Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Brief Summary

Charadrius vociferus

Resembling a much larger Semipalmated Plover (Charadrius semipalmatus), the Killdeer is most easily identified by its size (9-11 inches), brown back, two black breast bands, and orange-brown rump. Other field marks include its gray-green legs, black bill, and red eye ring. Male and female Killdeers are similar to one another in all seasons. The Killdeer breeds across the United States and southern Canada. Birds breeding in coastal areas and in the interior south are non-migratory, while birds breeding further north migrate south to Central America in winter. Other non-migratory populations occur in Mexico, Peru, and the West Indies. Less associated with water than most of its relatives, the Killdeer inhabits a number of open habitat types, including grasslands, mudflats, and gravel deposits. Also utilizes numerous man-made environments, such as fields, golf courses, and airports. The Killdeer eats small invertebrates, primarily worms and insects, but may consume plant matter when prey is scarce. Killdeers may be most easily observed while foraging for food, when it may be seen probing the soil with their bills or running across the surface to catch prey. Nesting Killdeer may also be observed feigning broken wings to lure intruders away from the nest site. This species is mainly active during the day, but frequently feeds at night when insects are plentiful.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Killdeer are native to the Nearctic and Neotropical regions. They can be found over much of North America and in parts of South America. From the Gulf of Alaska coastline the range extends southward throughout the United States and reaches the Atlantic and Pacific coasts. Distribution continues through the Nearctic zone and into South America, runs along the Andes Mountain Range and terminates at the southern border of Peru.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Hayman, P., J. Marchant, P. Tony. 1986. Shorebirds. An Identification Guide to the Waders of the World. Boston: Houghton Mifflin Co.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Nesting range extends from eastern Alaska east across Canada (through northern Saskatchewan and southern Hudson Bay region) to Newfoundland, south to southern Baja California, central Mexico, Gulf of Mexico coast of the southeastern United States, southern Florida, West Indies, and, disjunctly, in Costa Rica and western South America (coastal Peru, extreme northwestern Chile, and southwestern Ecuador) (Stiles and Skutch 1989, AOU 1998, Jackson and Jackson 2000).

During the northern winter, the range extends from southeastern Alaska (rarely), southern British Columbia, central United States, and New England south to the West Indies and northern South America (west of Andes to western Ecuador and east to northern Venezuela, and in the breeding range in Peru and Chile). This species sometimes shows up in Europe, Hawaii, and elsewhere outside the primary range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Gulf of Maine, Gulf of Mexico, North West Atlantic, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Killdeer are native to the Nearctic and Neotropical regions. They can be found over much of North America and parts of South America. Starting from the Gulf of Alaska coastline, the range extends south throughout the United States and reaches the Atlantic and Pacific coasts. They can also be found into South America along the Andes Mountain Range to the southern border of Peru.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Hayman, P., J. Marchant, P. Tony. 1986. Shorebirds. An Identification Guide to the Waders of the World. Boston: Houghton Mifflin Co.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America; range extends from Southern Labrador to coastal Peru
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Killdeer are medium-sized shorebirds. They range from 23 to 27 cm long and have an average wingspan of 17.5 cm. They are most easily recognized by the two dark bands on their upper breast that look like necklaces. The upper band completely circles their neck. They have another dark band around their head, which goes across their face and along the forehead and above the bill. Killdeer are grayish-brown on their backs and head, and have a bright white chest, belly and neck. They have long, pointed bills that they use for probing the ground for insects and other invertebrates.

Male and female killdeer look about the same, though breeding females may have more brown on their face than males. Young killdeer look similar to adults, but their feathers have buff-colored edges.

Range length: 23 to 27 cm.

Range wingspan: 17.5 (low) cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: sexes alike

Average mass: 88 g.

