Articles on this page are available in 2 other languages: Spanish (9), Chinese (Simplified) (1) (learn more)

Overview

Brief Summary

Pluvialis dominica

A large (10-11 inches) wader, the male American Golden-Plover is most easily identified by its mottled golden back and crown, black underparts, and broad white stripe separating the two regions. The female American Golden-Plover in summer is similar to the male, but is slightly paler, especially on the face. In winter, both sexes are paler overall, becoming mottled gray above and pale below. In the breeding season, this species is most easily separated from the related Black-bellied Plover (Pluvialis squatarola) by that species’ larger size and grayer back. The American Golden-Plover breeds in northern Alaska and northwestern Canada. In winter, this species undertakes a long-distance migration to southern South America. American Golden-Plovers follow the Atlantic seaboard south during the fall migration, and return north along the central portion of the continent in spring. American Golden-Plovers breed on dry, sparsely-vegetated tundra habitats. In winter and on migration, this species utilizes a variety of open habitats, including grasslands, fields, coastal marshes, and mudflats. American Golden-Plovers primarily eat small invertebrates, including insects, earthworms, mollusks, and crustaceans. Due to its remote breeding and wintering habitats, many North American birdwatchers have only observed this species on migration. In suitable habitat, individuals may be seen foraging for food by probing the mud with their bills. This species is known to be territorial on its summer and winter ranges, but gathers in small flocks during migration. American Golden-Plovers are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Distribution

Range

Breeds Arctic North America; winters s South America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine, Gulf of Mexico, Irish Exclusive economic Zone, Kenya, New Zealand Exclusive Economic Zone, North West Atlantic, Portuguese Exclusive Economic Zone, Somalia, South Africa (country), Spanish Exclusive Economic Zone, Tanzania, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caribbean, North America
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

In summer months American golden plovers migrate from South America to Hudson Bay, northern Alaska, and Baffin island, their breeding grounds. They have also been spotted in Labrador, Nova Scotia, and Quebec. American golden plovers arrive on their summer grounds in mid-May. In the fall American golden plovers travel to Argentina, Uruguay, and Brazil for the winter.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: northern North America, from Baffin Island in Canada west to western Alaska. NORTHERN WINTER: Bolivia, Uruguay, and southern Brazil south to northern Chile and northern Argentina (some present in Central and South America in northern summer).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

American golden plovers closely resemble Pacific golden plovers (Pulvialis fulva), and the two were originally thought to be the same species. Both have wing undersides that are a grey-brown color and their wings are almost identical in size. American golden plovers have a longer, thinner body with a shorter neck and larger head, a tibia that is shorter than its bill, and a shorter bill relative to head size than Pacific golden plovers.

American golden plovers weigh between 122 and 194 g, averaging 144.6 g. They are 23 to 30 cm in length, and have a wingspan of 45.7 to 66.0 cm with average wingspan being 50.8 cm across.

American golden plovers resemble black-bellied plovers (Pulvialis squatarola) in coloration during the winter breeding season, although they are more golden in color. They are speckled grey and white on their underside (more grey than black-bellied plovers), and are speckled golden, white, and black on the head, back, and tail feathers. In the non-breeding season, American golden plovers appear more golden on their back and head. They lack a wing stripe and males are slightly more colorful than females.

Juvenile stage first non-breeding year plumage is a mix of juvenile and adult-like feathers after a post-juvenile moult. The first pre-breeding feathers look similar to adults after a moult occurs to replace the tail and body feathers of the first non-breeding feathers. American golden plovers have a post-breeding moult, replacing their breeding plumage with an eclipse plumage. This eclipse plumage replaces breeding plumage when they reach their southern wintering grounds. Eclipse plumage is more yellow and brown in color. Females retain more of their winter feathers than males. Males grow new tertials and wing coverts, and females do not. This is why males are brighter in color than females. On their northwards migration in spring, they begin to moult into breeding plumage.

Range mass: 122 to 194 g.

Average mass: 144.6 g.

Range length: 23 to 30 cm.

Average length: 26 cm.

Range wingspan: 45.7 to 66.0 cm.

Average wingspan: 50.8 cm.

Range basal metabolic rate: unknown to unknown cm^3 oxygen/hour.

