Articles on this page are available in 2 other languages: Dutch (1), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

It's not difficult to recognize a curlew. It has a long beak curved downward. This long beak can be seen from a long distance. And if you can't recognize it by sight, then you just need to use your ears! You can't mistake the sound they make: a kind of yoddling vibration. Once you've heard it, you'll never mistake it.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Eurasian Curlew (Numenius arquata) is a large curlew (male around 660 g, 52 cm length; female 790 g, 55 cm length) that breeds across Eurasia from the United Kingdom to Siberia, but not all the way to the Pacific coast. The wintering range extends from Europe and Japan south throughout Africa and southern Asia. Eurasian Curlews occasionally show up on the Atlantic coast of North America in spring, fall, and winter from Newfoundland to New York, as well as in the Bahamas.

Eurasian Curlews breed on moors and marshlands in the boreal forest zone (taiga), as well as in moist meadows in steppe and pastureland. When not breeding, they are found (usually in flocks) on coastal mudflats and sometimes on muddy shores of lakes and rivers and, in migration, on wet grassland and agricultural fields.

Eurasian Curlews feed by pecking, jabbing, or deep probing with their bills in mud or damp soil. When not breeding, females, which have slightly longer bills than males, tend to forage more on intertidal flats, feeding on mollusks, crabs, and polychaete worms, whereas males tend to feed more on lumbricid earthworms on cultivated grassland.

(van Gils and Wiersma 1996 and references therein; Paulson 2005)

  • Paulson, D. 2005. Shorebirds of North America: The Photographic Guide. Princeton University Press, Princeton.
  • van Gils, J. and P. Wiersma. 1996. Eurasian Curlew (Numenius arquata). Pp. 504-505 in: del Hoyo, J., Elliott, A., and Sargatal, J., eds. Handbook of the Birds of the World. Volume 3. Hoatzin to Auks. Lynx Edicions, Barcelona.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Brief

"A wader from the large Scolopacidae family, the Eurasian Curlew is one of the most widespread curlews, breeding across temperate Europe and Asia. This species if often referred to as just “the Curlew” in Europe, and colloquially as """"Whaup"""" in Scotland."
  • ""Eurasian Curlew"". Wikipedia. 24 August, 2011. Wikimedia Foundation, Inc. 30 August, 2011.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Miscellaneous Details

A study on the laterality of wildfowl and wading birds while they were performing the single task of roosting on the ground on one foot indicates that Eurasian curlews may be right footed.
  • Randler C. ""Foot preferences during resting in wildfowl and waders."" Laterality. 2007 Mar;12(2):191-7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

