Articles on this page are available in 3 other languages: Spanish (9), Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

For a wader, turnstones have short legs. They don't look for their food in the mud or water, but between stones. They thank their name to the fact that they turn over stones while looking for food. They are truly worldy citizens; you find them almost everywhere. They nest from the end of May on rocky islands along the coast and on tundra in the Arctic region. They migrate south at the beginning of June. In the Netherlands, you can see them almost the entire year along the coast, but in particular during migration season and in the winter. 'Our' winter turnstones nest mostly in Greenland or Canada.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arenaria interpres

A medium-sized (8-10 inches) plover, the Ruddy Turnstone in summer is most easily identified by its orange back and legs, pale breast, white head with black patches on the face and throat. In winter, this species becomes dull brown above and white below. Birds in summer plumage are unmistakable, while winter birds may be separated from other dull shorebirds by this species’ short, upturned bill. Male and female Ruddy Turnstones are similar to one another in all seasons. The Ruddy Turnstone occurs throughout much of the world. In the New World, this species breeds in the high arctic of Canada, Alaska, and Greenland, wintering along the coasts of the Americas from mid-latitude North America south to southern South America. In the Old World, this species breeds along the edge of the Arctic Ocean, wintering from Europe south to South Africa and from South Asia south to Australasia and the islands of the Pacific Ocean. Ruddy Turnstones breed in wet areas on the arctic tundra. In winter, this species may be found along the coast on sandy or rocky beaches. Ruddy Turnstones primarily eat small insects during the summer months, switching to crustaceans and small fish during the winter. Due to this species’ remote breeding grounds, most birdwatchers are only familiar with Ruddy Turnstones during the winter. At that time, this species is most easily seen while walking or running along the shoreline, turning over stones while foraging for food (a behavior which gave this species its name). Ruddy Turnstones are most active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

At all seasons, the plumage is dominated by a harlequin-like pattern of black and white. Breeding birds have reddish-brown upper parts with black markings. The head is mainly white with black streaks on the crown and a black pattern on the face. The breast is mainly black apart from a white patch on the sides. The rest of the underparts are white. In flight it reveals a white wingbar, white patch near the base of the wing and white lower back, rump and tail with dark bands on the uppertail-coverts and near the tip of the tail. The female is slightly duller than the male and has a browner head with more streaking. Non-breeding adults are duller than breeding birds and have dark grey-brown upperparts with black mottling and a dark head with little white. Juvenile birds have a pale brown head and pale fringes to the upperpart feathers creating a scaly impression. Birds of the subspecies morinella are smaller with darker upperparts and less streaking on the crown. The Ruddy Turnstone has a staccato, rattling call and also a chattering alarm-call which is mainly given during the breeding season.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Circumpolar. BREEDS: northern Alaska and Canadian arctic islands south to western Alaska, and Southhampton, Coats, and Mansel islands, probably also northern Mackenzie and northern Keewatin; Greenland, Iceland, Palearctic. NORTHERN WINTER: coast from central California, Gulf Coast, and New York south through West Indies to southern South America; Pacific islands (common in Hawaii August-May, a few stay all year); Australia, New Zealand, Old World. Nonbreeders may summer in winter range. In South America, by far the most important area is north-central coast of Brazil between Belem and Sao Luis; other important areas include Suriname and French Guiana as well as the northeast coast of Brazil (Morrison and Ross 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; southern Nova Scotia to the Gulf States
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Ruddy turnstones breed far north in arctic tundra from Alaska, across Canada, Greenland, Scandinavia, and northern Siberia to the Bering Sea. In winter they are found along almost all of the coastlines of the world, including North, Central, and South America, Africa, Europe, Asia, Australia, and Pacific Ocean islands.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native ); oceanic islands (Native )

Other Geographic Terms: holarctic ; cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Ruddy turnstones are one of the northernmost breeding shorebirds. They breed in arctic tundra from Alaska, across Canada, Greenland, Scandinavia, the Baltic Islands, and across northern Siberia to the Bering Sea. In winter they are found along coastlines from northern Massachusetts and northern California throughout the Antilles, Central and South America to Tierra del Fuego and along coastlines throughout Europe, Africa, Australia, New Zealand, Southeast Asia, and the Pacific Islands.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native ); oceanic islands (Native )

Other Geographic Terms: holarctic ; cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Subspecies and Distribution:


    * interpres (Linnaeus, 1758) - Axel Heiberg I and Ellesmere I (N Canadian Arctic), Greenland, N Eurasia and NW Alaska; winters on coasts of W Europe, Africa, S Asia, Australasia and S Pacific islands, with some also on Pacific coast of North America, from California to at least Mexico. * morinella (Linnaeus, 1766) - NE Alaska and most of Arctic Canada; winters from South Carolina and Gulf of Mexico to SC Chile and N Argentina.


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Ruddy turnstones are small, robust Scolopacidae with stout, black, slightly upturned bills. They are 21 to 26 cm long, weighing from 84 and 190 g, and a wingspan of 50 to 57 cm. They look similar in all seasons and males and females look alike. Ruddy turnstones have reddish-brown feathers on their back and wings. They have black and brown feathers on the head and mixed in with the reddish feathers on their backs. The belly is white and the legs are bright orange. They have a dark, black band that stretches across the neck and chest, like a bib.

Range mass: 84 to 190 g.

Range length: 21 to 26 cm.

