Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Non-breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) BREEDS: locally along western and southern Alaska coast (see map in Handel and Gill 1992); 85% (61,000-99,000 birds) nest on the central Yukon-Kuskokwim Delta; about 15,000 others nest elsewhere (Handel and Gill 1992); nonbreeding birds may be found in summer in wintering range. WINTERS: south-coastal and southeastern Alaska south along Pacific coast to southern Baja California and central Sonora, Mexico (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeds coastal Alaska; winters se Alaska to nw Mexico.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 24 cm

Weight: 134 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Nonbreeding: rocky seacoasts and offshore islets, less frequently in seaweed on sandy beaches and tidal mudflats (AOU 1983). Nests mainly in salt-grass tundra; breeds along the coast or on offshore islands. Most of the breeding population is concentrated in a narrow band of salt grass, graminoid, and dwarf shrub meadows within 2 km of the coast; highest breeding densities occur in coastal salt grass meadows and lowest densities in dwarf shrub mat tundra; breeding densities in mixed graminoid and dwarf shrub meadows decline significantly with distance fom the coast (Handel and Gill 1992). Nests on the ground in a depression in a grassy area.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 31 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 15.174 - 16.316
  Nitrate (umol/L): 0.240 - 0.604
  Salinity (PPS): 33.311 - 33.496
  Oxygen (ml/l): 5.685 - 5.858
  Phosphate (umol/l): 0.330 - 0.407
  Silicate (umol/l): 1.436 - 2.773

Graphical representation

Temperature range (°C): 15.174 - 16.316

Nitrate (umol/L): 0.240 - 0.604

Salinity (PPS): 33.311 - 33.496

Oxygen (ml/l): 5.685 - 5.858

Phosphate (umol/l): 0.330 - 0.407

Silicate (umol/l): 1.436 - 2.773
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Begins migrating north along California coast in early April.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds along rocky coasts. Feeds on slugs, mollusks, and crustaceans. Inspects seaweeds for small marine animals. May also eat berries (Bent 1929).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Arenaria melanocephala (Black Turnstone) preys on:
Gigartina agardhii
Endocladia muricata
Littorina scutulata
Acmaea digitalis
Acmaea pelta
Acmaea scabra
Cyanoplax dientens
Dynamenella glabra
Allochertes ptilocerus
Diaulota densissima
Balanus glandula
Pachygrapsus crassipes

Based on studies in:
USA: California, Monterey Bay (Littoral, Rocky shore)

This list may not be complete but is based on published studies.
  • P. W. Glynn, Community composition, structure, and interrelationships in the marine intertidal Endocladia Muricata - Balanus glandula association in Monterey Bay, California, Beaufortia 12(148):1-198, from p. 133 (1965).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 - 100,000 individuals

Comments: Morrison et al. (2001) estimate the total population to be 80,000 (range 61,000-99,000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Breeding density in optimal conditions is 1.11 birds/ha (Handel and Gill 1992).

Kelp restoration along the California coast apparently has enhanced local wintering population through augmented feeding substrate (algal wrack) (Condor 95:372-376).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Breeds from early May to late July. Four eggs incubated for 21 days (probably incubated by both sexes since both have incubation patches) (Terres 1980). Nestlings are precocial.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Arenaria melanocephala

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

NNNNTATACCTAATCTTCGGTGCATGAGCCGGCATAGTTGGAACTGCCCTCAGCCTACTCATTCGCGCAGAACTAGGTCAACCGGGGACCCTCCTAGGAGACGACCAAATTTACAATGTAATCGTCACCGCCCATGCCTTTGTAATAATCTTCTTCATAGNAATACCAATTATAATCGGTGGCTTCGGAAATTGACTAGTTCCCCTCATAATTGGTGNCCCCGACATGGCATTCCCTCGCATAAACAACATAAGCTTCTGATTACTTCCCCCATCATTCCTTCTACTACTAGCATCATCCACAGTAGAAGCCGGAGCAGGTACAGGATGAACTGTATACCCACCCCTCGCTGGCAACCTAGCCCATGCTGGGGCTTCAGTAGACCTAGCCATCTTCTCCCTTCACTTAGCAGGAGTCTCCTCCATCCTAGGTGCCATCAACTTCATCACAACAGCCATTAACATAAAACCCCCAGCTCTCTCTCAATACCAAACACCCCTATTCGTATGGTCAGTGCTTATCACCGCCGTCCTACTACTGCTCTCTCTCCCAGTTCTCGCCGCTGGCATCACCATGCTACTAACAGATCGAAATTTAAACACTACATTCTTCGACCCAGCCGGAGGCGGAGACCCAGTCCTATATCAACACCTCTTCTGATTCTTTGGTCACCCAGAAGTCTACATCTTAATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Arenaria melanocephala

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5N - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Black Turnstone

The black turnstone (Arenaria melanocephala) is a species of small wading bird. It is one of two species of turnstone in the genus Arenaria, the ruddy turnstone (A. interpres) being the other. It is now classified in the sandpiper family Scolopacidae but was formerly sometimes placed in the plover family Charadriidae. It is native to the west coast of North America and breeds only in Alaska.

