Overview

Distribution

Range Description

Pedionomus torquatus is endemic to Australia. It is recorded from north-central Victoria, eastern South Australia, southern New South Wales around the Riverina and west-central Queensland (Baker-Gabb 2002; Barrett et al. 2003). The population is estimated to vary from c.2000 birds during periods of widespread drought to c.5500–7000 birds after several successive seasons with favourable conditions (Baker-Gabb 2002). A significant proportion of the population occurs in the Riverina region. Here, the population may be as high as 5,500 birds after good years, but can decline to about 1,000 in poor years (Baker-Gabb 2002). The population in west-central Queensland is estimated at 1000 birds, and the north-central Victorian and South Australia populations may hold 500 birds each during good years (Maher and Baker-Gabb 1993; Baker-Gabb 2002). Surveys in the Riverina reveal an on-going decline, with an encounter rate of 0.13 birds/km in 4,286 km of monitoring during the dry years of 2001–2007, compared to 0.3 birds/km in 2,121 km of monitoring in the wetter years of 1984–1986 (Baker-Gabb 2002; Birds Australia 2008).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Australia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Locally in sparse grasslands of inland se Australia.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It favours sparse grasslands with c.50% bare ground, widely spaced plants up to 0.1 m high and remaining standing vegetation less than 0.05 m in height. It is sedentary for as long as the habitat remains suitable. May occasionally use lower-quality habitat including cereal stubble, but cannot persist in an agricultural landscape (Garnett et al. 2011). Habitat mapping of 2.3 million ha in the Riverina showed that just 2.3% was primary habitat suitable all year round and 4.3% was secondary habitat that may be periodically occupied (Roberts and Roberts 2001). The female lays 3–5 eggs in a shallow, grass-lined scrape (Marchant and Higgins 1993; Baker-Gabb 1998).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Pedionomus torquatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Pedionomus torquatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACCGATGATTATTCTCAACCAACCACAAAGATATCGGCACACTATACCTAATCTTCGGTGCATGGGCCGGTATAGTCGGAACCGCCCTTAGCCTTCTCATTCGCGCAGAACTTGGCCAACCAGGCACCTTGCTCGGAGAC---GACCAAATCTATAACGTAATCGTCACCGCCCACGCTTTCGTAATAATCTTTTTCATGGTAATACCCATCATGATTGGAGGCTTCGGAAACTGACTGGTACCCCTCATAATTGGTGCCCCAGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGACTCCTCCCCCCCTCATTCCTACTCCTCCTTGCCTCCTCCACAGTAGAAGCCGGAGCCGGGACCGGATGAACCGTGTATCCCCCCCTCGCAGGCAACCTAGCACATGCTGGCCCTTCAGTAGACTTAGCAATCTTTTCCCTACATTTAGCAGGTGTTTCCTCAATCTTAGGCGCCATCAACTTCATCACAACCGCCATCAACATAAAACCGCCAGCCCTATCTCAATACCAAACCCCTTTATTTGTATGATCAGTCCTCATCACCGCCGTCCTACTATTACTCTCCCTCCCAGTTCTAGCTGCCGGCATCACTATACTCCTGACAGATCGAAATCTAAACACTACATTTTTCGACCCTGCTGGAGGAGGTGACCCTGTCCTATACCAGCACCTATTCTGATTTTTCGGCCACCCAGAAGTCTACATTTTAATTTTACCAGGCTTCGGAATTATCTCACACATCGTAGCTTATTATGCCGGCAAAAAAGAGCCCTTCGGCTATATAGGTATAGTATGAGCCATACTATCAATCGGATTCCTCGGCTTCATCGTCTGAGCCCACCACATATTCACGGTAGGAATAGACGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C2a(ii)

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Taylor, J. & Butchart, S.