Range wingspan: 50 to 57 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Ruddy turnstones are small, robust sandpipers with stout, black, slightly upturned bills. They are 21 to 26 cm long, weighing from 84 and 190 g, and a wingspan of 50 to 57 cm. Plumage in breeding and non-breeding seasons are similar, slightly darker overall in the non-breeding season. Males and females are also similar in appearance. Ruddy turnstones have rufous feathers on their back and dorsal surface of their wings. They have black and brown plumage on the head and interspersed with the rufous areas overall. The belly is white and the legs are bright orange. They have a dark, black band that stretches across the neck and chest, like a bib. In flight they have distinctive white wing stripes and black on the trailing edge of the wing. There are two white stripes along the back and a broad, white rump patch.

Range mass: 84 to 190 g.

Range length: 21 to 26 cm.

Range wingspan: 50 to 57 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 24 cm

Weight: 141 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

It is a fairly small and stocky bird, 22–24 centimetres long with a wingspan of 50–57 centimetres and a weight of 85-150 grams. The dark, wedge-shaped bill is 2–2.5 centimetres long and slightly upturned. The legs are fairly short at 3.5 centimetres and are bright orange

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Length: 21-25 cm. Plumage: above mottled dull or dusky brown and black; below white; sides of face and breast blackish, cheeks and chin white; wingbar and inner wing coverts white; wedge on back white with black patch on rump and wide black sub-terminal band on white tail; breeding bird with rufous replacing brown and very bold intricate black and white face and breast pattern. Immature . Bare parts: iris brown; bill black and wedge-shaped, slightly upturned; feet and short legs orange with black joints. Habitat: rocky beaches, tidal reefs, mudflats, coral reefs and weedy beaches; some inland waters. Palearctic migrant. <389><391><393>
  • Urban, E.K., C.H. Fry & S. Keith (1986). The Birds of Africa, Volume II. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

At all seasons, the plumage is dominated by a harlequin-like pattern of black and white. Breeding birds have reddish-brown upper parts with black markings. The head is mainly white with black streaks on the crown and a black pattern on the face. The breast is mainly black apart from a white patch on the sides. The rest of the underparts are white. In flight it reveals a white wingbar, white patch near the base of the wing and white lower back, rump and tail with dark bands on the uppertail-coverts and near the tip of the tail. The female is slightly duller than the male and has a browner head with more streaking. Non-breeding adults are duller than breeding birds and have dark grey-brown upperparts with black mottling and a dark head with little white. Juvenile birds have a pale brown head and pale fringes to the upperpart feathers creating a scaly impression. Birds of the subspecies morinella are smaller with darker upperparts and less streaking on the crown. The Ruddy Turnstone has a staccato, rattling call and also a chattering alarm-call which is mainly given during the breeding season.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Nonbreeding: rocky, barren pebbly coasts, sandy beaches, mud flats, river mouths, tidal creeks, and shores of lakes (AOU 1983); fields (Shallenberger 1984). Nests in dry, dwarf-shrub tundra, usually near water (AOU 1983); various habitats ranging from wet mud or barren peat to dense vegetation, though appears to favor barren habitats (see Johnson and Herter 1989). Usually breeds along the coast. Nests on the ground; may nest near other ruddy turnstones.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour This species is fully migratory (del Hoyo et al. 1996). It breeds from May to early-August (Hayman et al. 1986) in solitary pairs (del Hoyo et al. 1996), although several pairs may nest close together in optimal habitats (Johnsgard 1981) along coasts or on islands (Snow and Perrins 1998). The species migrates in large flocks (del Hoyo et al. 1996) and is gregarious and sociable when feeding or roosting in winter (Snow and Perrins 1998), often foraging in close flocks of 10-100 or more individuals, especially in tidal areas (del Hoyo et al. 1996). Habitat Breeding The species breeds near the coast or up to several kilometres inland (Snow and Perrins 1998) in the high Arctic (Hayman et al. 1986), nesting on coastal plains, marshes and tundra (del Hoyo et al. 1996) and showing a preference for mosaics of bare rock, clay or shingle and vegetation near water (Snow and Perrins 1998) or in areas that remain damp until late summer (Johnsgard 1981). Non-breeding Outside of the breeding season the species is mainly coastal (del Hoyo et al. 1996), although on migration it may occur inland along dykes or on lake shores (del Hoyo et al. 1996). During the winter it frequents productive rocky and shingle shores (Hayman et al. 1986, del Hoyo et al. 1996), breakwaters (del Hoyo et al. 1996), sandy beaches with storm-wracked seaweed (Hayman et al. 1986, del Hoyo et al. 1996), short-grass saltmarshes, sheltered inlets, estuaries, mangroves swamps, exposed reefs and mudflats with beds of molluscs (del Hoyo et al. 1996). Diet Breeding On its Arctic breeding grounds the species takes Diptera(especially adult and larval midges) as well as larval Lepidoptera, Hymenoptera, Coleoptera and spiders, occasionally also taking vegetable matter early in the season (del Hoyo et al. 1996). Non-breeding Outside of the breeding season its diet consists of insects, crustaceans, molluscs (del Hoyo et al. 1996) (especially mussels or cockles) (Johnsgard 1981), annelids, echinoderms, small fish, carrion and birds eggs (del Hoyo et al. 1996). Breeding site The nest is a shallow depression (del Hoyo et al. 1996) in mud, peat or on dry ground (Johnsgard 1981) with dense vegetation (del Hoyo et al. 1996), often positioned on a slight ridge, hummock or tussock, or in cleft or shallow fissure (Snow and Perrins 1998). The species usually nests solitarily, although neighbouring pairs may nest as little as 15 m apart along coasts or on islands (where abundant feeding habitats are available) (Snow and Perrins 1998). Management information Removing feral American mink Neovison vison from a large archipelago with many small islands in the Baltic Sea had the result of increasing the breeding density of this species in the area (Nordstrom et al. 2003).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ruddy turnstones are found in arctic tundra and rocky coastal areas during the breeding season and along coastlines during winter and migration. Preferred habitats in winter are sandy coastlines and mudflats, but ruddy turnstones are also found on rocky beaches, wetlands, and other intertidal areas.