  • 1987. National Geographic Society. Field Guide to the Birds of North America. Washington, D.C.: National Geographic Society.
  • Jackson, B., J. Jackson. 2000. Killdeer (Charadrius_vociferus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 517. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Adult killdeer reach a length ranging between 23-27cm, with an average wingspan of 17.5 cm. Distinguishing characteristics include a dark, double-banded breast, with the top band completely encircling the upper body/breast. Another band is located at the head, resembling a mask absent of the facial portion. The band is continuous, thinning while going across the face along the forehead region and above the bill, and thickening at the supercilium; extending around the eye and onward around the back of the head. Plumage is relatively absent of complexity with the exception of a vividly colored, reddish-orange rump that is visible during flight and behavioral displays. The rest the body consists of a grayish-brown coloration along the dorsal side, crown and nape, while the ventral region is white. Characteristic of species in the same order, C. vociferus possess a lengthened tarsus and a pointed, extended bill, suitable for its foraging habits.

Male and female killdeer are similar in appearance, though breeding females may have additional brown on their face. Juvenile killdeer are similar in appearance to adults, with the exception of buffed fringes and the (uncommon) presence of tail-down.

There are three recognized subspecies of Charadrius vociferus. These subspecies are differentiated on the basis of differences in coloration and pattern of rufous edgings on their back and wing coverts.

Range length: 23 to 27 cm.

Range wingspan: 17.5 (low) cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: sexes alike

Average mass: 88 g.

  • 1987. National Geographic Society. Field Guide to the Birds of North America. Washington, D.C.: National Geographic Society.
  • Jackson, B., J. Jackson. 2000. Killdeer (Charadrius vociferus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 517. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 27 cm

Weight: 101 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Killdeer live in a variety of habitats, including savannas, coniferous forests, and deciduous forest regions. They can live in many different terrain types including shorelines, savannas, and high altitude regions, but they prefer open areas, such as sandbars, mudflats and pastures.

Temperature is the most important factor that determines where killdeer can live. Killdeer remain in the same area year-round, migrating only when temperature becomes extremely cold (about 10 degrees Celsius and below). They are able to adapt to changes in the climate and in their environment. Because of this, they have been able to successfully live in human environments such as parks and farms.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: taiga ; savanna or grassland ; forest

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Root, T. 1988. Atlas of Wintering North American Birds: An Analysis of Christmas Bird Count Data. Chicago: The University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Killdeer live in terrestrial biomes including savannas, taiga and deciduous forest regions, preferring open areas within these biomes, especially sandbars, mudflats and pastures. Their preferred topographical features range greatly (shorelines, savannas, high altitude regions), with temperature being the critical factor of environment choice. With its large year-round distribution range (and as a result, a small wintering range), C. vociferus remain within their habitats year-round, migrating only when temperature becomes extremely cold, which for the killdeer, is approximately 10 degrees Celsius and below. Killdeer are highly adaptive to climate and environmental variations, and as a consequence, have effectively settled into human altered environments including parks and agricultural zones.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: taiga ; savanna or grassland ; forest

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Root, T. 1988. Atlas of Wintering North American Birds: An Analysis of Christmas Bird Count Data. Chicago: The University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 39 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Habitat includes various open areas such as fields, meadows, lawns, pastures, mudflats, and shores of lakes, ponds, rivers, and seacoasts (AOU 1983). Nests are on the ground ground in open dry or gravelly situations, sometimes in similar situations on roofs, driveways, etc.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

This species is described as a medium distance partial migrant, but its seasonal movements are complex and not well understood (Jackson and Jackson 2000). Migrants arrive in northernmost breeding areas in March-April, depart by September-October (Bent 1929). In Puerto Rico, resident populations are augmented by North American migrants fall-spring (Raffaele 1983). Migrants arrive in Costa Rica in late August-September, depart in April-May (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Killdeers' primary diet consists of various invertebrates, specifically Insecta and Malacostraca from both land and the water, but they can be considered omnivorous since berries are known to be included in their diet.

Killdeer obtain water by drinking it from standing pools or running water sources.

Animal Foods: insects; aquatic crustaceans

Plant Foods: fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Charadrius vociferus can be considered omnivorous since berries are known to be included within the diet. Primarily though, the diet consists of various aquatic and terrestrial invertebrates, insects and crustaceans.

Animal Foods: insects; aquatic crustaceans

Plant Foods: fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet includes small invertebrates obtained from ground surface, sometimes in shallow water (Terres 1980).`

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Killdeer affect the populations of the insects and crustaceans they eat. They also provide a valuable source of food for their predators. Killdeer also host at least 13 different species of parasites.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Killdeer adults, chicks and eggs are vulnerable to predation by many different predators, including Falconiformes, Larus, Corvus  Serpentes, Vulpes vulpes, Canis latrans, Felis silvestris, Canis lupus familiaris, Procyon lotor, Mephitis mephitis and Didelphis virginiana.

