Articles on this page are available in 2 other languages: Chinese (Simplified) (4), Dutch (1) (learn more)

Overview

Brief Summary

It's not difficult to recognize a curlew. It has a long beak curved downward. This long beak can be seen from a long distance. And if you can't recognize it by sight, then you just need to use your ears! You can't mistake the sound they make: a kind of yoddling vibration. Once you've heard it, you'll never mistake it.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Eurasian Curlew (Numenius arquata) is a large curlew (male around 660 g, 52 cm length; female 790 g, 55 cm length) that breeds across Eurasia from the United Kingdom to Siberia, but not all the way to the Pacific coast. The wintering range extends from Europe and Japan south throughout Africa and southern Asia. Eurasian Curlews occasionally show up on the Atlantic coast of North America in spring, fall, and winter from Newfoundland to New York, as well as in the Bahamas.

Eurasian Curlews breed on moors and marshlands in the boreal forest zone (taiga), as well as in moist meadows in steppe and pastureland. When not breeding, they are found (usually in flocks) on coastal mudflats and sometimes on muddy shores of lakes and rivers and, in migration, on wet grassland and agricultural fields.

Eurasian Curlews feed by pecking, jabbing, or deep probing with their bills in mud or damp soil. When not breeding, females, which have slightly longer bills than males, tend to forage more on intertidal flats, feeding on mollusks, crabs, and polychaete worms, whereas males tend to feed more on lumbricid earthworms on cultivated grassland.

(van Gils and Wiersma 1996 and references therein; Paulson 2005)

  • Paulson, D. 2005. Shorebirds of North America: The Photographic Guide. Princeton University Press, Princeton.
  • van Gils, J. and P. Wiersma. 1996. Eurasian Curlew (Numenius arquata). Pp. 504-505 in: del Hoyo, J., Elliott, A., and Sargatal, J., eds. Handbook of the Birds of the World. Volume 3. Hoatzin to Auks. Lynx Edicions, Barcelona.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Exclusive Economic Zone, Djibouti, Eritrea, Het Zwin, Kenya, Madagascar, North West Atlantic, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Red Sea, Somalia, South Africa (country), Spanish Exclusive Economic Zone, Tanzania, United Kingdom Exclusive Economic Zone, Wimereux, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

accidental shore bird from Eurasia, reported in Nova Scotia and Newfoundland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Numenius arquata is widely distributed, breeding across Europe from the British Isles, through north-western Europe and Scandinavia into Russia extending east into Siberia, east of Lake Baikal. It winters around the coasts of north-west Europe, the Mediterranean, Africa, the Middle East, the Indian Subcontinent, South-East Asia, Japan and the Sundas. It has a large global population estimated to number 765,000-1,065,000 individuals28,29. The breeding population in Western Europe (220,000-360,000 pairs) has declined in recent years, with a 53% decline in the United Kingdom calculated over the period 1970-2005 from the Common Birds Census and the Breeding Bird Survey, and a 37% decline over the period 1994-2006 derived from the Breeding Bird Survey33,34. A decline of 86% was calculated in Ireland between 1988-1991 and 200318,19and declines have been recorded in Finland2, Germany20, Lithuania (20-30% per decade)21 and the Netherlands (31% since 198422). Unquantified, but potentially highly significant, declines have also been recorded in the central Asian populations of N. a. orientalis23. In Denmark24 and eastern Siberia25 breeding populations are apparently stable and apparent increases in wintering populations in the Wadden Sea26, on the Adriatic coast27, in East Asia28 and in Western Europe suggest that breeding populations, probably in European Russia and northern Siberia have perhaps increased. Overall, analysis of the compiled trend data indicate three generation (15 year) estimate of decline of between 26% and 34%2,19,22,28,29,30,31,32,33,34. Owing to the uncertainty over whether declines in southern populations have been compensated by increases in northern populations, the global trend is suspected to fall within the band 20-30% declines in the past 15 years or three generations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Length: 53-59 cm. Plumage: above, head neck and breast streaked brown on buff; belly and rump white; flanks with brown streaking. Immature like adult. Bare parts: iris brown; bill brown with pinkish base, extremely long (three times length of head) and strongly decurved; immature with shorter bill; feet and legs greenish-, pinkish- or bluish-grey. Habitat: coastal mudflats, seashores, estuaries and inland waters. Palearctic migrant, a few may oversummer. <389><391><393>
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Most populations of this species are fully migratory6 and breed from April to August7 in solitary territorial pairs8, occasionally also forming small colonies9. After breeding adults gather on coasts (from July onwards)7 for the post-breeding moult10 before migrating south to the wintering grounds between July and November6. The species departs its wintering grounds again from February through to May, although non-breeders may remain in the wintering areas all-year-round6. During the winter the species usually forages singly or in small groups6 occasionally aggregating into flocks of several thousand individuals, especially at roosting sites10. Habitat Breeding The species breeds on upland moors, peat bogs, swampy and dry heathlands, fens, open grassy or boggy areas in forests, damp grasslands, meadows6, non-intensive farmland in river valleys7, dune valleys and coastal marshlands6. Non-breeding During the winter the species frequents muddy coasts, bays and estuaries6 with tidal mudflats and sandflats10, rocky and sandy beaches with many pools8, 10, mangroves, saltmarshes10, coastal meadows8 and muddy shores of coastal lagoons8, inland lakes and rivers6. It also utilises wet grassland and arable fields during migration6. Diet Its diet consists chiefly of annelid worms and terrestrial insects6 (e.g. Coleoptera and Orthoptera)8 especially during the summer6, although it will also take crustaceans, molluscs, polychaete worms6, spiders8, berries and seeds, as well as occasionally small fish, amphibians, lizards, young birds and small rodents6. Breeding site The nest is a shallow depression on the ground or on a mound9 in the open or in the cover of grass or sedge6 often far from water8. Management information A study into the effects of shellfish harvesting by hand in coastal intertidal habitats recommends that the harvesting load should be limited to <0.56 persons per 10 ha-1 during this species's autumn migration17.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 68 specimens in 2 taxa.
Water temperature and chemistry ranges based on 49 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.533 - 12.348
  Nitrate (umol/L): 1.402 - 8.636
  Salinity (PPS): 33.777 - 35.363
  Oxygen (ml/l): 6.138 - 6.665
  Phosphate (umol/l): 0.321 - 0.630
  Silicate (umol/l): 0.987 - 4.938