Average basal metabolic rate: unknown cm^3 oxygen/hour.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male more colorful

  • Sibley, D. 2000. The Sibley Guide to Birds. New York: Alfred A. Knopf, Inc..
  • Sibley, D. 2003. The Sibley Field Guide to Birds of Eastern North America. New York: Alfred A. Knopf, Inc..
  • Sibley, D. 2003. The Sibley Field Guide to Birds of Western North America. New York: Alfred A. Knopf, Inc..
  • Robbins, C., B. Bruun, H. Zim. 1966. A Guide to Field Identification Birds of North America. New York: Golden Press.
  • Gough, G., J. Sauer, M. Iliff. 1998. "Patuxent Bird Identification Infocenter." (On-line). Accessed October 15, 2006 at http://www.mbr-pwrc.usgs.gov/id/framlst/infocenter.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 27 cm

Weight: 145 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Length: 23-26 cm. Plumage: non-breeding adult greyish brown spotted golden above; conspicuous superciliary stripes golden yellow and extend well behind eyes; underparts lightly mottled greyish or brownish yellow; belly and crissum white. Breeding adult black spotted golden with more white than non-breeding. Immature resembles non-breeding adult, but more yellow with brown spots on flanks. Bare parts: iris brown; bill black; feet and legs slate grey. Habitat: marine shores and estuaries. Vagrant in WIO. <389><391><393>
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

American golden plovers live in temperate, grassland areas. In winter, American golden plovers are found along the Rio de la Plata in the surrounding grasslands. In spring they migrate to arctic tundra regions.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; savanna or grassland

Wetlands: marsh

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Nonbreeding: short grasslands, pastures, golf courses, mudflats, sandy beaches, and flooded fields (AOU 1983). Nests on grassy tundra; prefers dry upland areas. The nest is a shallow scraped-out depression, lined with mosses, leaves, grass, and lichens. In western Alaska, where DOMINICA and FULVA are sympatric, DOMINICA nests occurred more often in areas of higher elevation and slope, with sparser and shorter vegetation, and more rocks; FULVA nests were usually at lower elevations in denser and taller vegetative cover; both forms used relatively dry upland tundra (Connors et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Arrives in U.S. March-April, in northern breeding areas late May-early June. Rare fall migrant in Puerto Rico and the Virgin Islands August-December (Raffaele 1983). Southward migration occurs mostly over oceans; northward migration through Middle America and from the Rockies to the Mississippi Valley. Young remain on tundra until around mid-August, at which time they form flocks and begin to migrate. In fall, Nova Scotia is a staging area for many that migrate to South America (but some may pass over Maritime provinces and fly nonstop from to South America). Amazonia apparently is an important migratory route (Stotz et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

During the breeding season, terrestial snails, insects and insect larvae, seeds, freshwater crustaceans, and insect larvae make up the majority of the American golden plovers diet. During this time, both males and females forage on their breeding territories. Females feed at greater distances than do males, and males return to the nest more often. When not breeding, terrestial earthworms, insects and insect larvae, berries, seeds, and freshwater fish make up the majority of their diet. Diet is influenced by local abundance of prey and temperatures. The breeding season in the arctic is marked by cold weather and local mudflats often freeze, forcing these plover to forage more on land. Species eaten include: juvenile southwestern Atlantic fiddle crabs (Uca uruguayensis), crowberries (Empetrum nigrum), cranberries (Vaccinium macrocarpon), and cloudberries (Rubus chamaemorus). It is unknown whether males and females have different feeding preferences.

American golden plovers eats foods whole, exhibiting a "run-stop-peck" feeding pattern. Because they lack nerve endings at the end of their beaks, they use their hard, sharp beaks to grab prey quickly and forcefully. Their beaks contain relatively unspecialized muscles which adds to the force with which prey is grabbed and to the range of movement in their jaw muscles. Thay also have strong neck muscles that keep their heads erect and increase the force with which they grab prey.

Animal Foods: fish; insects; mollusks; terrestrial worms; aquatic or marine worms; aquatic crustaceans; other marine invertebrates

Plant Foods: fruit

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods, Molluscivore ); herbivore (Frugivore )

  • Iribarne, O., M. Mariano. 1999. Predation on the Southwestern Atlantic Fiddler Crab (Uca uruguayensis) by migratory shorebirds (Pluvalis dominica, P. squatarola, Arenaria interpres, and Numenius phaeopus) . Estuaries, 22: 47-54.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds primarily on insects (grasshoppers, crickets, grubs of beetles, caterpillars, cutworms, wireworms, etc.). Also eats some small mollusks and crustaceans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