accidental shore bird from Eurasia, reported in Nova Scotia and Newfoundland
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Numenius arquata is widely distributed, breeding across Europe from the British Isles, through north-western Europe and Scandinavia into Russia extending east into Siberia, east of Lake Baikal. It winters around the coasts of north-west Europe, the Mediterranean, Africa, the Middle East, the Indian Subcontinent, South-East Asia, Japan and the Sundas. It has a large global population estimated to number 765,000-1,065,000 individuals (M. Barter in litt. 2007; Wetlands International 2006). The breeding population in Western Europe (220,000-360,000 pairs) has declined in recent years, with a 53% decline in the United Kingdom calculated over the period 1970-2005 from the Common Birds Census and the Breeding Bird Survey, and a 37% decline over the period 1994-2006 derived from the Breeding Bird Survey (Eaton et al. 2007; R. Gregory in litt. 2007). A decline of 86% was calculated in Ireland between 1988-1991 and 2003 (Gibbons et al. 1993; Hillis 2003) and declines have been recorded in Finland (BirdLife International 2004), Germany (Hötker et al. 2007), Lithuania (20-30% per decade) (L. Raudonikis in litt. 2007) and the Netherlands (31% since 1984 (A. J. van Djik in litt. 2007)). Unquantified, but potentially highly significant, declines have also been recorded in the central Asian populations of N. a. orientalis (J. Kamp and S. Sklyarenko in litt. 2007). In Denmark (K. N. Flensted in litt. 2007; Meltofte et al. 2009) and eastern Siberia (I. Fefelov in litt. 2007) breeding populations are apparently stable and apparent increases in wintering populations in the Wadden Sea (Laursen and Karsten 2005; Meltofte et al. 2009), on the Adriatic coast (Gusson et al. 2005), in East Asia (M. Barter in litt. 2007) and in Western Europe suggest that breeding populations, probably in European Russia and northern Siberia have perhaps increased. Overall, analysis of the compiled trend data indicate three generation (15 year) estimate of decline of between 26% and 34% (BirdLife International 2004; Hillis 2003; A. J. van Djik in litt. 2007; M. Barter in litt. 2007; Wetlands International 2006; Thorup 2006; A. Copland in litt. 2007; M. Boschert in litt. 2007; Eaton et al. 2007; R. Gregory in litt. 2007). Owing to the uncertainty over whether declines in southern populations have been compensated by increases in northern populations, the global trend is suspected to fall within the band 20-30% declines in the past 15 years or three generations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"The Eurasian Curlew is widespread in Europe, Africa and Asia. Breeding distribution: Eurasian Curlews breed in Europe, from Britain and Scandinavia, east to the Ural Mountains. Farther east, in Asia, they breed from the Volga River and the Ural Mountains, east to north-eastern China and adjacent parts of eastern Siberia and northern Kazakhstan. On passage: In the East Asia-Australasian Flyway, the subspecies N. a. orientalis is recorded on passage through eastern China, South Korea and adjacent parts of the Yellow Sea, Japan, the Philippines, Indonesia and the Malay Peninsula. Elsewhere, Eurasian Curlews are recorded on passage through the Middle East and the Indian subcontinent, and along the East Atlantic and Mediterranean Flyways, through most of Europe and Africa. Non-breeding distribution: Eurasian Curlews spend the non-breeding season over a wide area (including regions where the species is also recorded on passage), occurring in coastal regions in western Europe, virtually all of Africa, the Middle East, the Indian subcontinent, and South East and eastern Asia (south at least to Sumatra and north to the Yangtze River). Vagrants have been recorded in Timor and Halmahera and further afield in North America. There have been no acceptable records in Australia. Global distribution: Native to Afghanistan; Albania; Algeria; Angola; Armenia; Austria; Azerbaijan; Bahrain; Bangladesh; Belarus; Belgium; Benin; Bermuda; Bosnia and Herzegovina; Botswana; British Indian Ocean Territory; Brunei Darussalam; Bulgaria; Burkina Faso; Cambodia; Cameroon; Central African Republic; Chad; China; Comoros; Congo; Congo, The Democratic Republic of the; Côte d'Ivoire; Croatia; Cyprus; Czech Republic; Denmark; Djibouti; Egypt; Equatorial Guinea; Eritrea; Estonia; Ethiopia; Faroe Islands; Finland; France; Gabon; Gambia; Georgia; Germany; Ghana; Gibraltar; Greece; Guam; Guinea; Guinea-Bissau; Hong Kong; Hungary; Iceland; India; Indonesia; Iran, Islamic Republic of; Iraq; Ireland; Israel; Italy; Japan; Jordan; Kazakhstan; Kenya; Korea, Democratic People's Republic of; Korea, Republic of; Kuwait; Kyrgyzstan; Lao People's Democratic Republic; Latvia; Liberia; Libyan Arab Jamahiriya; Liechtenstein; Lithuania; Luxembourg; Macedonia, the former Yugoslav Republic of; Madagascar; Malawi; Malaysia; Maldives; Mali; Malta; Mauritania; Mauritius; Mayotte; Moldova; Mongolia; Montenegro; Morocco; Mozambique; Myanmar; Namibia; Nepal; Netherlands; Nigeria; Northern Mariana Islands; Norway; Oman; Pakistan; Philippines; Poland; Portugal; Qatar; Réunion; Romania; Saudi Arabia; Senegal; Serbia; Seychelles; Sierra Leone; Singapore; Slovakia; Slovenia; Somalia; South Africa; Spain; Sri Lanka; Sudan; Sweden; Switzerland; Taiwan, Province of China; Tajikistan; Tanzania, United Republic of; Thailand; Togo; Tunisia; Turkey; Turkmenistan; Uganda; Ukraine; United Arab Emirates; United Kingdom; Uzbekistan; Viet Nam; Western Sahara; Yemen; Zambia; Zimbabwe. Vagrant in Australia; Bahamas; Bhutan; Burundi; Canada; Cape Verde; Greenland; Lebanon; Lesotho; Niger; Niue; Rwanda; Sao Tomé and Principe; Svalbard and Jan Mayen; Syrian Arab Republic; United States. Distribution in the Indian subcontinent: Found throughout the Indian Union including Lakshadweep, Andamans, Nicobars; also in Sri Lanka, Myanmar and Maldives."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Endemic Distribution

No.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Refer section on Diagnostic Description.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

"Length From head to tail: 50-60cm on average. Bill-length: 9-15cm on average. Wingspan: 80-106cm on average. Winglength:Males - 276-302mm, and females - 286-326mm on average. Adult weight Males 540-1000g, and females - 700-1300g on average."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Length: 53-59 cm. Plumage: above, head neck and breast streaked brown on buff; belly and rump white; flanks with brown streaking. Immature like adult. Bare parts: iris brown; bill brown with pinkish base, extremely long (three times length of head) and strongly decurved; immature with shorter bill; feet and legs greenish-, pinkish- or bluish-grey. Habitat: coastal mudflats, seashores, estuaries and inland waters. Palearctic migrant, a few may oversummer. <389><391><393>
  • Urban, E.K., C.H. Fry & S. Keith (1986). The Birds of Africa, Volume II. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

SubSpecies Varieties Races

"Three subspecies are recognized: • arquata (Linnaeus, 1758) - nominate subspecies. Breeds in Europe - British Isles and France across W Europe (N to Arctic Circle) and E to R Volga and Urals. Winters from Iceland and British Isles to Mediterranean and NW Africa, and E to Persian Gulf and W India. • orientalis C. L. Brehm, 1831 - Breeds in Russia, northern Kazakhstan and western China. Winters in W, E & S Africa, and from S Caspian Sea to Persian Gulf and E through S Asia to E China and S Japan, and S to Philippines and Greater Sundas. • suschkini Breeds in the southern Urals and Kazakhstan and migrates to eastern and southern Africa (Bamford et al 2008; Cramp & Simmons 1983; van Gils & Wiersma 1996)."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic

"The largest wader in its range, this bird is about 50-57cm in length, 410–1360g in wieght, and, has a 1m wingspan. It is darkish brown in colour and streaked with brown on buff in the head, neck and breast; white on the belly and rump (conspicuous in flight); and brown on flanks. Its most characteristic feature is a long, down-curved slender bill of about 12-15cm (5-6 inches). Birds of this species tend to occur in flocks, but vagrants are more likely to occur singly. The outer primaries of the bird are contrastingly dark. The flight of the bird is slow and gull-like. Sexes look alike, but the beak of the adult females of the species are slightly longer than that of males. In breeding plumage, the head, neck and upper mantle are pale buff-brown with dark streaks on the head and neck, and dark blotches and diffuse bars on the mantle. The lower back and rump are white, while the tail is barred pale brown and black-brown. The upperwings are pale buff-brown with dark blotches, and the flight feathers are very dark, almost black. The face is pale buff-brown with dark streaking, with an ill-defined supercilium, and a pale chin and upper throat. The upper breast is whitish with dark streaks, grading to heavier streaking on the lower breast, forming a bib, and streaking continues onto the belly, vent and undertail coverts. The underwing is white, variably streaked and spotted. The eyes are brown, the bill is dark horn with a pinkish or reddish base, and the legs and feet are blue-grey to olive-grey . In non-breeding plumage, birds look similar, but are duller and drabber in colour. They lose the buff tone, and the underparts below the chest become whiter, making the bib on the breast more obvious. Juveniles can only be identified after close inspection as they look a lot like the adults. In general, juveniles have slightly shorter beaks, have paler buff tones, finer streaking on the underparts, and whiter belly and vent. The only similar species over most of the Curlew's range is the Whimbrel (N. phaeopus), which is smaller in size, has a shorter beak with a kink rather than a smooth curve, a dark crown side and an eye stripe. Other species which are similar include N.tahitiensis, N.americanus and N.madagascariensis. However, all of these have dark rumps and underwings. Flying birds may resemble a Bar-tailed Godwit (Limosa lapponica) in winter plumage, but in contrast to that species which is smaller, has a slightly upturned bill, and feet that are barely longer than the tail tip; in the Eurasian Curlew the feet are longer, forming a conspicuous """"point""""."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic

"Upperparts: Buff and brown; rump white 'V' pointing towards head. Head: Buff and brown; crown no stripes. Underparts: Buff and brown spotted barring; throat buff and brown streaks; belly white. Wings: Buff and brown. Tail: Short and square; Upper and under: buff and brown Legs: Long; dark green in males and juveniles. Bill: Male - Very long and thin, decurved (downwards curve); black. Female bill usually much longer. Eyes: Male - Black."
  • Numenius arquata - Eurasian curlew. Wildlife Information Network and and Wildpro. Accessed on: 30th August, 2011.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

"N. phaeopus , N.tahitiensis , N.americanus and N.madagascariensis. Flying birds may resemble a Bar-tailed Godwit (Limosa lapponica) in winter plumage. For distinguishing features, refer section on Diagnostic Description."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Most populations of this species are fully migratory (del Hoyo et al. 1996) and breed from April to August (Hayman et al. 1986) in solitary territorial pairs (Johnsgard 1981), occasionally also forming small colonies (Flint et al. 1984). After breeding adults gather on coasts (from July onwards) (Hayman et al. 1986) for the post-breeding moult (Snow and Perrins 1998) before migrating south to the wintering grounds between July and November (del Hoyo et al. 1996). The species departs its wintering grounds again from February through to May, although non-breeders may remain in the wintering areas all-year-round (del Hoyo et al. 1996). During the winter the species usually forages singly or in small groups (del Hoyo et al. 1996) occasionally aggregating into flocks of several thousand individuals, especially at roosting sites (Snow and Perrins 1998). Habitat Breeding The species breeds on upland moors, peat bogs, swampy and dry heathlands, fens, open grassy or boggy areas in forests, damp grasslands, meadows (del Hoyo et al. 1996), non-intensive farmland in river valleys (Hayman et al. 1986), dune valleys and coastal marshlands (del Hoyo et al. 1996) Non-breeding During the winter the species frequents muddy coasts, bays and estuaries (del Hoyo et al. 1996) with tidal mudflats and sandflats (Snow and Perrins 1998), rocky and sandy beaches with many pools (Johnsgard 1981;Snow and Perrins 1998), mangroves, saltmarshes (Snow and Perrins 1998), coastal meadows (Johnsgard 1981) and muddy shores of coastal lagoons (Johnsgard 1981), inland lakes and rivers (del Hoyo et al. 1996). It also utilises wet grassland and arable fields during migration (del Hoyo et al. 1996). Diet Its diet consists chiefly of annelid worms and terrestrial insects (del Hoyo et al. 1996) (e.g. Coleoptera and Orthoptera) (Johnsgard 1981) especially during the summer (del Hoyo et al. 1996), although it will also take crustaceans, molluscs, polychaete worms (del Hoyo et al. 1996), spiders (Johnsgard 1981), berries and seeds, as well as occasionally small fish, amphibians, lizards, young birds and small rodents (del Hoyo et al. 1996). Breeding site The nest is a shallow depression on the ground or on a mound (Flint et al. 1984) in the open or in the cover of grass or sedge (del Hoyo et al. 1996) often far from water (Johnsgard 1981). Management information A study into the effects of shellfish harvesting by hand in coastal intertidal habitats recommends that the harvesting load should be limited to -1 during this species's autumn migration (Navedo and Masero 2007).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"Includes the following: fresh and saltwater marshes; rocky beaches with tidal pools; mudflats, estuaries and sandy shores; and, heath, moorland and fields near water. In general, during the breeding season, birds are found on upland moors, peat bogs, swampy and dry heathlands, fens, open grassy or boggy areas in forests, damp grasslands, meadows, non-intensive farmland in river valleys, dune valleys and coastal marshlands. Whereas in non-breeding seasons, species frequents muddy coasts, bays and estuaries with tidal mudflats and sandflats, rocky and sandy beaches with many pools, mangroves, saltmarshes, coastal meadows and muddy shores of coastal lagoons, inland lakes and rivers. Being a palearctic migrant, a few birds may over-summer. "
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 68 specimens in 2 taxa.
Water temperature and chemistry ranges based on 49 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.533 - 12.348
  Nitrate (umol/L): 1.402 - 8.636
  Salinity (PPS): 33.777 - 35.363
  Oxygen (ml/l): 6.138 - 6.665
  Phosphate (umol/l): 0.321 - 0.630
  Silicate (umol/l): 0.987 - 4.938