When predators come near a killdeer nest, the adults try to draw the predator away by pretending to be injured. They pretend that their wing is broken, and they hobble away from the nest, hoping that the predator will follow. After they have drawn the predator far enough away from the nest, the killdeer flies away to safety.

Known Predators:

  • birds of prey (Falconiformes)
  • gulls (Larus)
  • crows and ravens (Corvus)
  • snakes (Serpentes)
  • red foxes (Vulpes_vulpes)
  • coyotes (Canis_latrans)
  • domestic cats (Felis_silvestris)
  • domestic dogs (Canis_lupus_familiaris)
  • raccoons (Procyon_lotor)
  • striped skunks (Mephitis_mephitis)
  • Virginia opossums (Didelphis_virginiana)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Killdeer affect the populations of the insects and crustaceans they eat. They also provide a valuable source of food for their predators. Killdeer also host at least 13 different species of parasites.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Killdeer adults, chicks and eggs are vulnerable to predation by a wide assortment of predators. These include birds of prey, gulls, crows and ravens  snakes, foxes, coyotes, domestic cats, domestic dogs, raccoons, skunks and Virginia opossums.

Killdeers typically try to draw predators that come near the nest by distracting them. An adult killdeer sitting on eggs will lie still during the approach of an intruder. When the intruder comes too near, the adult will leave the nest and perform an "injured bird" routine, hobbling away and dragging its wings. After drawing the unwelcome visitor far enough from the nest, the adult killdeer takes off in flight and eludes the potential danger.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Charadrius vociferus (killdeer) is prey of:
Buteo swainsoni

Based on studies in:
USA: California, Cabrillo Point (Grassland)

This list may not be complete but is based on published studies.
  • L. D. Harris and L. Paur, A quantitative food web analysis of a shortgrass community, Technical Report No. 154, Grassland Biome. U.S. International Biological Program (1972), from p. 17.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a very large number of occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Morrison et al. (2001) estimated a total population of 1,000,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Nesting density in several different areas was 13-30 pairs per hectare. Relatively isolated nesting of single pairs also occurs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Killdeer communicate using vocalizations and physical displays. Their common name comes from the loud, piercing "kill-dee(r)" call. Killdeer calls often serve as an alert system for other individuals, including animals of different species.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Killdeer communicate using vocalizations and physical displays. Their common name comes from the loud, piercing "kill-dee(r)" call. Killdeer calls often serve as an alert system for other individuals, including animals of different species.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Sometimes activity occurs on moonlit nights (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest known wild killdeer lived at least 10 years and 11 months.

Range lifespan

Status: wild:
12 (high) years.

Average lifespan

Status: wild:
131 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

The oldest known wild killdeer lived at least 10 years and 11 months.

Range lifespan

Status: wild:
12 (high) years.

Average lifespan

Status: wild:
131 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Killdeer are monogamous (one male mates with one female). Breeding pairs form on the breeding grounds in the spring. Male killdeer claim a nesting territory and then try to attract a female by performing flight displays and singing. Pairs that do not migrate may remain together year-round, and may even breed together for several years.

Mating System: monogamous

Killdeer usually begin breeding in early spring. This can be as early as March in the southern United States, to as late as June in central Canada. Killdeer that breed in the Caribbean and Mexico can nest year-round. In northern areas, killdeer only raise one brood per season, though they may lay up to three broods of eggs. However, in the southern U.S., killdeer often raise two broods of chicks in one summer.

The male and female work together to "build" their nest. The nest is just a shallow depression that they scrape out of the ground. Their nests are usually built in open areas with very little vegetation, often in farm fields, on road shoulders, in parking lots and on flat graveled rooftops. Females lay about 4 eggs, which both parents incubate for 24 to 28 days. The chicks are precocial at hatching; they are covered in down and are able to walk soon after hatching. Unlike most birds, killdeer parents do not feed their chicks. Instead, after the last egg has hatched, they lead the chicks to a feeding area. The chicks stay with the parents until they are able to fly. This happens when they are 20 to 31 days old. These chicks become mature and may breed the next spring.