Habitat Regions: temperate ; tropical ; polar ; terrestrial

Terrestrial Biomes: desert or dune

Aquatic Biomes: coastal

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ruddy turnstones are found in arctic tundra and rocky coastal areas during the breeding season and along coastlines during winter and migration. Preferred habitats in winter are sandy coastlines and mudflats, but ruddy turnstones are also found on rocky beaches, wetlands, and other intertidal areas.

Habitat Regions: temperate ; tropical ; polar ; terrestrial

Terrestrial Biomes: desert or dune

Aquatic Biomes: coastal

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 48 specimens in 1 taxon.
Water temperature and chemistry ranges based on 36 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 8.094 - 16.999
  Nitrate (umol/L): 0.119 - 14.675
  Salinity (PPS): 32.704 - 35.363
  Oxygen (ml/l): 5.554 - 6.701
  Phosphate (umol/l): 0.351 - 0.763
  Silicate (umol/l): 1.872 - 7.519

Graphical representation

Temperature range (°C): 8.094 - 16.999

Nitrate (umol/L): 0.119 - 14.675

Salinity (PPS): 32.704 - 35.363

Oxygen (ml/l): 5.554 - 6.701

Phosphate (umol/l): 0.351 - 0.763

Silicate (umol/l): 1.872 - 7.519
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

It can survive in a wide range of habitats and climatic conditions from Arctic to tropical. The typical breeding habitat is open tundra with water nearby. Outside the breeding reason, it is found along coasts, particularly on rocky or stony shores. It is often found on man-made structures such as breakwaters and jetties.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

In U.S. migrates northward mainly in May, along Atlantic, Great Lakes, and Pacific coast; arrives in Beaufort Sea region beginning mid- to late May. Juveniles, are last to depart breeding areas, begin to migrate south during last half of August and early September; fall migrants common in s. Quebec, Newfoundland, and Maritime Provinces (Johnson and Herter 1989). Migrants common in Costa Rica late March-late May and August-October (Stiles and Skutch 1989). Arrives in northern South America by September, most depart by end of May (Hilty and Brown 1986). Usually flys high, in large flocks, during migration.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on crustaceans (amphipods, soft parts of barnacles, fiddler crabs, eggs, etc.) worms, insects and their larvae, and mollusks. Also known to eat berries, tern and spotted sandpiper eggs, and crumbs from picnic areas (Terres 1980). In spring at Delaware Bay, consumes large numbers of horseshoe crab eggs (Castro and Myers 1993, Botton et al. 1994). Forages mainly in intertidal zone; overturns shells, debris, digs into sand (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The ruddy turnstone diet varies seasonally between wintering and breeding habitats. They eat mainly invertebrates, mostly Insecta, mostly Diptera, during the breeding season and Crustacea, Mollusca, and other marine invertebrates during migration and winter.

Ruddy turnstones actively hunt down and efficiently manipulate prey. They use their stout bills to turn over rocks and other objects and probe into sand and soil to find prey. They are skilled at opening and eating bivalves and barnacles.

Animal Foods: fish; eggs; carrion ; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic or marine worms; aquatic crustaceans; echinoderms; other marine invertebrates

Plant Foods: fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The ruddy turnstone diet varies seasonally between wintering and breeding habitats. They eat primarily invertebrates, mostly insects during the breeding season and crustaceans, mollusks, and other marine invertebrates during migration and winter. In the breeding season, ruddy turnstones use their stout bills to turn over rocks, probe through tundra vegetation or soils, and chase down mostly insect prey. Early in the season they may rely on carrion and plant materials, until insect prey becomes more abundant. Dominant prey in summer are flies and their larvae (Diptera), especially midges (Chironomidae), but also crane flies (Tipulidae), dance flies (Empididae), syrphid flies (Syrphidae), muscid flies (Muscidae), and blow flies (Calliphoridae). They also take spiders (Dictynidae, Lycosidae, Linyphiidae, Thomisidae), moth and butterfly larvae (Lymantriidae, Liparidae, Noctuidae, Nymphalidae), and beetles (Coleoptera). They may also take the eggs of colonial nesting birds (Larus, Sterna) in summer if they are nesting nearby. Once the young have hatched, families hunt together mostly along the margins of ponds and wetlands, where dipteran prey is most abundant.

In winter and during migration, ruddy turnstones take prey found on or just under the surface in their sandy, coastal habitats, especially crustaceans, mollusks, and polychaete worms. Diet varies with local and temporal availability of prey. During migration they will take advantage of highly abundant, but temporary, food resources, such as horseshoe crab eggs (Limulus polyphemus) on the mid-Atlantic coast during May and blowfly larvae (Calliphoridae) along the coasts of Alaska during August. Ruddy turnstones are opportunistic and will take carrion, the eggs of other birds, fish, and plant material as available. Dominant prey items in winter habitats include barnacles (Balanus), amphipods (Gammarus, Caprella), copepods (Calanus), shrimp and crabs (Crago, Cancer, Hippa, Emerita, Carcinus, Eupagurus, Pagurus), polychaete worms (Nereis), chitons (Chaetopleura, Chiten), periwinkles (Littorina), and bivalves (Mytilus, Cardium, Mya). They include other aquatic invertebrates in their diet as well.