Graphical representation

Temperature range (°C): 9.533 - 12.348

Nitrate (umol/L): 1.402 - 8.636

Salinity (PPS): 33.777 - 35.363

Oxygen (ml/l): 6.138 - 6.665

Phosphate (umol/l): 0.321 - 0.630

Silicate (umol/l): 0.987 - 4.938
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

"A migratory species over most of its range, it is found wintering in Africa, southern Europe and southAsia. Occasionally, a vagrant individual reaches places far away from its normal range, such as in Nova Scotia or the Marianas. Usually found all year round in the milder climates of Ireland, Great Britain and the adjacent European coasts. In India, it is chiefly a winter vistor. This is especially true for the race orientalis which is identified by its finely streaked underparts."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

"Diet: * In the non-breeding season, birds mainly eat small invertebrates including polychaete worms, molluscs, crustaceans (crabs), shrimps and amphipods; as well as earthworms, insects and spiders, small fish, amphibians, lizards, eggs and chicks , and small mammals like rodents. Studies suggest that in some parts of the world, like in Norway, earthworms may be the most important component of the diet of Eurasian curlews in the pre-breeding season. Occasionally, they also feed on berries and seeds of marsh plants, grass shoots, seaweed and other vegetable matter. * On breeding grounds, they mainly eat insects and their larvae (e.g. Coleoptera and Orthoptera), especially grasshoppers and beetles, but also ants, craneflies, earwigs, flies and moths. They also eat annelid worms like earthworms, and occasionally freshwater crustaceans, amphibians, lizards, chicks and small mammals, and also occasionally fruits and other plant material. Foraging: Usually, the Eurasian Curlews feed by probing the wet sand on the banks of a water body or the shores of the sea at low tide or off the surface with their beaks. In general, they use the following 3 methods to forage: (a)pecking the surface of the substrate (b)quickly jabbing the bill into the substrate, inserting half of the length of the bill (c)more prolonged probing, where the bill is fully inserted into the substrate. Crabs are usually located by the birds by sight. Since curkews show sexual dimorphism in the shape of their bills, with males having shorter bills than females, both sexes show slightly different methods of foraging. Males tend to catch more invertebrates from the surface of the soil, while females tend to catch more earthworms taken from beneath the soil."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

"Predators: Foxes (Vulpes vulpes ) , Hooded Crows (Corvus corone) and Lesser Black-backed Gulls (Larus fuscus) feed on eggs, chicks and birds. Prey: Insects and their larvae(e.g. Coleoptera and Orthoptera), especially grasshoppers and beetles, but also ants, craneflies, earwigs, flies and moths. Small invertebrates including polychaete worms, molluscs, crustaceans (crabs), shrimps and amphipods. Spiders, small fish, amphibians, lizards, eggs and chicks, and small mammals like rodents."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Numenius arquatus (Numenius arquatus curlew) preys on:
Crangon crangon
Nereis diversicolor
Ostracoda
Hydrobia ulvae
Littorina littorea

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Numenius arquatus (Numenius arquatus curlew) is prey of:
Levinseniella
Spelotrema clariforma