Breeding interval: In the northern part of their range, killdeer breed once per year, raising one to two broods per season. In the southern part of their breeding range, killdeer can breed year-round.

Breeding season: Killdeer usually begin breeding in early spring, depending on their location. Nesting may begin as early as March in the southern United States, to as late as June in central Canada. In the Caribbean and Mexico, killdeer can nest year-round.

Range eggs per season: 2 to 6.

Range time to hatching: 24 to 28 days.

Range fledging age: 3 to 24 days.

Range time to independence: 20 to 31 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

The male and female both build the nest and incubate the eggs. Unlike most birds, killdeer parents do not feed their chicks in the nest. Instead, they lead the chicks to a feeding area soon after they have hatched. The chicks stay with the parents until they are able to fly.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Protecting: Male, Female); pre-independence (Protecting: Male, Female)

  • 1985. Plovers and Sandpipers. Pp. 160-177 in The Encyclopedia of Birds. New York: Facts on File, Inc.
  • 2000. "New Hampshire Public Television" (On-line). Accessed September 2000 at http://www.nhptv.org/natureworks/killdeer.htm.
  • 2000. "United States Geological Survey" (On-line). Accessed Sept. 2000 at http://www.mbr-pwrc.usgs.gov/id/mlist/h2730.html.
  • Jackson, B., J. Jackson. 2000. Killdeer (Charadrius_vociferus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 517. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Killdeer are monogamous. Breeding pairs form on the breeding grounds in the spring. Male killdeer claim a territory in which to nest, and then attempt to attract a mate using aerial displays and a series of two-noted calls. Non-migratory breeding pairs may remain together year-round, and may breed together for several years.

Mating System: monogamous

Killdeer usually begin breeding in early spring, depending on their location. Nesting may begin as early as March in the southern United States, to as late as June in central Canada. In the Caribbean, killdeer can nest year-round. In most temperate localities, killdeer may lay up to three broods per season, but most often only raise one brood successfully. However, in the southern part of their range, successful hatching of two broods may be common.

The male and female work together to "build" their nest, which is simply a depression scraped into the bare earth, or other substrate. Nests are typically located in open areas with sparse vegetation, often in farm fields, road shoulders, parking lots and flat graveled rooftops. Females lay an average clutch of 4 eggs, though the clutch may be as few as 2 eggs and as many as 6. Eggs are incubated for 24 to 28 days, with both parents performing this duty. The chicks are precocial at hatching; they are down-covered and active, and are able to leave the nest soon after their down dries. Unlike most birds, killdeers do not feed their chicks in the nest. Soon after hatching, the parents lead the chicks to a feeding area. The chicks remain with the parents until they are able to fly, 20 to 31 days after hatching. They are able to breed the next year.

Breeding interval: In the northern part of their range, killdeer breed once per year, raising one to two broods per season. In the southern part of their breeding range, killdeer can breed year-round.

Breeding season: Killdeer usually begin breeding in early spring, depending on their location. Nesting may begin as early as March in the southern United States, to as late as June in central Canada. In the Caribbean and Mexico, killdeer can nest year-round.

Range eggs per season: 2 to 6.

Range time to hatching: 24 to 28 days.

Range fledging age: 3 to 24 days.

Range time to independence: 20 to 31 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

Both members of a killdeer breeding pair participate in nest preparation and incubation. Unlike most birds, killdeer parents do not feed their chicks in the nest. Instead, after the last egg has hatched, they lead the chicks to a feeding area. The chicks stay with the parents until they are able to fly.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Protecting: Male, Female); pre-independence (Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nesting phenology varies geographically, with egg laying beginning in March in the southern United States and in April in the north. First clutches are laid around early March in Mississippi, mid-March in North Carolina and Maryland, late March in Pennsylvania, mid- to late March in northeastern California, mid-April in Washington State and Minnesota, and late April in northern Michigan. Active nests may be found as late as July in the north, and late summer and fall nesting sometimes occurs in the southern United States. Clutch size is 3-5 (usually 4). Incubation averages 24-30 days, by both sexes (female may desert second clutch in some areas). Young are tended by both parents, first fly at about 25 days. Sometimes a female produces two broods in a single season. Both sexes may breed at an age of one year.