Ruddy turnstones are aggressive birds, actively hunting down and efficiently manipulating prey. They use their stout bills to turn over rocks and other objects and probe into substrates to find prey. They are skilled at opening and dislodging bivalves and barnacles.

Animal Foods: fish; eggs; carrion ; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic or marine worms; aquatic crustaceans; echinoderms; other marine invertebrates

Plant Foods: fruit

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Ruddy Turnstone has a varied diet including carrion, eggs and plant material but it feeds mainly on invertebrates. Insects are particularly important in the breeding season. At other times it also takes crustaceans, molluscs and worms. It often flips over stones and other objects to get at prey items hiding underneath; this behaviour is the origin of the name ""turnstone"". It usually forages in flocks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Ruddy turnstones are predators of insects and other invertebrates in their tundra breeding habitats and crustaceans and mollusks in coastal habitats at other times of the year.

Mutualist Species:

  • collared lemmings (Dicrostonyx_groenlandicus)

Commensal/Parasitic Species:

  • nematodes (Nematoda)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Most predation on ruddy turnstones is on eggs and hatchlings. Predators include Stercorarius longicaudus, Stercorarius parasiticus, Larus hyperboreus, Corvus corax, Vulpes lagopus, and Vulpes vulpes. Many predators take more ruddy turnstone eggs and young when numbers of Dicrostonyx groenlandicus are low. Ruddy turnstones place their nests far away from others, in order to avoid being found by predators. Males patrol the nesting territory and warn the female when there is a predator nearby. The female will then sneak away from the nest so that the predators can't find it. Parents warn their hatchlings to freeze when they see a predator and the parents may try to distract the predatory by pretending to have a broken wing. Adults are only occasionally preyed on by birds of prey, like Accipiter nisus, Falco peregrinus, Falco columbarius, and Strigiformes.

Known Predators:

  • long-tailed jaegers (Stercorarius_longicaudus)
  • parasitic jaegers (Stercorarius_parasiticus)
  • glaucous gulls (Larus_hyperboreus)
  • common ravens (Corvus_corax)
  • arctic foxes (Vulpes_lagopus)
  • red foxes (Vulpes_vulpes)
  • Eurasian sparrow-hawks (Accipiter_nisus)
  • peregrine falcons (Falco_peregrinus)
  • merlins (Falco_columbarius)
  • owls (Strigiformes)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Ruddy turnstones are important predators of insects and other invertebrates in their tundra breeding habitats and crustaceans and mollusks in coastal habitats at other times of the year. There are few parasites recorded in ruddy turnstones, only some records of nematode infections.

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Most predation on ruddy turnstones is on eggs and hatchlings. Known predators are long-tailed jaegers (Stercorarius longicaudus), parasitic jaegers (Stercorarius parasiticus), glaucous gulls (Larus hyperboreus), common ravens (Corvus corax), arctic foxes (Vulpes lagopus), and red foxes (Vulpes vulpes). Jaegers may be the primary predators, they will continue to visit nests that they discover until all eggs or young are taken. Predation pressure on ruddy turnstones and other shorebirds nesting in tundra is highest when population numbers of collared lemmings (Dicrostonyx groenlandicus) are lowest. Ruddy turnstones have dispersed nesting territories, even in habitats with dense populations, to make it more difficult for predators to discover nests. Males actively patrol the nesting territory and warn the female when there is a predator nearby. In response, females sneak away from the nest to disguise its location from the predator. When predators are detected by pairs with hatchlings, their warning calls cause the hatchlings to freeze and the parents may perform a distraction display, pretending to be injured. Adults are only occasionally preyed on, reported predators of adults are Eurasian sparrow-hawks (Accipiter nisus), peregrine falcons (Falco peregrinus), merlins (Falco columbarius), and owls (Strigiformes).

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Arenaria interpres (Arenaria interpres turnstone) preys on:
Carcinus
Corophium
Gammaridae
Corophium volutator
Gammarus
Hydrobia ulvae
Littorina littorea
Mytilus edulis

Based on studies in:
Scotland, Ythan estuary (Estuarine)
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • H. Milne and G. M. Dunnet, Standing crop, productivity and trophic relations of the fauna of the Ythan estuary. In: The Estuarine Environment, R. S. K. Barnes and J. Green, Eds. (Applied Science Publications, Edinburgh, Scotland, 1972), pp. 86-106, from
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Arenaria interpres (Arenaria interpres turnstone) is prey of:
Himasthla elongata
Levinseniella brachysoma
Maritrema gratiosum
Hymenolepis

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

100,000 - 1,000,000 individuals

Comments: Morrison et al. (2001) estimated the global population at 449,000 and the North American population at 235,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Usually feeds singly or in small numbers (may defend individual feeding territory); may feed with other shorebirds along sandy or rocky beaches. May form large flocks (500 or more) during migration. Sleeps or rests in flocks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Ruddy turnstones use calls and visual displays when communicating with others. They display on the ground and in the air to attract mates. Males call more than females, but both sexes use calls of different kinds. Ruddy turnstones have been described as "noisy." Variations on a call that sounds like "kitititit" are contact and alarm calls. "Pri pri pri" type calls are used to call young. Clicking calls and sounds are used when distracting or attacking predators and high pitched "i i i" sounds are distress calls.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Ruddy turnstones use vocalizations and visual displays extensively in communicating with conspecifics. They use displays, both on the ground and in the air, to attract mates and reinforce pair bonds. Males vocalize more than females, but both sexes do produce a variety of calls in different contexts. Ruddy turnstones have been described as "noisy." Variations on a call that sounds like "kitititit" are contact and alarm calls. "Pri pri pri" type calls are used to call young. Clicking calls and sounds are used when distracting or attacking predators and high pitched "i i i" sounds are distress calls.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Rests at night and at high tide.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The longest recorded lifespan for ruddy turnstones in the wild is 19.7 years. Average lifespan in Finland was estimated at 6 to 7 years.