Description[edit]

It is 22–25 centimeters long and weighs 100–170 grams. The black bill is 20–27 millimeters long and slightly upturned. The legs and feet are blackish-brown with a reddish tinge. The bird is largely black and white in appearance. Breeding-plumaged adults have a black head and breast apart from a white spot between the eye and bill, a white stripe over the eye and white flecks on the sides of the breast. The upperparts are blackish-brown with pale fringes to the wing-coverts and scapular feathers. The belly and vent are white. In flight it shows a white wingbar, white shoulder patch and white tail with a broad black band across it. There is white from the lower back to the uppertail-coverts apart from a dark bar across the rump.

In winter the head and breast become largely dark brown with little white. Juveniles are similar to winter adults but browner with buff fringes to the wing-coverts and scapulars and a grey-brown tip to the tail.

The ruddy turnstone is similar but has rufous-brown markings on the upperparts and more white on the head and breast, particularly in breeding plumage. It has narrower wings and a narrower white wingbar. Its legs are orange and brighter than those of the black turnstone though there can be some overlap.

The black turnstone has a variety of calls, especially a rattling trill which can be heard throughout the year. This call is higher and less harsh than the similar call of the ruddy turnstone. Other calls include a loud, screeching alarm call and a soft, purring call uttered to young chicks. Displaying males produce a long series of staccato notes in flight as well as chirruping trills on the ground.

Distribution[edit]

It breeds in western Alaska from the Alaska Peninsula in the south to Point Hope in the north. The bulk of the population nests in the Yukon-Kuskokwim Delta. It usually nests near the coast but in some areas it occurs further inland along the shores of rivers and lakes. There are a handful of records from north-east Siberia but there has been no sign of breeding there. The world population is estimated at 95,000 birds with about 80,000 of these in the Yukon-Kuskokwim Delta.

It winters on rocky shores along the Pacific coast of North America from southern Alaska southwards as far as north-west Mexico where it occurs in Baja California and Sonora with a single record from Nayarit. It is very occasionally seen inland during spring and fall migration; there are a number of records from the Salton Sea in southern California and scattered sightings from inland US states including Montana, Wisconsin, Nevada and Arizona.[2] Vagrant birds have been recorded from Yukon and the Northwest Territories and there is one record from San Cristóbal Island in the Galápagos Islands.[3]

Ecology[edit]

Winter-plumaged bird in California.

It feeds mainly on invertebrates, particularly crustaceans and mollusks in winter and insects during the breeding season. Seeds, eggs and carrion are also taken. At the breeding grounds it mainly feeds in wet meadows with sedges. In winter, its typical habitat is rocky coasts but it also feeds on beaches, mudflats and man-made structures such as jetties and breakwaters. It uses its bill to turn over stones, algal mats and other objects to get at prey hidden beneath.

It arrives on its breeding ground from early May to early June with the males arriving first. The birds often return to the same territory and pair with the same mate as previous years. The nest is a scrape dug mainly by the male. It is usually located amongst sedges or grasses or under willows. Four eggs are usually laid; they are olive or pale greenish with darker spots. The eggs are incubated for 21–24 days by both parents. The young birds are precocial and are able to leave the nest and feed themselves soon after hatching. They are able to fly well after 25–34 days.

Footnotes[edit]

  1. ^ BirdLife International (2012). "Arenaria melanocephala". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Stevenson, Mark M. (2005). "First occurrence of Black Turnstone in Arizona". Arizona Birds Online 2: 1–3. 
  3. ^ a b Swash, Andy & Still, Rob (2000). Birds, Mammals and Reptiles of the Galápagos Islands, Pica Press, East Sussex and WILDGuides, Hampshire.

References[edit]

  • Handel, C. M., and R. E. Gill (2001). Black Turnstone (Arenaria melanocephala). In The Birds of North America, No. 585 (A. Poole and F. Gill, eds.). The Birds of North America, Inc., Philadelphia, PA. Accessed 20/09/07. [subscription required]
  • Rosair, David & Cottridge, David (1995) Hamlyn Photographic Guide to the Waders of the World. Hamlyn, London.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!