Overview

Distribution

Range Description

Pedionomus torquatus is endemic to Australia. It is recorded from north-central Victoria, eastern South Australia, southern New South Wales around the Riverina and west-central Queensland (Baker-Gabb 2002; Barrett et al. 2003). The population is estimated to vary from c.2000 birds during periods of widespread drought to c.55007000 birds after several successive seasons with favourable conditions (Baker-Gabb 2002). A significant proportion of the population occurs in the Riverina region. Here, the population may be as high as 5,500 birds after good years, but can decline to about 1,000 in poor years (Baker-Gabb 2002). The population in west-central Queensland is estimated at 1000 birds, and the north-central Victorian and South Australia populations may hold 500 birds each during good years (Maher and Baker-Gabb 1993; Baker-Gabb 2002). Surveys in the Riverina reveal an on-going decline, with an encounter rate of 0.13 birds/km in 4,286 km of monitoring during the dry years of 20012007, compared to 0.3 birds/km in 2,121 km of monitoring in the wetter years of 19841986 (Baker-Gabb 2002; Birds Australia 2008).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Australia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Locally in sparse grasslands of inland se Australia.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It favours sparse grasslands with c.50% bare ground, widely spaced plants up to 0.1 m high and remaining standing vegetation less than 0.05 m in height. It is sedentary for as long as the habitat remains suitable. May occasionally use lower-quality habitat including cereal stubble, but cannot persist in an agricultural landscape (Garnett et al. 2011). Habitat mapping of 2.3 million ha in the Riverina showed that just 2.3% was primary habitat suitable all year round and 4.3% was secondary habitat that may be periodically occupied (Roberts and Roberts 2001). The female lays 35 eggs in a shallow, grass-lined scrape (Marchant and Higgins 1993; Baker-Gabb 1998).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pedionomus torquatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACCGATGATTATTCTCAACCAACCACAAAGATATCGGCACACTATACCTAATCTTCGGTGCATGGGCCGGTATAGTCGGAACCGCCCTTAGCCTTCTCATTCGCGCAGAACTTGGCCAACCAGGCACCTTGCTCGGAGAC---GACCAAATCTATAACGTAATCGTCACCGCCCACGCTTTCGTAATAATCTTTTTCATGGTAATACCCATCATGATTGGAGGCTTCGGAAACTGACTGGTACCCCTCATAATTGGTGCCCCAGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGACTCCTCCCCCCCTCATTCCTACTCCTCCTTGCCTCCTCCACAGTAGAAGCCGGAGCCGGGACCGGATGAACCGTGTATCCCCCCCTCGCAGGCAACCTAGCACATGCTGGCCCTTCAGTAGACTTAGCAATCTTTTCCCTACATTTAGCAGGTGTTTCCTCAATCTTAGGCGCCATCAACTTCATCACAACCGCCATCAACATAAAACCGCCAGCCCTATCTCAATACCAAACCCCTTTATTTGTATGATCAGTCCTCATCACCGCCGTCCTACTATTACTCTCCCTCCCAGTTCTAGCTGCCGGCATCACTATACTCCTGACAGATCGAAATCTAAACACTACATTTTTCGACCCTGCTGGAGGAGGTGACCCTGTCCTATACCAGCACCTATTCTGATTTTTCGGCCACCCAGAAGTCTACATTTTAATTTTACCAGGCTTCGGAATTATCTCACACATCGTAGCTTATTATGCCGGCAAAAAAGAGCCCTTCGGCTATATAGGTATAGTATGAGCCATACTATCAATCGGATTCCTCGGCTTCATCGTCTGAGCCCACCACATATTCACGGTAGGAATAGACGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pedionomus torquatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C2a(ii)

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Taylor, J. & Butchart, S.

Contributor/s

Justification
This species is listed as Endangered because it has a very small population which is experiencing an ongoing decline owing to cultivation and overgrazing of natural grassland.


History
  • Endangered (EN)
  • Endangered (EN)
  • Endangered (EN)
  • Endangered (EN)
  • Endangered (EN)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Threatened (T)