conservation status and the ecological requirements that may be limiting curlew populations (Handel and Dau 1988). Also need to determine the extent of the breeding and staging areas, annual survivorship of various age groups, reproductive success and sources of mortality of eggs and chicks, breeding population distinctness using DNA analysis, habitat specificity during molt, the effects of exotic mammalian predators and subsistence hunting on the distribution of wintering birds, routes and timing of migration, locations of principal wintering areas, migratory stopover points, and survival rates of birds on islands with predators versus predator-free islands. Furthermore, population estimates and trends need to be refined using techniques such as mark-resighting, breeding chronology needs to be better defined, and a technique to readily determine age and sex of birds in the field needs to be developed (Gill and Handel 1990, Marks and Redmond 1994b).

Biological Research Needs: Future studies should identify concentrations of wintering birds, determine whether migratory stopover sites exist between Hawaii and the southern end of the wintering grounds, and determine how human subsistence hunting and human commensal predators affect winter habitat use and population trends. In addition, a subset of wintering populations need to be monitored regularly. Islands and atolls that support most wintering curlews need to be identified and protected (Marks and Redmond 1994a).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Some breeding and staging habitat is protected within the Yukon Delta National Wildlife Refuge. Wintering birds are protected within the Hawaiian Islands National Wildlife Refuge (NWR), Midway Atoll NWR, and satellite NWRs in Central and South Pacific on Baker Island, Howland Island, Jarvis Island, Johnston Atoll, and Rose Atoll (Marks et al. 2002). This species also occurs in wildlife reserves on various other islands in the winter range (see Marks et al. 2002).

Bristle-thighed curlew was designated as a Species of Concern by the U.S. Fish and Wildlife Service as of January 1995. The wintering range of the species includes an area the size of the continental United States with multinational jurisdiction (France, New Zealand, United States, Great Britain, and several independent island nations such as Kiribati and Tuvalu). There is currently no international protection program in effect.

Needs: Important migration stops may exist in the Central Pacific; identification and protection of these sites is needed (Marks and Redmond 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The bristle-thighed curlew occurs in a number of protected areas. Both the Yukon Delta and some of the remote Hawaiian Islands, are designated National Wildlife Refuges, which protects breeding grounds and several stop-over and wintering sites (4) (6). Wildlife and habitat is monitored in the Yukon Delta, but further specific monitoring of the curlew is recommended (4). Hawaii's Comprehensive Wildlife Conservation Strategy proposes a number of conservation actions for the bristle-thighed curlew including protecting the current habitat of the curlew in Hawaii, and protecting and restoring additional wetland habitat, especially where it can be reclaimed from abandoned urban or agricultural uses (7). However, to protect this species from further declines, it is important to tackle the primary threat of introduced mammals across its wintering range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Traditionally trapped for food throughout the Tuamotus (Collar et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: Threatened principally by predation by humans and human commensal animals in the wintering habitat. Breeding and staging habitat is relatively secure. Best managed by habitat preservation and, where needed, predator control and establishment of regulations prohibiting hunting. Regular monitoring programs need to be established at both ends of the migration route to refine population estimates and access population trends.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bristle-thighed Curlew

The Bristle-thighed Curlew (Numenius tahitiensis) is a medium-sized shorebird that breeds in Alaska and winters on tropical Pacific islands. It has a long, decurved bill and bristled feathers at the base of the legs. Its length is about 40–44 cm and wingspan about 84 cm (females averaging bigger than males). The size and shape are the same as the Whimbrel's, and the plumage is similar, spotted brown on their upper body with a light belly and rust-colored or buffy tail. The bigger buff spots on the upper body, unmarked light belly and barely marked flanks, tail color, and pale buffy-orange rump distinguish it from the Whimbrel.

The population is estimated at 7,000.

Bristle-thighed Curlews feed on a wide variety of vegetation such as flowers and berries and on insects, sea life, and other bird's eggs, which they use rocks to break open—the only tool use among shorebirds.

The bird is rarely seen near populated land masses, with only a handful of sightings in Canada, California and Oregon. It was first described scientifically during James Cook's visits to Tahiti in the 18th century, but its nesting grounds were not identified until 1948.

Nesting grounds are on the lower Yukon River and Seward Peninsula, with the birds preferring low-lying tundra near the shoreline. Nests are built in ground depressions and lined with tundra moss. Eggs are greenish with brown spots, with four to a clutch and one brood per season. Incubation lasts 25 days, with both parents tending the nest and protecting the newly hatched chicks.

Adults leave their chicks at about five weeks of age to migrate south. The chicks continue to feed until they are able to make the journey. The first leg of the migration includes a nonstop 4,000 km flight from Alaska to Laysan. They can make non-stop flights in excess of 6,000 km.

Bristle-thighed Curlews are unique among shorebirds in that they are flightless during molt. Also, their migration departures consist of small flocks and have no diurnal patterns.

Its winter habitat is tropical Oceania, and includes Micronesia, Fiji, Tuvalu, Tonga, Hawaiian Islands, Samoa, and French Polynesia. There is concern over encroachment and introduced predators in their winter habitat.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Whimbrel (Numenius phaeopus) is generally accepted as the closest relative of N. tahitiensis (Marks et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!