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Diseases

"In a survey of H5N1 Avian flu virus in wild birds in 14 provinces of China from 2004-2007, samples of the virus were collected from Numenius arquata where the prevalence of infection was estimated to be 0.40%."
  • Zheng Kou, Yongdong Li, Zuohua Yin, Shan Guo, Mingli Wang, Xuebin Gao, Peng Li, Lijun Tang, Ping Jiang, Ze Luo, Zhi Xin, Changqing Ding, Yubang He, Zuyi Ren, Peng Cui, Hongfeng Zhao, Zhong Zhang, Shuang Tang, Baoping Yan, Fumin Lei, Tianxian Li. ""The Survey of H5N1 Flu Virus in Wild Birds in 14 Provinces of China from 2004 to 2007."" PLoS One. 2009; 4(9): e69Published online 2009 September 9. doi: 10.1371/journal.pone.0006926
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

"This species has a large range, with its estimated global extent of occurrence being about 10, 000, 000 km2; and large global population of about 770,000 - 1,065,000 mature individuals. This number is now believed to be decreasing, especially in Europe."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

"Most populations of the bird are fully migratory. In their winter grounds, they forage singly or in small groups, occassionally aggregating into flocks of several thousand individuals, especially at their roosting sites. Birds leave their wintering grounds around February to May, although non-breeders may remain in wintering grounds all year round. In the summer, usually between April to August, birds breed in solitary territorial pairs, occassionally forming small colonies. By July, birds gather on coast for post-breeding moult before they migrate south anytime between July - November."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"Call: The familiar call from which this bird gets its name is a shrill, wild and plaintive scream of curloo or cur-lew, which is uttered chiefly on the wing. Though very gregarious outside the breading season, this bird is usually exceedingly wary and difficult to circumvent."
  • Ali, Salim. 'The book of Indian Birds'. Bombay Natural History Society, 2002. 13: Plate 24, pg 136.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Birds live on average for 32 years and first start breeding when two years old.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

"Lives for a maximum of about 31 years in the wild. The Eurasian Curlew first breeds when two years old, and the oldest known bird of this species lived for 32 years."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 31.5 years (wild) Observations: The oldest animal captured was over 31 years old and was in good health (John Terres 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

"Nesting season: Eurasian Curlews lay their eggs between April and early July. Nests: Either a bare scrape or a large depression in the ground, lined with dry grass and a few feathers, and, often situated on a tussock or low hummock, among grass or crops, or completely exposed in a meadow or similar habitat. Sexual Behaviour: Birds show monogamous pair-bond, which is probably re-established annually. Both birds, but mainly the males, show territorial defence of nest site. Clutch sizes: Vary between 2-6 in number. Optimal size is usually four eggs. Egg description: Smooth and fairly glossy in appearance, the eggs are broad oval in shape, about 68mm long, greenish to olive-brown in colour, with dark spots or splotches of olive, reddish-brown or grey. Incubation: Eggs are incubated for 27–29 days. Hatching: Synchronous. Parental behaviour: Several nests are bulilt by the male bird. The female only chooses one. Eggs are incubated by both sexes. Fledgelings are fed by both parents. Fledgling: Chicks are precocial and fledge after 32-38 days or 5-6 weeks. Juveiles: Are independent. Survival rate: Due to their ground-nesting habit and the precocial nature of the chicks, Eurasian Curlews show high mortality rates. On average, about 66% of the birds die in the first year of their birth. The mortality rate reduces to 18% in the third year. This is mainly because they are vulnerable to predators like Foxes (Vulpes vulpes ) , Hooded Crows (Corvus corone) and Lesser Black-backed Gulls (Larus fuscus)."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

The postnatal growth rate of this species is 0.13 days-1 (from logistic function).
  • ""AnAge entry for Numenius arquata"". de Magalhaes, J. P., and Costa, J. (2009) ""A database of vertebrate longevity records and their relation to other life-history traits."" Journal of Evolutionary Biology 22(8):1770-1774.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

"Eurasian Curlews are widely studied by evolutionary biologists in an attempt to understand the evolution of maternal desertion of young ones. This behaviour is frequantly seen in monogamous single-clutch shorebird species, of which Eursian Curlews are good examples. It has been observed that both males and females of this species contribute equally to incubation. Also for a short period after the eggs hatch, both sexes show no difference in intensity in their mobbing behviour to protect their nests against potential nest predators. However, approximately halfway through the brooding period (16 days after hatching of eggs), females of the species have been frequently found to desert their offspring, while the males remain to rear the chicks to independence. Also, females that lay eggs later in the breeding season tend to leave their chicks sooner than those females that lay their eggs earlier in the breeding season. Thus, curlew females in North-Eastern Europe, where laying seasons were later, breeding seasons were shorter and migratory distances were longer than those females who were in Western and Central Europe, tend to desert their chicks much earlier than the others. Some studies have suggested that this behviour may have evolved as a result of the association of maternal desertion with increased female survival rates and the maintenance of pair-bonds between mating individuals between years. Eurasian Curlews, along with other wading birds of the order Charadiformes, are also cited in evolutionary biology as an example of Adapative Radiation. """"Essential Ornithology"""" by Graham Scott has one such description. He mentions how as many as a dozen species of birds of the Order Charadiformes can be seen feeding along the same area of a shore, but showing a wide range of bill morphologies, ranging from the tiny, straight bill of the Ringed Plover Charadrius dubius that is used to delicately isopods from the strand line, to the long decurved bill of the Eurasian Curlew Numenius arquata that is used to probe deeply into wet sand to drag out large polychaetes, to the heavy, hammering bill of the Eurasian Flycatcher Haematopus ostralegus that is ideal for smashing open the shells of bivavle molluscs. Scott hypothesises that this diversity of bill shapes and sizes allows the birds to co-exist without competing too closely for food - each bird species occupies it's own unique feeding niche. He suggests that this diversity in bill morphology may be an example of one visible outcome of a process of adaptive radiation. It is likely that at one time, the Charadiform bill was more or less uniform, but through evolutionary time and in parallel with the evolution of all of the various wader species, it evolved into many different forms as a result of natural selection."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