There is little information available on the role of P. dominica in its ecosystem. Because American golden plovers eat large numbers of insects and insect larvae, crustaceans, seeds, and berries, they reduce these populations. They may help disperse the seeds of the berries they eat.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

American golden plovers exhibit various types of predator defense. When a possible predator approaches its nest during breeding season, an adult will quickly leave the nest. The adult will then try to capture the predators attention from a different location, protecting the eggs. Circling and scolding the predator or "torpedo running" are both used for defense. American golden plovers will also use alarm calls to warn other plovers of the predators presence or perform lapwing motions. They sometimes attack a predator, but this is rare. American golden plovers will only attack arctic skuas (Stercorarius parasiticus) and long-tailed skuas (Stercorarius longicaudus).

American golden plovers are also able to blend in with their surroundings. When crouched on the nest, they conceal the white feathers on their undersides (breeding plumage), leaving only the darker, speckled feathers on the back visible. The dorsal plumage blends in well with the lichen-covered tundra habitat in which they nest.

American golden plover males exhibit fierce behavior when defending their territory during incubation from other American golden plovers. A male will "parallel walk" or exhibit "upright frontal threat" posture when another male enters his territory. Males will also physically fight, jumping on and pecking at one another. However, they do not use "torpedo running" or exhibit other behaviors that are used against predators. After the chicks hatch, American golden plovers cease defending their territory.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

American golden plovers communicate with each other using various calls. These calls include: trill, main/wail song, and alarm calls. Both the trill and main songs are used in the male flight song. Main song makes up the main portion of the song. Both trill and main songs have 4 short and quick tones. There are 6 different trill sequences used by P. dominica, much less than other tundra plovers. Alarm calls are more diverse than any other tundra plover. The call contains "whistles, yodel whistles, and clicking," and has also been described as a "clear, short, whistled oodle-oo" as well as "too-leet, too-leet." The flight call it thought to sound sad and urgent. Females tend to alarm call more during the incubation period than males. After hatching, alarm calls occur more equally between sexes.

American golden plovers also communicate visually. Males communicate with females using their flight songs, "torpedo runs," and butterfly wing motions. Both sexes will perform a type of flapping known as lapwings to show other members of the species that there is danger.

Communication Channels: visual ; acoustic

  • Allen, A. 1939. The Golden Plover and Other Plovers. Ithaca, New York: Com stock Publishing Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Males tend to live longer than females. Lifespans are usually between 8 and 15 years in the wild.

Range lifespan

Status: wild:
15 (high) years.

Typical lifespan

Status: wild:
8 to 15 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: The record longevity in the wild for these animals is 8 years, but they probably live over 15 years (Johnson et al. 1997).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

In late April, American golden plovers engage in what is known as "torpedo runs." This occurs within the first few days of reaching their breeding territory. Males will chase a female while exhibiting a series of winglifts accompanied by trill sounds. The male will separate a female from other members of the group, and will fight off any males who come near. "Torpedo runs" are used both for courtship and as a aggressive maneuver. There is no identifiable difference between chases used in courtship and those used in an aggressive manner.

All male plovers also perform flight songs when first arriving at breeding grounds. These flight songs are used to attract a mate. There are few characterstics that distinguish the flight songs of American golden plovers from those of Pacific golden plovers (P. fulva). However, Pacific golden plovers descend smoothly and softly while American golden plovers decend steeply and quickly. Their song can be recognized because it has four, short tones, and is thought to sound like "clicking." The song is performed quickly and repetitively. Other tundra plovers have less tones in their songs and perform longer, both in tonation and in invervals between tones. All tundra plover species' flights have a common main component called "butterfly flight" in which the male will move his wings in "slow, jerky, and stiff wingbeats."

American golden plovers are monogamous, mating with only one other individual.

Mating System: monogamous

Breeding begins shortly after arriving on breeding territory and eggs are laid a few weeks later. American golden plovers build nests on the Arctic coast in tundra areas. Nests built in areas with lichen are less likely to be destroyed by predators. Nests are built on uniform surroundings that help camouflage the nest. Nests are the smallest built by any tundra plover species. A female lays 1 to 4 eggs (the average is 4) in June. Each egg is large and weighs almost 20% of the female's body weight. The eggs are creme or white in colored with brown and black spots. The eggs hatch 22 to 30 days after being layed. Fledging occurs approximately 22 days after the egg hatches and they become independent soon after. American golden plover hatchlings are sexually mature when they return to breeding grounds the next year.