Range lifespan

Status: wild:
19.75 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The longest lifespan for ruddy turnstones in the wild is an individual that lived to 19.7 years. Average lifespan in Finland was estimated at 6 to 7 years. Survival rates in the first year are estimated at 45 to 58% in some areas. Annual survival of adults is estimated at 66 to 85% in some areas. Eggs and hatchlings are vulnerable to cold weather, damage to eggs during incubation, and predation.

Range lifespan

Status: wild:
19.75 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.7 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg laying occurs mainly in mid-June in arctic Canada. Both sexes incubate usually 4 eggs for 21-22 days (Terres 1980). Nestlings are precocial. Young initially are tended by both parents; can fly 24-26 days after hatching.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ruddy turnstones form mated pairs that stay together over many years. Pairs meet again in the same breeding territory used the last year. Ruddy turnstones are fairly aggressive and will even attack their mates at first. Males and females both use flight displays to help attract their mates. Once they are back together, males and females stay within sight of each other until they start incubating the eggs.

Mating System: monogamous

Ruddy turnstones arrive on the breeding grounds in late May and early June and mate and begin to lay eggs within 7 to 10 days of their arrival. They create a nest scrape lined with leaves and lichen. Females lay 1 egg each day and usually lay 4 dark brown or olive splotched eggs. Incubation is 21 to 24 days long. Young hatch within a day or two of each other. Fledging occurs at 19 to 21 days old, at which point the young are independent. Ruddy turnstone young remain on their wintering grounds throughout their first year after hatching. Young begin to breed in their 2nd year, although breeding may be delayed until 3 or 4 years old.

Breeding interval: Ruddy turnstones breed once yearly.

Breeding season: Ruddy turnstones breed in May and June.

Range eggs per season: 2 to 5.

Average eggs per season: 4.

Range time to hatching: 21 to 24 days.

Range birth mass: 10 to 12.5 g.

Average birth mass: 11.42 g.

Range fledging age: 19 to 21 days.

Range time to independence: 19 to 21 days.

Range age at sexual or reproductive maturity (female): 4 (high) years.

Average age at sexual or reproductive maturity (female): 2 years.

Range age at sexual or reproductive maturity (male): 4 (high) years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Females and males incubate the eggs, but females do most of the incubation and caring for the eggs and nest. Males patrol the nest area and warn the female if there are predators nearby, at which point she will move from the nest to distract attention from the eggs. Young ruddy turnstones hatch with downy feathers and are able to walk and begin to find food within a few hours after hatching and the nest is abandoned within a day of hatching. Males and females protect the hatchlings, but the female abandons them mid-way through the hatchling period and the male remains to protect the young until they fledge, at 19 to 21 days old. Parents aggressively guard their young and lead them to areas with lots of prey, especially Chironomidae, so they can feed themselves. A few days after fledging, usually at 21 to 23 days old, the young are almost at adult sizes and begin their first migration to the wintering grounds.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Protecting: Male, Female)

  • Larsen, T. 1991. Antipredator behaviour and mating systems in waders: aggressive nest defence selects for monogamy. Animal Behavior, 41: 1057–1062.
  • Nettleship, D. 2000. Ruddy turnstone (Arenaria interpres). The Birds of North America Online, 537: 1-20. Accessed April 02, 2009 at http://bna.birds.cornell.edu/bna/species/537.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ruddy turnstones are monogamous. Pairs form on the breeding territory, meeting again in the same territory used the previous year. In one study 16 turnstones kept the same mate each year over a 5 year period. Ruddy turnstones are aggressive, mated pairs initially are aggressive towards each other, even when one or the other returns to the nest. Pair bonds are renewed through courtship displays on the ground and in the air. Displays can be initiated by either females or males. Once the pair bond is established, males and females remain within sight of each other until egg-laying begins.

Mating System: monogamous

Ruddy turnstones arrive on the breeding grounds in late May and early June and establish pair bonds within 7 to 10 days of their arrival and create a nest scrape lined with leaves and lichen and begin laying eggs within a few days after that, usually by mid-June. Egg laying is influenced by the availability of prey and may be delayed if there isn't enough animal foods. Females lay 1 egg each day for the first 3 eggs, with other eggs laid at 1 to 2 day intervals. Locally, females are highly synchronous in egg-laying. Clutches are completed by late June and incubation begins at the 3rd egg laid. Clutches are from 2 to 5, but usually 4, dark brown or olive splotched eggs and incubation is 21 to 24 days long. Young hatch within a day or two of each other. Fledging occurs at 19 to 21 days old, at which point the young are independent. Ruddy turnstone young remain on their wintering grounds throughout their first year after hatching. Young begin to breed in their 2nd year, although breeding may be delayed until 3 or 4 years old.

Breeding interval: Ruddy turnstones breed once yearly.

Breeding season: Ruddy turnstones breed in May and June.

Range eggs per season: 2 to 5.

Average eggs per season: 4.

Range time to hatching: 21 to 24 days.

Range birth mass: 10 to 12.5 g.

Average birth mass: 11.42 g.

Range fledging age: 19 to 21 days.

Range time to independence: 19 to 21 days.

Range age at sexual or reproductive maturity (female): 4 (high) years.

Average age at sexual or reproductive maturity (female): 2 years.