A list of nucleotide sequences from the Eurasian Curlew can be viewed at: http://www.ncbi.nlm.nih.gov/nuccore?term=Eurasian%20Curlew A list of protein sequences from the species can be viewed at: http://www.ncbi.nlm.nih.gov/protein?term=Eurasian%20Curlew
  • National Centre for Biological Information (NCBI)
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology

Statistics of barcoding coverage: Numenius arquata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Numenius arquata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTTTACCTAATCTTTGGAGCATGAGCGGGCATGGTCGGAACCGCCCTCAGCCTACTCATCCGCGCCGAACTAGGTCAACCAGGGACCCTTCTGGGAGACGACCAAATCTACAACGTAATCGTCACCGCCCATGCCTTCGTGATAATCTTCTTCATAGTAATGCCAATCATAATTGGTGGCTTCGGAAATTGACTAGTTCCACTGATAATCGGTGCTCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTTCTCCCCCCATCATTCCTTCTCCTACTAGCCTCATCCACAGTTGAAGCCGGGGCCGGCACAGGATGAACCGTATACCCGCCCCTCGCCGGCAACCTAGCTCATGCTGGAGCCTCAGTAGACTTAGCCATTTTTTCCCTACACTTAGCAGGTGTCTCCTCCATCCTAGGAGCCATCAACTTCATCACAACCGCCATCAACATAAAACCTCCAGCTCTTTCTCAATACCAAACCCCCTTATTCGTATGATCAGTGCTCATCACCGCTGTCCTACTCCTTCTATCCCTCCCAGTCCTTGCCGCAGGCATTACAATACTACTGACAGACCGAAACCTAAACACTACATTTTTCGACCCTGCCGGAGGAGGTGACCCAGTTTTATATCAACACCTCTTCTGATTCTTTGGCCACCCAGAAGTCTATATCCTAATCCTGCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Symes, A. & Butchart, S.

Contributor/s
Barter, M., Fefelov, I., Boschert, M., Copland, A., Kamp, J., Sklyarenko, S., van Dijk, A., Bragin, E., Mischenko, A., Raudonikis, L., Flensted, K. & Chan, S.