Each pair will only mate once per season, unless their eggs are lost due to predation or other reasons early in the breeding season. If eggs are lost later in the season, the pair will not breed again. Studies have shown that chicks that hatch early in the season have a better chance of survival (because they have more time to grow and develop before the migration to Rio de la Plata).

Breeding interval: American golden plovers breed once per year.

Breeding season: Breeding occurs in the month of June.

Range eggs per season: 1 to 4.

Average eggs per season: 4.

Range time to hatching: 22 to 30 days.

Average time to hatching: 25-28 days.

Average fledging age: 22 days.

Average time to independence: 22 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

Male and female American golden plovers spend equal amounts of time incubating their eggs and caring for their young. Each parent will spend 12 straight hours incubating the eggs, males during the day and females at night. Little information is available about parental care after hatching, but it appears to be the same as other tundra plovers. After hatching, males tend to spend more time caring for young than females, 48% of males make nest visits when they are "off-duty." Both parents forage in their breeding territory, however males spend more time on breeding territory (at least partially because of the off-duty nest visits). In other tundra plovers, the male continues to spend more time caring for young, and the female may leave before the chicks have left the nest. In cases where females do not leave before the chicks are mature enough be on on their own, both parents provide equally for the chicks until they reach independence. Both males and females protect and care for their eggs, and they decrease the amount of protection they provide for their precocial young once the eggs hatch.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Sibley, D. 2001. The Sibley Guide to Bird Life and Behavior. New York: Alfred A. Knopf, Inc..
  • Sibley, D. 2003. The Sibley Field Guide to Birds of Eastern North America. New York: Alfred A. Knopf, Inc..
  • Sibley, D. 2003. The Sibley Field Guide to Birds of Western North America. New York: Alfred A. Knopf, Inc..
  • Byrkjedal, I. 1998. Tundra Plovers. 24-28 Oval Road, London, NWI 7DX: T & AD Poyser Ltd.
  • Thompson, D., I. Byrkjedal. 2001. Shorebirds. Minnesota: Voyageur Press.
  • Cornell Lab of Ornithology, 2004. "Cornell Lab of Ornthology All About Birds" (On-line). American-Golden Plover. Accessed November 11, 2006 at http://www.birds.cornell.edu/AllAboutBirds/BirdGuide/American_Golden-Plover_dtl.html.
  • National Audubon Society, 2005. "Audubon" (On-line). American-Golden Plover. Accessed November 11, 2006 at http://web1.audubon.org/waterbirds/species.php?speciesCode=amegol&tab=natHistory.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding begins late May in south to early or mid-June in north (Harrison 1978). Usually 4 eggs are incubated (by male during the day, by female at night) for 26 days (Terres 1980). Young are precocial, tended by both adults. Monogamous. Some begin breeding at 1 year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pluvialis dominica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTAATCTTCGGCGCATGAGCCGGTATAGTCGGTACCGCCCTTAGCTTACTCATCCGTGCAGAACTTGGCCAACCAGGTACTCTACTGGGAGACGACCAAATCTATAATGTAATTGTTACTGCCCATGCCTTCGTAATAATCTTCTTCATAGTTATACCAATCATGATTGGGGGTTTCGGAAACTGACTAGTACCACTCATAATTGGTGCCCCCGACATAGCATTTCCCCGCATAAACAACATAAGCTTCTGACTACTTCCCCCATCATTCCTACTCCTCCTTGCCTCCTCCACAGTAGAAGCCGGAGCAGGCACAGGATGAACCGTATACCCCCCTCTAGCCGGTAACCTAGCTCACGCCGGAGCCTCAGTAGACCTGGCTATTTTTTCCCTCCACCTGGCAGGTGTATCTTCAATCCTAGGCGCAATTAACTTCATCACAACCGCCATCAACATAAAACCTCCTGCCCTATCACAATACCAAACTCCTCTATTTGTATGATCCGTCCTCATCACCGCCGTCCTGTTACTCCTTTCACTCCCAGTTCTTGCTGCTGGCATCACTATGCTACTAACAGACCGAAACCTGAACACCACATTCTTCGACCCTGCCGGAGGCGGAGACCCAGTCCTATATCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pluvialis dominica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

American golden plovers have a large migratory range and are not experiencing significant threats to their current population of approximately 150,000 individuals. For these reasons, they are listed as "least concern" on the IUCN Red List and are not identified as at risk by other management agencies.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of P. dominica on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

For centuries, American golden plovers were hunted. In the late 18th century, there was an enormous decline in their numbers due to hunting. In one day it was recorded that 50,000 were killed and sold in a single market. The species became protected in most of the western hemisphere, and was taken off the game list. In addition, much of their wintering range has been protected. American golden plover populations have now rebounded, and are not currently listed as protected.