Contributor/s

Justification
This species is listed as Endangered because it has a very small population which is experiencing an ongoing decline owing to cultivation and overgrazing of natural grassland.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/04/1973
Lead Region: Foreign (Region 10) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Pedionomus torquatus, see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population is estimated to vary from between 5,500–7,000 in good years to around 2,000 birds during periods of widespread drought (Baker-Gabb 2002, Garnett et al. 2011). It is placed in the band 1,000-2,499 mature individuals.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The cultivation of native grassland has virtually extinguished the species from southern South Australia and Victoria and is increasing across the Riverina. Even if left to recover, habitat remains unsuitable for decades. Where patches survive, they are often too few and dispersed to be suitable. High levels of grazing cause the desertion of an area, possibly because birds become too vulnerable to predators. Pesticides for locust control may kill birds, directly or indirectly through the food chain. Foxes may be significant predators near crops.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
Management actions completed or underway include extensive surveys in New South Wales, Victoria and south-east South Australia, detailed research on habitat requirements, recovery planning in New South Wales and Victoria, and incorporation of habitat in the protected-areas estate in New South Wales, Queensland and Victoria. Locust control spraying is now regulated in the species's habitat.

Conservation Actions Proposed
Refine population estimates in Queensland and northern South Australia. Monitor populations and habitat condition, and provide feedback to land-holders. Survey for suitable habitat in New South Wales and Queensland and identify areas of high conservation value for the species. Determine the effects of locust control. Purchase a reserve in the Riverina of over 200 km2. Negotiate refuge areas, ensuring Plains-wanderer habitat is not cultivated, has a 2 km buffer from cultivated land wherever possible, is not overgrazed during drought and is integrated into a regional conservation plan (Garnett et al. 2011). Continue to advocate the use of Green Guard® biological control agent for locust control in Plains-wanderer habitat (NSW National Parks and Wildlife Service 2002). Establish a recovery team.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Plains-wanderer

The plains-wanderer (Pedionomus torquatus) or plains wanderer, is a bird, the only representative of its family. It is endemic to Australia. The majority of the remaining population are found in the Riverina region of New South Wales.

Description[edit]

The plains-wanderer is a quail-like ground bird, measuring 15–19 cm. The adult male is light brown above, with fawn-white underparts with black crescents. The adult female has a distinctive white-spotted black collar. They are poor flyers, preferring to run when startled. Females lay four eggs, which the male then incubates.[2]

Taxonomy[edit]

It was formerly believed to be related to the buttonquails and thus placed in the gamebird order Galliformes or with the cranes and rails in Gruiformes. DNA-DNA hybridization and RAG-1 sequence data places it as a wader related to the jacanas (Sibley & Ahlquist 1990, Paton et al. 2003, Thomas et al. 2004, van Tuinen et al. 2004). It thus represents a remarkable case of morphological convergence, or perhaps it is simply extremely plesiomorphic in morphology (the buttonquails, meanwhile, having turned out to be a very basal offshoot of the wader radiation). In the latter case, this would mean that the jacanas, painted snipe and seedsnipes – all ecologically very different birds – all evolved from birds very similar to the living plains-wanderer.

Status and conservation[edit]

Population decline has been caused by the conversion of native grasslands to cultivation. Sites identified by BirdLife International as being important for plains-wanderer conservation are Boolcoomatta, Bindarrah and Kalkaroo Stations in north-eastern South Australia, Diamantina and Astrebla Grasslands in western Queensland, Patho Plains in northern Victoria and the Riverina Plains in New South Wales.[3]

International[edit]

This bird is listed as an endangered species on the 2007 IUCN Red List.

Australia[edit]

Plains-wanderers are listed as vulnerable on the Australian Environment Protection and Biodiversity Conservation Act 1999 (EPBC). Their conservation status also varies from state to state within Australia. For example:

  • The plains-wanderer is listed as threatened on the Victorian Flora and Fauna Guarantee Act (1988).[4] Under this Act, an Action Statement for the recovery and future management of this species has been prepared.[5]
  • The plains-wanderer is listed as endangered on Schedule 1 of the 'Threatened Species Conservation Act (1995).

The plains-wanderer is likely to change status to nationally endangered under the EPBC Act 1999.

References[edit]

  1. ^ BirdLife International (2012). "Pedionomus torquatus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Archibald, George W. (1991). Forshaw, Joseph, ed. Encyclopaedia of Animals: Birds. London: Merehurst Press. p. 101. ISBN 1-85391-186-0. 
  3. ^ "Plains-wanderer". Important Bird Areas. BirdLife International. 2012. Retrieved 2012-11-04. 
  4. ^ Department of Sustainability and Environment - information on status
  5. ^ Department of Sustainability and Environment - Action Statement
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!