Range age at sexual or reproductive maturity (male): 4 (high) years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Females and males incubate the eggs, but females do most of the incubation and caring for the eggs and nest. Males patrol the nest area and warn the female of the presence of predators, at which point she will move from the nest to distract attention from the eggs. Young ruddy turnstones hatch with downy feathers and are able to walk and begin to find food within a few hours after hatching and the nest is abandoned within a day of hatching. Males and females protect the hatchlings, but the female abandons the brood mid-way through the hatchling period and the male remains to protect the young until they fledge, at 19 to 21 days old. Parents aggressively guard their young and lead them to areas with lots of prey, especially midges, so they can feed themselves. A few days after fledging, usually at 21 to 23 days old, the young are almost at adult sizes and begin their first migration to the wintering grounds.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Protecting: Male, Female)

  • Larsen, T. 1991. Antipredator behaviour and mating systems in waders: aggressive nest defence selects for monogamy. Animal Behavior, 41: 1057–1062.
  • Nettleship, D. 2000. Ruddy turnstone (Arenaria interpres). The Birds of North America Online, 537: 1-20. Accessed April 02, 2009 at http://bna.birds.cornell.edu/bna/species/537.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

It is a monogamous bird and pairs may remain together for more than one breeding season. The nest is a shallow scrape, often with a lining of leaves. It is about 11 centimetres across and 3 centimetres deep. It may be built amongst vegetation or on bare stony or rocky ground. Several pairs may nest close together. A single clutch of two to five eggs is laid with four being most common. The eggs measure about 41 millimetres by 29 and weigh around 17.9 grams. They are smooth, slightly glossy and oval to pear-shaped. They are variable in colour but are commonly pale green-brown with dark brown markings, densest at the larger end. Incubation begins when the first egg is laid and lasts for about 22–24 days. The female is mainly responsible for incubating the eggs but the male may help towards the end. Non-breeding plumage

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Arenaria interpres

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Arenaria interpres

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTTTTATCAACCGATGACTATTCTCAACCAACCACAAAGATATCGGTACCCTATACCTAATCTTTGGTGCATGAGCCGGCATAGTCGGAACTGCCCTCAGCCTACTCATTCGCGCAGAACTAGGTCAACCGGGGACCCTCTTAGGAGACGATCAAATTTACAATGTAATCGTTACCGCCCATGCCTTTGTAATAATCTTCTTCATAGTAATGCCAATTATAATTGGTGGCTTCGGAAACTGACTAGTTCCTCTCATAATTGGCGCTCCCGACATAGCATTCCCCCGCATAAACAACATAAGCTTCTGATTACTTCCCCCATCATTCCTTCTACTACTAGCATCATCCACAGTAGAAGCCGGGGCAGGTACAGGATGAACTGTATACCCACCCCTTGCTGGTAACCTAGCCCATGCCGGAGCTTCAGTAGACCTAGCTATTTTCTCCCTTCACTTAGCAGGTGTCTCCTCCATCCTAGGTGCCATCAACTTCATTACAACAGCCATCAACATAAAACCCCCAGCCCTCTCTCAATACCAAACACCCCTATTTGTATGATCAGTACTTATCACCGCTGTCCTACTCCTGCTCTCTCTCCCAGTCCTCGCCGCTGGCATCACTATACTACTAACAGATCGAAACCTAAACACTACATTTTTCGACCCGGCCGGAGGCGGAGACCCAGTCCTATATCAACATCTCTTCTGATTCTTCGGCCACCCCGAAGTCTATATTCTAATCCTACCTGGCTTTGGAATCATCTCACACGTAGTAGCTTATTATGCAGGCAAAAAAGAACCATTCGGATACATAGGAATAGTATGAGCCATACTTTCCATTGGATTCCTAGGCTTCATCGTTTGAGCTCACCACATATTTACAGTAGGAATAGACGTAGATACCCGAGCATACTTTACATCCGCCACTATAATCATCGCCATTCCAACTGGCATTAAAGTATTCAGCTGACTAGCTACCTTGCACGGAGGAACTATTAAATGAGACCCCCCTATATTGTGAGCCCTAGGCTTCATTTTCCTTTTCACCATTGGTGGGCTCACAGGGATCGTACTGGCAAACTCCTCACTAGATATTGCCCTACATGACACATATTATGTAGTCGCCCACTTCCACTATGTCCTCTCAATAGGAGCTGTATTCGCCATCCTAGCGGGATTCACTCACTGATTCCCCCTATTTACAGGATACACGCTGCATACTACATGAACTAAGGCTCACTTCGGAGTCATATTTACTGGTGTTAACCTAACCTTCTTCCCACAACATTTCTTAGGCTTAGCCGGCATGCCACGCCGATACTCCGATTACCCAGACGCATACACCCTATGAAACACCATGTCCTCTATCGGCTCACTAATCTCAATAACTGCCGTAATCATACTAATATTCATCATCTGAGAAGCCTTCACATCAAAACGCAAAGTCCTACAGCCAGAACTAACCACTACTAACATTGAATGAATCCATGGCTGCCCGCCCCCATATCACACCTTCGAGGAACCGGCCTTCGTCCAAGTCCAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B,N5N : N4B: Apparently Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ruddy turnstones are not considered threatened because of their large geographic range and population sizes. They are protected under the U.S. Migratory Bird Act. However, populations are threatened by many of the things that threaten shorebirds worldwide: alteration, destruction, and contamination of coastal habitats. Their breeding grounds may also be influenced by global climate change. Especially serious is the effect of coastal disturbance on ruddy turnstones during migration. They rely on places along their migration route where superabundant food resources, such as horseshoe crab eggs (Limulus_polyphemus) or herring eggs (Clupea_harengus), help them gain fat for the rest of their migration.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ruddy turnstones are not considered threatened because of their large geographic range and population sizes. They are protected under the U.S. Migratory Bird Act. However, populations are threatened by many of the things that threaten shorebirds worldwide: alteration, destruction, and contamination of coastal habitats. Their breeding grounds may be influenced increasingly by global climate changes. Especially critical is the impact of coastal disturbance on ruddy turnstones during migration, especially important staging areas where historically superabundant food resources, such as horseshoe crab eggs (Limulus polyphemus) or herring eggs (Clupea harengus), were critical to body condition during the spring migration.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.460,000-800,000 individuals (Wetlands International, 2006), while national population estimates include: c.1,000-10,000 individuals on migration and c.50-1,000 wintering individuals in China; c.1,000-10,000 individuals on migration and c.50-10,000 wintering individuals in Taiwan; c.50-10,000 individuals on migration in Korea; c.1,000-10,000 individuals on migration and c.50-1,000 wintering individuals in Japan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species suffers nest predation from feral American mink Neovison vison in some regions (Nordstrom et al. 2003), and is susceptible to avian influenza so may be threatened by future outbreaks of the virus (Melville and Shortridge 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no adverse effects of ruddy turnstones on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Ruddy turnstones are fun to watch as they forage along beaches.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no adverse effects of ruddy turnstones on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Ruddy turnstones are interesting and charismatic members of coastal faunas throughout the world.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ruddy turnstone