American golden plovers are important shorebirds in both Argentina and Alaska that attract ecotourism. In addition, they are important research subjects because of their long migrations and migratory patterns.

Positive Impacts: food ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

American Golden Plover

The American Golden Plover (Pluvialis dominica) is a medium-sized plover.

American Golden Plover taking flight.
Note dusky back and axillaries.

Adults are spotted gold and black on the crown, back and wings. Their face and neck are black with a white border; they have a black breast and a dark rump. The legs are black.

It is similar to two other golden plovers, Eurasian and Pacific. The American Golden Plover is smaller, slimmer and relatively longer-legged than European Golden Plover (Pluvialis apricaria) which also has white axillary (armpit) feathers. It is more similar to Pacific Golden Plover (Pluvialis fulva) with which it was once considered conspecific under the name "Lesser Golden Plover".[2] The Pacific Golden Plover is slimmer than the American species, has a shorter primary projection, and longer legs, and is usually yellower on the back.

These birds forage for food on tundra, fields, beaches and tidal flats, usually by sight. They eat insects and crustaceans, also berries.

Scrape nest with four eggs

The breeding habitat of American Golden Plover is Arctic tundra from northern Canada and Alaska. They nest on the ground in a dry open area. They are migratory and winter in southern South America. They follow an elliptical migration path; northbound birds pass through Central America about January–April[3] and stage in great numbers in places like Illinois before their final push north. In fall, they take a more easterly route, flying mostly over the western Atlantic and Caribbean Sea to the wintering grounds in Patagonia. The bird has one of the longest known migratory routes of over 25,000 miles. Of this, 2,400 miles is over open ocean where it cannot stop to feed or drink. It does this from body fat stores that it stocks up on prior to the flight. It is a regular vagrant to western Europe.

A comparison of dates and migratory patterns leads to the conclusion that Eskimo Curlews and American Golden Plovers were the most likely shore birds to have attracted the attention of Christopher Columbus to nearby America in early October 1492, after 65 days at sea out of sight of land.[4]

Large numbers were shot in the late 19th century and the population has never fully recovered.

Footnotes

  1. ^ BirdLife International (2012). "Pluvialis dominica". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Reviewed in Sangster et al. (2002).
  3. ^ Strewe & Navarro (2004), Herrera et al. (2006)
  4. ^ J.B. Gollop, T.W. Barry, & E.H. Iversen (1986). "Eskimo Curlew - A vanishing species? : The Eskimo Curlew's Year - Introduction to Oceanic Migration". Nature Saskatchewan & United States Geological Survey. Retrieved 2007-12-22. 

References

  • Hayman, Peter; Marchant, John & Prater, Tony (1986): Shorebirds: an identification guide to the waders of the world. Houghton Mifflin, Boston. ISBN 0-395-60237-8
  • Herrera, Néstor; Rivera, Roberto; Ibarra Portillo, Ricardo & Rodríguez, Wilfredo (2006): Nuevos registros para la avifauna de El Salvador. ["New records for the avifauna of El Salvador"]. Boletín de la Sociedad Antioqueña de Ornitología 16(2): 1-19. [Spanish with English abstract] PDF fulltext
  • Sangster, George; Knox, Alan G.; Helbig, Andreas J. & Parkin, David T. (2002): Taxonomic recommendations for European birds. Ibis 144(1): 153–159. doi:10.1046/j.0019-1019.2001.00026.x PDF fulltext
  • Strewe, Ralf & Navarro, Cristobal (2004): New and noteworthy records of birds from the Sierra Nevada de Santa Marta region, north-eastern Colombia. Bull. B.O.C. 124(1): 38-51. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Pluvialis dominica and P. fulva formerly were regarded as conspecific (P. dominica). Connors et al. (1993) documented clear and consistent differences in breeding vocalizations and nesting habitat, and strict assortative mating in areas of sympatry in western Alaska; they concluded that P. dominica and P. fulva are distinct species. Sibley and Monroe (1990) and AOU (1993) also treated these taxa as separate species. See AOU (1995) for explanation of change in spelling of specific name from dominica to dominicus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!