Graphical representation

Temperature range (°C): 9.533 - 12.348

Nitrate (umol/L): 1.402 - 8.636

Salinity (PPS): 33.777 - 35.363

Oxygen (ml/l): 6.138 - 6.665

Phosphate (umol/l): 0.321 - 0.630

Silicate (umol/l): 0.987 - 4.938
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Numenius arquatus (Numenius arquatus curlew) preys on:
Crangon crangon
Nereis diversicolor
Ostracoda
Hydrobia ulvae
Littorina littorea

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Numenius arquatus (Numenius arquatus curlew) is prey of:
Levinseniella
Spelotrema clariforma

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 31.5 years (wild) Observations: The oldest animal captured was over 31 years old and was in good health (John Terres 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Numenius arquata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTTTACCTAATCTTTGGAGCATGAGCGGGCATGGTCGGAACCGCCCTCAGCCTACTCATCCGCGCCGAACTAGGTCAACCAGGGACCCTTCTGGGAGACGACCAAATCTACAACGTAATCGTCACCGCCCATGCCTTCGTGATAATCTTCTTCATAGTAATGCCAATCATAATTGGTGGCTTCGGAAATTGACTAGTTCCACTGATAATCGGTGCTCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTTCTCCCCCCATCATTCCTTCTCCTACTAGCCTCATCCACAGTTGAAGCCGGGGCCGGCACAGGATGAACCGTATACCCGCCCCTCGCCGGCAACCTAGCTCATGCTGGAGCCTCAGTAGACTTAGCCATTTTTTCCCTACACTTAGCAGGTGTCTCCTCCATCCTAGGAGCCATCAACTTCATCACAACCGCCATCAACATAAAACCTCCAGCTCTTTCTCAATACCAAACCCCCTTATTCGTATGATCAGTGCTCATCACCGCTGTCCTACTCCTTCTATCCCTCCCAGTCCTTGCCGCAGGCATTACAATACTACTGACAGACCGAAACCTAAACACTACATTTTTCGACCCTGCCGGAGGAGGTGACCCAGTTTTATATCAACACCTCTTCTGATTCTTTGGCCACCCAGAAGTCTATATCCTAATCCTGCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Numenius arquata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s
Boschert, M., Kamp, J., Flensted, K., Raudonikis, L., Barter, M., Chan, S., Mischenko, A., Bragin, E., Sklyarenko, S., Copland, A., Fefelov, I., van Dijk, A.