The ruddy turnstone (Arenaria interpres) is a small wading bird, one of two species of turnstone in the genus Arenaria. It is now classified in the sandpiper family Scolopacidae but was formerly sometimes placed in the plover family Charadriidae. It is a highly migratory bird, breeding in northern parts of Eurasia and North America and flying south to winter on coastlines almost worldwide. It is the only species of turnstone in much of its range and is often known simply as turnstone.

Description[edit]

Non-breeding plumage

It is a fairly small and stocky bird, 22–24 cm (8.7–9.4 in) long with a wingspan of 50–57 cm (20–22 in) and a weight of 85–150 g (3.0–5.3 oz). The dark, wedge-shaped bill is 2–2.5 cm (0.79–0.98 in) long and slightly upturned. The legs are fairly short at 3.5 cm (1.4 in) and are bright orange.

At all seasons, the plumage is dominated by a harlequin-like pattern of black and white. Breeding birds have reddish-brown upper parts with black markings. The head is mainly white with black streaks on the crown and a black pattern on the face. The breast is mainly black apart from a white patch on the sides. The rest of the underparts are white. In flight it reveals a white wingbar, white patch near the base of the wing and white lower back, rump and tail with dark bands on the uppertail-coverts and near the tip of the tail. The female is slightly duller than the male and has a browner head with more streaking.

Ruddy turnstone on Bald Head Island

Non-breeding adults are duller than breeding birds and have dark grey-brown upperparts with black mottling and a dark head with little white. Juvenile birds have a pale brown head and pale fringes to the upperpart feathers creating a scaly impression.

Birds of the subspecies morinella are smaller with darker upperparts and less streaking on the crown.

The ruddy turnstone has a staccato, rattling call and also a chattering alarm-call which is mainly given during the breeding season.

Distribution[edit]

Floreana Island, Galapagos Islands

It breeds in northern latitudes, usually no more than a few kilometres from the sea. The subspecies A. i. morinella occurs in northern Alaska and in Arctic Canada as far east as Baffin Island. A. i. interpres breeds in western Alaska, Ellesmere Island, Greenland, Norway, Denmark, Sweden, Finland, Estonia and northern Russia. It formerly bred on the Baltic coast of Germany and has possibly bred in Scotland and the Faroe Islands.

In the Americas, the species winters on coastlines from Washington and Massachusetts southwards to the southern tip of South America although it is scarce in southern parts of Chile and Argentina and is only an unconfirmed vagrant in the Falkland Islands. In Europe, it winters in western regions from Iceland, Norway and Denmark southwards. Only small numbers are found on Mediterranean coasts. In Africa, it is common all the way down to South Africa with good numbers on many offshore islands. In Asia, it is widespread in the south with birds wintering as far north as southern China and Japan (mainly in the Ryukyu Islands). It occurs south to Tasmania and New Zealand and is present on many Pacific islands. Some non-breeding birds remain year round in many parts of the wintering range, with some of those birds still taking on breeding plumage in the spring and summer.

Behavior[edit]

Feeding and diet[edit]

Ruddy turnstones typically feed on insects in the summer, though their diet is extended to other invertebrates such as crustaceans, mollusks, and worms in other seasons.

They have also been observed preying on the eggs of other bird species such as gulls, terns, ducks, and even other turnstones, though this behavior is uncommon. In the majority of observed cases, turnstones typically go after undefended or unattended nests, puncturing the shells with their beaks to get at the contents within.[2]

Ruddy turnstones engage in a variety of behaviors to locate and capture prey. These behaviors can be placed into six general categories:[3]

  • Routing — The turnstone manipulates piles of seaweed through flicking, bulldozing, and pecking to expose small crustaceans or gastropod molluscs hidden underneath.
  • Digging — With small flicks of its bill, the turnstone creates holes in the ground substrate (usually sand or mud) and then pecks at the exposed prey - often sandhoppers or seaweed flies.
  • Probing — The turnstone inserts its bill more than a quarter-length into the ground to get at littorinids and other gastropods.
  • Hammer–probing — The turnstone cracks open its prey's shell by using its bill as a hammer, and then extracts the animal inside through pecking and probing.[4]
  • Surface pecking — The turnstone uses short, shallow pecks (less than a quarter bill-length) to get at prey at or just below the ground's surface.