Justification
This widespread species remains common in many parts of its range, and determining population trends is problematic. Nevertheless, declines have been recorded in several key populations and overall a moderately rapid global decline is estimated. As a result, the species has been uplisted to Near Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Red List Category & Criteria: Near Threatened Year Assessed: 2008 Assessor/s: BirdLife International Reviewer/s: Bird, J. & Butchart, S. (BirdLife International Red List Authority)"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.77,000-1,065,000 individuals (Wetlands International 2006 and Barter in litt. 2007), while national population estimates include: < c.10,000 individuals on migration and >c.10,000 wintering individuals in China; c.1,000-10,000 individuals on migration and c.50-1,000 wintering individuals in Taiwan; c.1,000-10,000 individuals on migration and c.1,000-10,000 wintering individuals in Korea; c.1,000-10,000 individuals on migration and c.50-1,000 wintering individuals ? in Japan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"According to BirdLife International, there was an estimated three-generation decline of 26.1-34.1% of the species in 2007. However, because there is a certain degree of uncertainity regarding whether decline in southern populations of the species have been compensated for by increases in northern populations, the global trend of Eurasian curlews is suspected to fall within the band of a 20-30% decrease in the past 15 years (three generations)."
  • BirdLife International (2011) Species factsheet: Numenius arquata. Downloaded from http://www.birdlife.org on 30/08/2011. 
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Breeding The species is threatened by the loss and fragmentation of moorland habitats as a result of afforestation (del Hoyo et al. 1996; Johnsgard 1981) and of marginal grassland habitats as a result of agricultural intensification and improvement (del Hoyo et al. 1996; Johnsgard 1981;Baines 1988) (e.g. drainage, inorganic fertilisation and reseeding) (Baines 1988). The species also suffers from high egg and chick mortalities (due to mechanical mowing) and higher predation rates if nesting on improved grasslands (del Hoyo et al. 1996). Conversely populations in the central Asians steppes have declined following abandonment of farmland and subsequent increases in the height of vegetation, rendering large areas unsuitable for nesting. It has also suffered population declines as a result of hunting (Johnsgard 1981), and is susceptible to avian influenza so may be threatened by future outbreaks of the virus (Melville and Shortridge 2006). Non-breeding Wintering populations are threatened by disturbance on intertidal mudflats (del Hoyo et al. 1996; Burton et al. 2002a, 2002b) (e.g. from construction work (Burton et al. 2002a) and foot-traffic (Burton et al. 2002b)), development on high-tide roosting sites, pollution (del Hoyo et al. 1996) and the flooding of estuarine mudflats and saltmarshes as a result of tidal barrage construction (Burton 2006). The species is also threatened by the degradation of migrational staging areas owing to land reclamation, pollution, human disturbance and reduced river flows (Kelin and Qiang 2006). Local populations of this species have also declined owing to hunting pressures (del Hoyo et al. 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Breeding: On the breeding grounds, especially in Europe, Eurasian Curlews are adversely affected by loss, fragmentation or modification of their breeding habitats as a result of afforestation or agricultural intensification and improvement (e.g. drainage, inorganic fertilisation and reseeding). This includes the drainage of wet grasslands, moors and peat bogs, conversion of such habitats to farmland or forested areas, intensive management of habitats for game or intensive grazing. In addition, they have also been threatened by technology. Mechanized cutting of peat, and mowing of grassy areas causes high mortality of chicks and eggs. In contrast, in the Central Asian Steppes, populations have declined following abandonment of farmland and subsequent increases in the height of vegetation, rendering large areas unsuitable for nesting. Hunting and the susceptibility of the species to avian influenza virus are two other threats to the survival of the bird. Non-breeding: Wintering populations are threatened by disturbance on intertidal mudflats (e.g. from construction work and foot-traffic), development on high-tide roosting sites, pollution and the flooding of estuarine mudflats and saltmarshes as a result of tidal barrage construction. Also threatened by the degradation of migrational staging areas owing to land reclamation, pollution, human disturbance and reduced river flows. Local populations of this species have also declined owing to hunting pressures. Others: Many threats that affect all migratory waders occur in the East Asian-Australasian Flyway. These include: 1. Direct and indirect habitat loss. Staging areas used during migration through eastern Asia are being lost and degraded by reclaiming of mudflats for future development, or, by the rapid rate of reclamation of many inter-tidal areas along the East Asian-Australasian Flyway. 2. Infastructures for regulation and diversion of water bodies in the major tributaries. These reduced water and sediment flows. 3. Global warming and associated changes in sea-level. These are predicted to have long-term impacts on the breeding, staging and non-breeding grounds of migratory waders. 4. Increasing pollution, and disturbance from human activities - including recreation, shellfish harvesting, fishing and aquaculture."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Legislation

Protection Legal Status

"Eurasian curlews occur in a large number of protected areas throughout its range and feature in several national monitoring schemes. The European Commission has commissioned a management plan for species that are listed in Annex II/2 of the EU Birds Directive. This plan has been updated for 2007-2009, and outlines the following key conservation targets: 1. Protect key wintering sites. 2. Determine the key perameters driving declines in breeding areas and integrate agri-environment measures to counter these. 3. Continue monitoring trends. 4. Minimise disturbance on the wintering grounds."
  • BirdLife International (2011) Species factsheet: Numenius arquata. Downloaded from http://www.birdlife.org on 30/08/2011. 
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"International: Listed in the Agreement on the Conservation of African-Eurasian Migratory Waterbirds(AEWA), Appendix II of the International Convention on Migratory Species, Marine and Migratory under the Environment Protection and Biodiversity Conservation Act 1999. (Australia), Migartory Bird Treaty Act, and, in the China-Australia Migratory Bird Agreement (CAMBA)."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
Annex II/2 of the EU Birds Directive. A management plan for the species, updated for 2007-2009, was published in 2007, covering the EU portion of the species's range (Jensen and Lutz 2007). A 5 year moratorium on hunting the species was implemented in France in July 2008 (A. Duncan in litt. 2008). The species occurs in a large number of protected areas throughout its range and features in several national monitoring schemes.

Conservation Actions Proposed
The Management Plan for Curlew outlines key conservation targets: Protect key wintering sites. Determine the key parameters driving declines in breeding areas and integrate agri-environment measures to counter these. Continue monitoring trends. Minimise disturbance on the wintering grounds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Bamford and colleagues (2008) have reviewed sites of international importance for migratory shorebirds across the East Asian-Australasian Flyway to assist in management decisions related to species such as the Eurasian Curlew. This review can be found at: http://www.environment.gov.au/biodiversity/migratory/publications/shorebirds-east-asia.html One study into the effects of shellfish harvesting by hand in coastal intertidal habitats recommends that the harvesting load should be limited to <0.56 persons per 10 ha-1 during the Eurasian Curlew's autumn migration. Another study indicates that disturbance of mud in inter-tidal habitats by harvesters working by hand did not affect mean density of curlews, their foraging activity, feeding rate, percentage of crabs in the diet, size of crabs, or foraging speed. The latter study suggests a compatibility between shorebird conservation and traditional low-tide clam harvesting."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Folklore