Justification
This widespread species remains common in many parts of its range, and determining population trends is problematic. Nevertheless, declines have been recorded in several key populations and overall a moderately rapid global decline is estimated. As a result, the species has been uplisted to Near Threatened.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Wetlands International (2006); M. Barter in litt. (2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Breeding The species is threatened by the loss and fragmentation of moorland habitats as a result of afforestation6,8 and of marginal grassland habitats as a result of agricultural intensification and improvement6,8,16 (e.g. drainage, inorganic fertilisation and reseeding)16. The species also suffers from high egg and chick mortalities (due to mechanical mowing) and higher predation rates if nesting on improved grasslands6. Conversely populations in the central Asians steppes have declined following abandonment of farmland and subsequent increases in the height of vegetation, rendering large areas unsuitable for nesting. It has also suffered population declines as a result of hunting8, and is susceptible to avian influenza so may be threatened by future outbreaks of the virus12. Non-breeding Wintering populations are threatened by disturbance on intertidal mudflats6,14,15 (e.g. from construction work14 and foot-traffic15), development on high-tide roosting sites, pollution6 and the flooding of estuarine mudflats and saltmarshes as a result of tidal barrage construction13. The species is also threatened by the degradation of migrational staging areas owing to land reclamation, pollution, human disturbance and reduced river flows11. Local populations of this species have also declined owing to hunting pressures6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
Annex II/2 of the EU Birds Directive. The European Commission have commissioned a management plan for the species which has been updated for 2007-2009. The species occurs in a large number of protected areas throughout its range and features in several national monitoring schemes.

Conservation Actions Proposed
The Management Plan for Curlew outlines key conservation targets: Protect key wintering sites. Determine the key perameters driving declines in breeding areas and integrate agri-environment measures to counter these. Continue monitoring trends. Minimise disturbance on the wintering grounds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eurasian Curlew

The Eurasian Curlew (Numenius arquata) is a wader in the large family Scolopacidae. It is one of the most widespread of the curlews, breeding across temperate Europe and Asia. In Europe, this species is often referred to just as the "Curlew", and in Scotland known as the "whaup" in Scots.

Male in flight. Note "pointed tail" formed by the feet.

This is the largest wader in its range, at 50–60 cm (20–24 in) in length, with a 89–106 cm (35–42 in) wingspan and a body weight of 410–1,360 g (0.90–3.0 lb).[2] It is mainly greyish brown, with a white back, and a very long curved bill. Males and females look identical, but the bill is longest in the adult female. It is generally not possible to recognize the sex of a single Eurasian Curlew, or even several ones as there is much variation; telling male and female of a mated pair apart is usually possible however.

The familiar call, from which this bird gets it name, is a loud curloo-oo.

The only similar species over most of the Curlew's range is the Whimbrel (N. phaeopus). The Whimbrel is smaller and has a shorter bill with a kink rather than a smooth curve. Flying Curlews may also resemble, albeit not existing in the same area, Bar-tailed Godwits (Limosa lapponica) in their winter plumages; however, the latter have a smaller body, a slightly upturned beak, and legs that do not reach far beyond their tail tips. The Eurasian Curlew's feet are longer, forming a conspicuous "point".

The Curlew exists as a migratory species over most of its range, wintering in Africa, southern Europe and south Asia. Occasionally a vagrant individual reaches places far from its normal range, such as Nova Scotia[3] and the Marianas.[4] It is present all year in the milder climates of the United Kingdom and its adjacent European coasts.

It is generally wary. Highly gregarious outside the breeding season, the Eurasian Curlew feeds by probing soft mud for small invertebrates, but will also pick small crabs and earthworms off the surface if the opportunity arises.

A clutch of Eurasian Curlew eggs

The nest is a bare scrape on taiga, meadow, and similar habitats. Each Curlew lays between 3 and 6 eggs in April or May and incubates them for about a month until they begin to hatch.

The Curlew is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Formerly classified as a species of Least Concern by the IUCN, it was suspected to be rarer than generally assumed. Following the evaluation of its population size, this was found to be incorrect, and it was consequently promoted to Near Threatened status in 2008. Though it is a common bird, its numbers are noticeably declining.[5] In Ireland, for example, the breeding population is estimated to have declined by 86% in the last 30 years.[citation needed]


Footnotes

  1. ^ BirdLife International (2012). "Numenius arquata". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106003012. Retrieved 16 July 2012.
  2. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  3. ^ NHMNS (1998)
  4. ^ Wiles et al. (2000, 2004)
  5. ^ BLI (2008)

References

  • Natural History Museum of Nova Scotia (NHMNS) (1998): Birds of Nova Scotia – Eurasian Curlew. Retrieved 2008-MAY-23.
  • Wiles, Gary J.; Worthington, David J.; Beck, Robert E. Jr.; Pratt, H. Douglas; Aguon, Celestino F. & Pyle, Robert L. (2000): Noteworthy Bird Records for Micronesia, with a Summary of Raptor Sightings in the Mariana Islands, 1988–1999. Micronesica 32(2): 257–284. PDF fulltext
  • Wiles, Gary J.; Johnson, Nathan C.; de Cruz, Justine B.; Dutson, Guy; Camacho, Vicente A.; Kepler, Angela Kay; Vice, Daniel S.; Garrett, Kimball L.; Kessler, Curt C. & Pratt, H. Douglas (2004): New and Noteworthy Bird Records for Micronesia, 1986–2003. Micronesica 37(1): 69–96. HTML abstract
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!