There is evidence that turnstones vary between these feeding behaviors based on individual preference, sex, and even social status with respect to other turnstones. In one studied population, dominant individuals tended to engage in routing while preventing subordinates from doing the same. When these dominant individuals were temporarily removed, some of the subordinates started to rout, while others enacted no change in foraging strategy.

Aggression and territory defense[edit]

When foraging, turnstones adopt different postures indicative of their level of dominance. A lowered tail and a hunched stance is associated with chasing and aggression, and thus a dominant individual. Dominance in aggression is age-related, with juveniles assuming the subordinate role a disproportionate amount of the time.[5]

The plumage patterns of ruddy turnstones exhibit an unusual amount of variation in comparison with other shorebirds. Turnstones use these unique plumage patterns to recognize individuals and discriminate intruders in their territory from neighbors occupying an adjacent territory. When a fake fiberglass turnstone model is placed in a turnstone's territory, the occupant is less likely to respond aggressively if the model is painted to have the plumage pattern of a neighboring turnstone.[6]

Ecology[edit]

Flock of birds in varying stages of moult amongst pebbles and seaweed.

It can survive in a wide range of habitats and climatic conditions from Arctic to tropical. The typical breeding habitat is open tundra with water nearby. Outside the breeding season, it is found along coasts, particularly on rocky or stony shores. It is often found on man-made structures such as breakwaters and jetties. It may venture onto open grassy areas near the coast. Small numbers sometimes turn up on inland wetlands, especially during the spring and autumn migrations.

In terms of wintering sites, ruddy turnstones are particularly faithful to specific locations. A study published in 2009 examined turnstones wintering along a stretch of coastline in the Firth of Clyde. It found that 95% of birds resident to the area at the end of winter returned the following autumn. The same study also confirmed ruddy turnstones as one of the longest lived wader species, with annual adult mortality rates of under 15%.[7] Their average lifespan is 9 years with 19 years and 2 months being the longest recorded.

The ruddy turnstone has a varied diet including carrion, eggs and plant material but it feeds mainly on invertebrates. Insects are particularly important in the breeding season. At other times it also takes crustaceans, molluscs and worms. It often flips over stones and other objects to get at prey items hiding underneath; this behaviour is the origin of the name "turnstone". It usually forages in flocks.

Reproduction[edit]

Breeding-plumaged adult on nest
A drawing of the ruddy turnstone

It is a monogamous bird and pairs may remain together for more than one breeding season. The nest is a shallow scrape, often with a lining of leaves. It is about 11 cm (4.3 in) across and 3 cm (1.2 in) deep. It may be built amongst vegetation or on bare stony or rocky ground. Several pairs may nest close together.

A single clutch of two to five eggs is laid with four being most common. The eggs measure about 41 mm × 29 mm (1.6 in × 1.1 in) and weigh around 17.9 g (0.63 oz). They are smooth, slightly glossy and oval to pear-shaped. They are variable in colour but are commonly pale green-brown with dark brown markings, densest at the larger end. Incubation begins when the first egg is laid and lasts for about 22–24 days. The female is mainly responsible for incubating the eggs but the male may help towards the end.

The young birds are precocial and are able to leave the nest soon after hatching. They are buff above with dark grey markings and are white below. They are able to feed themselves but are protected by the parents, particularly the male. They fledge after 19–21 days.

Status and conservation[edit]

According to the International Union for Conservation of Nature (IUCN), the ruddy turnstone population is currently very stable. Environment Canada surveys suggest that they have in fact decreased in abundance relative to the 1970s, and face a variety of threats during migration and winter. They estimate that the Canadian population is 100,000 – 500,000 adults. The Canadian Wildlife Service estimates that the worldwide population of ruddy turnstones is 449,000, and that 235,000 are breeding in North America while the rest are breeding throughout the Arctic regions. They are very common and widespread. Their remote breeding range and widespread winter range should help them remain a common species.

References[edit]

  1. ^ BirdLife International (2012). "Arenaria interpres". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Parkes, Kenneth (September 1971). "The Ruddy Turnstone as an Egg Predator". The Wilson Bulletin 83 (3): 306–308. JSTOR 4160107. 
  3. ^ Whitfield, D. Philip (February 1990). "Individual Feeding Specializations of Wintering Turnstone Arenaria interpres". Journal of Animal Ecology 59 (1): 193–211. JSTOR 5168. 
  4. ^ Metcalfe, N. B.; R. W. Furness (1985). "Survival, winter population stability and site fidelity in the Turnstone Arenaria interpres". Bird Study 32 (3): 207–214. doi:10.1080/00063658509476881. Retrieved 26 September 2012. 
  5. ^ Groves, Sarah (January 1978). "Age related Differences in Ruddy Turnstone Foraging and Aggressive Behavior". The Auk 95 (1): 95–103. JSTOR 4085499. 
  6. ^ Whitfield, D. Philip (October 1986). "Plumage variability and territoriality in breeding turnstone Arenaria interpres: status signalling or individual recognition?". Animal behaviour 34 (5): 1471–1482. doi:10.1016/S0003-3472(86)80218-4. Retrieved 26 September 2012. 
  7. ^ Metcalfe, N. B.; R. W. Furness (1985). "Survival, winter population stability and site fidelity in the Turnstone Arenaria interpres". Bird Study 32 (3): 207–214. doi:10.1080/00063658509476881. Retrieved 26 September 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!