"Early scientific descriptions of the Eurasian Curlew: Murray, James A. (London : Trubner, 1888-1890) in his book """"The avifauna of British India and its dependencies."""" describes Eurasian Curlews in the following words - """"Habitat. Throughout most parts of Europe, India, Burmah, Ceylon, N. Africa, Egypt, Abyssinia and Palestine. Common along the sea coast and backwaters in great numbers during winter; also along the banks of the Indus and Punjab rivers, and on all large inland sheets of water."""" Jerdon, T. C. (Thomas Claverhill) in his book """"The birds of India."""" (Calcutta, 1862.Vol 2,2.Pg:684) describes Eurasian Curlews in the following words - """"The Curlew is found throughout India, most abundantly perhaps near the sea coast, but also far inland, frequenting marshes, lakes, and rivers. It is generally seen in small flocks, often alone, but at the times of its arrival or departure sometimes in great numbers. It arrives in September and leaves in March or April. It is a very wary bird, and has a fine wild whistle. It is excellent eating. It breeds in Northern Europe and Asia (spreading in winter into Africa and Southern Asia,) laying four eggs of the usual blotched green colour. The Curlew is stated to perch on trees occasionally in Northern Europe."""" Different usages of the word 'Curlew': The word Curlew is used in many different contexts, listed in Webster's Online Dictionary at: http://www.websters-online-dictionary.org/definitions/Curlew. Poetic usages of the word 'Curlew': The word Curlew has been used by some poets in their verses. Examples of some of these poems can be seen in Webster's Online Dictionary at: http://www.totopoetry.com/PoetryForWebstersOnlineCombined.asp?word=Curlew&ip=115.241.92.42#1"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eurasian curlew

The Eurasian curlew (Numenius arquata) is a wader in the large family Scolopacidae. It is one of the most widespread of the curlews, breeding across temperate Europe and Asia. In Europe, this species is often referred to just as the "curlew", and in Scotland known as the "whaup" in Scots.

Male in flight. Note "pointed tail" formed by the feet.

This is the largest wader in its range, at 50–60 cm (20–24 in) in length, with a 89–106 cm (35–42 in) wingspan and a body weight of 410–1,360 g (0.90–3.00 lb).[2] It is mainly greyish brown, with a white back, and a very long curved bill. Males and females look identical, but the bill is longest in the adult female. It is generally not possible to recognize the sex of a single Eurasian Curlew, or even several ones as there is much variation; telling male and female of a mated pair apart is usually possible however.

The familiar call, from which this bird gets it name, is a loud curloo-oo.

The only similar species over most of the curlew's range is the whimbrel (N. phaeopus). The Whimbrel is smaller and has a shorter bill with a kink rather than a smooth curve. Flying curlews may also resemble, albeit not existing in the same area, bar-tailed godwits (Limosa lapponica) in their winter plumages; however, the latter have a smaller body, a slightly upturned beak, and legs that do not reach far beyond their tail tips. The Eurasian Curlew's feet are longer, forming a conspicuous "point".

The curlew exists as a migratory species over most of its range, wintering in Africa, southern Europe and south Asia. Occasionally a vagrant individual reaches places far from its normal range, such as Nova Scotia[3] and the Marianas.[4] It is present all year in the milder climates of the United Kingdom and its adjacent European coasts.

It is generally wary. Highly gregarious outside the breeding season, the Eurasian curlew feeds by probing soft mud for small invertebrates, but will also pick small crabs and earthworms off the surface if the opportunity arises.

A clutch of Eurasian curlew eggs

The nest is a bare scrape on taiga, meadow, and similar habitats. Each curlew lays between 3 and 6 eggs in April or May and incubates them for about a month until they begin to hatch.

A Eurasian Curlew skull

The curlew is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Formerly classified as a species of Least Concern by the IUCN, it was suspected to be rarer than generally assumed. Following the evaluation of its population size, the classification was found to be incorrect, and it was consequently promoted to Near Threatened status in 2008. Though it is a common bird, its numbers are noticeably declining.[5] In Ireland, for example, the breeding population is estimated to have declined by 86% in the last 30 years.[6]


Footnotes[edit]

  1. ^ BirdLife International (2012). "Numenius arquata". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  3. ^ NHMNS (1998)
  4. ^ Wiles et al. (2000, 2004)
  5. ^ BLI (2008)
  6. ^ Maguire, Stephen "Endangered Curlew- Conservation drive started to save species" Irish Times 28/02/2014

References[edit]

  • Natural History Museum of Nova Scotia (NHMNS) (1998): Birds of Nova Scotia – Eurasian Curlew. Retrieved 2008-MAY-23.
  • Wiles, Gary J.; Worthington, David J.; Beck, Robert E. Jr.; Pratt, H. Douglas; Aguon, Celestino F. & Pyle, Robert L. (2000): Noteworthy Bird Records for Micronesia, with a Summary of Raptor Sightings in the Mariana Islands, 1988–1999. Micronesica 32(2): 257–284. PDF fulltext
  • Wiles, Gary J.; Johnson, Nathan C.; de Cruz, Justine B.; Dutson, Guy; Camacho, Vicente A.; Kepler, Angela Kay; Vice, Daniel S.; Garrett, Kimball L.; Kessler, Curt C. & Pratt, H. Douglas (2004): New and Noteworthy Bird Records for Micronesia, 1986–2003. Micronesica 37(1): 69–96. HTML abstract
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!