Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Golden plovers have beautiful plumage: a golden speckled back with a black belly. In the winter, they lose their black belly and have a much drabbier appearance. Golden plovers nest in open terrains in the high north. The males perform a collective dance in order to attract a female. They run towards each other with their wings spread open, jump over one another. The female chooses the best jumper. You see golden plovers in the Netherlands primarily during bird migration. This bird is responsible for the start of the Guinness Book of Records!
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

incidental visitor to Newfoundland during the spring
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is fully migratory but may only move short distances in some regions (del Hoyo et al. 1996). It breeds from May to August (Hayman et al. 1986) in solitary pairs (Hayman et al. 1986, del Hoyo et al. 1996), adults leaving the breeding grounds before the juveniles between July and August (Hayman et al. 1986). The return migration in the spring peaks between April and early-May (Hayman et al. 1986). The species feeds in small flocks during the breeding season, but on passage and in winter feeding flocks of tens to thousands of individuals may occur (Hayman et al. 1986, Urban et al. 1986, del Hoyo et al. 1996). Habitat Breeding The species breeds on humid moss, lichen and hummock tundra (del Hoyo et al. 1996), low-lying marshes in moss tundra (Johnsgard 1981), shrub tundra, open bogs in forest, peatlands, alpine tundra (del Hoyo et al. 1996), highland bogs , moors (Johnsgard 1981), and swampy highland heaths with high abundances of sphagnum moss and heather (Johnsgard 1981, del Hoyo et al. 1996). It shows a preference for nesting on short vegetation less than 15 cm tall (Ratcliffe 1977). Non-breeding When on passage and in its winter quarters (del Hoyo et al. 1996) the species frequents freshwater wetlands (Urban et al. 1986), moist grasslands (Urban et al. 1986), pastures (del Hoyo et al. 1996), agricultural land (e.g. stubble, ploughed or fallow fields) (Urban et al. 1986, del Hoyo et al. 1996) and highland steppe (Urban et al. 1986), also foraging on tidal shores, coastal rocky outcrops (Johnsgard 1981), intertidal flats (del Hoyo et al. 1996) and saltmarshes (Urban et al. 1986, del Hoyo et al. 1996) in shallow bays and estuaries (del Hoyo et al. 1996). Diet Its diet consists predominantly of insects (especially the adults, pupae and larvae of beetles (del Hoyo et al. 1996), larval Lepidoptera, locusts and grasshoppers (Urban et al. 1986)), as well as earthworms, spiders, millipedes, snails, polycheate worms (del Hoyo et al. 1996), crustaceans (Johnsgard 1981) and some plant material (e.g. berries, seeds and grass) (del Hoyo et al. 1996). Breeding site The nest is a shallow scrape on bare ground in flat, sparse areas with short vegetation (less than 15 cm) (del Hoyo et al. 1996). The species is a solitary nester, although in optimal habitats neighbouring pairs may nest only a few hundred metres apart (del Hoyo et al. 1996). Management information Extensive grazing of wetland grasslands (e.g. c.0.5 cows per hectare) was found to attract a higher abundance of the species in Hungary (Baldi et al. 2005), and in the UK the species shows a preference for nesting on heathlands and moors managed by rotational burning (a management strategy used to encourage grouse) as this keeps the vegetation short and prevents grasses from being displaced by heathers (Ratcliffe 1977, Johnsgard 1981).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 21 specimens in 1 taxon.
Water temperature and chemistry ranges based on 16 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.483 - 11.796
  Nitrate (umol/L): 1.402 - 16.868
  Salinity (PPS): 31.982 - 35.245
  Oxygen (ml/l): 6.196 - 6.609
  Phosphate (umol/l): 0.321 - 0.890
  Silicate (umol/l): 0.987 - 11.419

Graphical representation

Temperature range (°C): 9.483 - 11.796

Nitrate (umol/L): 1.402 - 16.868

Salinity (PPS): 31.982 - 35.245

Oxygen (ml/l): 6.196 - 6.609

Phosphate (umol/l): 0.321 - 0.890

Silicate (umol/l): 0.987 - 11.419
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Pluvialis apricaria (Pluvialis apricaria golden plover) preys on:
Nereis diversicolor
Corophium volutator
Gammarus
Hydrobia ulvae

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 12.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pluvialis apricaria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCCAACCACAAAGACATTGGCACCCTATACCTAATCTTCGGCGCATGAGCCGGTATAGTCGGCACCGCCCTTAGCTTACTCATCCGTGCAGAACTTGGCCAACCAGGTACCCTACTAGGAGACGACCAAATCTACAATGTAATTGTTACTGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATCATGATTGGAGGCTTCGGAAACTGACTAGTACCACTCATAATTGGTGCCCCCGACATAGCATTTCCCCGCATAAACAACATGAGCTTCTGACTACTCCCCCCATCATTCCTACTTCTCCTTGCCTCCTCCACAGTAGAAGCCGGAGCAGGCACAGGATGAACCGTATACCCCCCTCTAGCTGGCAACCTAGCTCACGCCGGAGCCTCAGTAGACCTGGCCATTTTTTCCCTCCATCTAGCAGGTGTATCCTCAATCCTAGGTGCAATCAACTTCATTACAACCGCCATCAACATAAAACCCCCTGCCCTATCACAATACCAAACTCCCCTATTTGTATGGTCCGTCCTCATCACTGCCGTCCTACTGCTCCTTTCACTCCCAGTTCTTGCCGCTGGCATCACCATGCTACTAACAGACCGAAACCTAAACACTACATTCTTCGACCCTGCCGGAGGCGGAGACCCAGTCCTATATCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATTCTAATCCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pluvialis apricaria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species has suffered minor range contractions due to the cultivation and afforestation of heathlands (Ratcliffe 1977, del Hoyo et al. 1996), and is susceptible to very cold winter temperatures and severe weather conditions (Ratcliffe 1977). Utilisation The species is frequently taken by hunters on its wintering grounds (e.g. France) (del Hoyo et al. 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

European golden plover

The European golden plover (Pluvialis apricaria), also known as the Eurasian golden plover or just the golden plover within Europe, is a largish plover. This species is similar to two other golden plovers. American golden plover, Pluvialis dominiica, and Pacific golden plover, Pluvialis fulva, are both smaller, slimmer and relatively longer-legged than European golden plover, and both have grey rather than white axillary feathers (only properly visible in flight).

Protection[edit]

The European golden plover is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Origin of Guinness World Records[edit]

On 10 November 1951, Sir Hugh Beaver, then the managing director of the Guinness Breweries,[2] went on a shooting party in the North Slob, by the River Slaney in County Wexford, Ireland. After missing a shot at a Eurasian golden plover, he became involved in an argument over which was the fastest game bird in Europe, the golden plover or the red grouse (the former being correct).[3] That evening at Castlebridge House, he realised that it was impossible to confirm in reference books whether or not the golden plover was Europe's fastest game bird.[4][5] Beaver knew that there must be numerous other questions debated nightly in pubs throughout Ireland, but there was no book in the world with which to settle arguments about records. He realised then that a book supplying the answers to this sort of question might prove popular.[6] Later, he published the first Guinness World Records.

References[edit]

  1. ^ BirdLife International (2012). "Pluvialis apricaria". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "The History of the Book". Guinness Record Book Collecting. Retrieved 2012-02-10. 
  3. ^ Fionn Davenport (2010). Ireland. Lonely Planet. p. 193. ISBN 9781742203508. 
  4. ^ "Early history of Guinness World Records". 2005. p. 2. [dead link]
  5. ^ Cavendish, Richard (August 2005). "Publication of the Guinness Book of Records: 27 August 1955". History Today 55. 
  6. ^ Guinness World Records 2005. Guinness; 50th Anniversary edition. 2004. p. 6. ISBN 1892051222. 
  • Tomek, T. & Bocheński, Z. (2005). Weichselian and Holocene bird remains from Komarowa Cave, Central Poland. Acta Zoologica Cracoviensia, 48A(1-2), 43-65. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!