In hot conditions, adult killdeer sometimes dip their breast-feathers in water, return to the nest, and apply the water to the eggs. Presumably this cools the eggs through conduction and evaporation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Charadrius vociferus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTCTCAACTAACCACAAAGACATCGGCACCCTATACCTAATCTTTGGCGCATGAGCCGGTATAGTCGGTACAGCCCTCAGCTTACTTATCCGCGCAGAACTAGGCCAACCAGGAACCCTCCTAGGAGAC---GACCAAATCTATAACGTAATTGTCACCGCCCACGCTTTCGTAATAATCTTTTTCATAGTCATGCCAATCATAATCGGCGGCTTCGGCAACTGACTAGTCCCACTGATAATTGGTGCACCGGACATAGCATTCCCCCGCATAAATAACATAAGCTTCTGACTACTTCCTCCATCATTTTTACTTCTTCTAGCCTCTTCTACAGTCGAAGCAGGAGCAGGTACCGGATGAACCGTTTACCCGCCTCTAGCTGGCAACCTAGCACACGCTGGAGCATCAGTAGACCTAGCCATCTTCTCACTTCACCTAGCAGGTGTCTCCTCTATCCTAGGCGCAATCAACTTCATCACAACCGCCATCAACATAAAACCACCTGCCCTCTCACAATACCAAACTCCCCTATTCGTCTGATCCGTACTTATCACCGCTGTTCTATTACTCCTCTCACTTCCAGTCCTCGCTGCAGGCATCACCATGCTACTAACAGACCGAAATCTGAACACTACATTCTTCGATCCTGCTGGAGGAGGTGACCCAGTCCTGTACCAACATCTCTTTTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCTTACCAGGATTTGGAATCATCTCCCACGTAGTAACATACTACGCAGGTAAAAAAGAGCCATTCGGCTATATAGGAATAGTTTGAGCCATACTATCAATCGGATTCCTAGGCTTCATTGTTTGAGCCCACCACATATTCACCGTAGAAATGGACGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Charadrius vociferus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Killdeer are neither endangered nor threatened. However, they are protected under the U.S. Migratory Bird Act.

Killdeer have adapted well to many of the habitats created by humans. Because of this, they are a very common species. There are about 1,000,000 killdeer in the world.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Killdeer are neither endangered nor threatened according any of the organizations involved with biodiversity and conservation. They are, however, protected under the U.S. Migratory Bird Act.

Killdeer are highly adaptable and able to thrive in many human-altered habitats. Because of this, they are a very common species, with an estimated worldwide population of 1,000,000 individuals.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range; large population size; many subpopulations; nesting range expanded historically into many human-altered habitats, but Breeding Bird Survey data indicate a slow decline in recent decades.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Total regarded as a minimum by Wetlands International (2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Breeding Bird Survey (BBS) data indicate a significant survey-wide decline of 1.1 percent per year for 1980-2007; this rate of decline amounts to a 10 percent decline over 10 years, but BBS abundance was relatively stable during 2000-2007.

Global Long Term Trend: Unknown

Comments: Long-term trend (last 200 years) in abundance is unknown, but as a result of forest clearing the range extent and area of occupancy undoubtedly are much larger now than in the past. Mortality from hunting likely offset this to some degree along the Atlantic coast. In the twentieth century, the breeding range expanded northward in Canda and southward in the southeastern United States (see Jackson and Jackson 2000).

Breeding Bird Survey (BBS) data indicate a significant survey-wide decline of 0.6 percent per year for 1966-2007; this amounts to a 22 percent decline over this time period. Abundance declined from an average of roughly 5-6 birds per route in the 1970s and early 1980s to an average of 4.5-4.7 birds per route by the 2000s.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Formerly this species was shot in apparently large numbers, especially along the Atlantic coast in the late 1890s and early 1900s, and populations evidently declined (Jackson and Jackson 2000).

Locally, pesticides and other contaminants likely have detrimentally affected killdeer populations (see Jackson and Jackson 2000).

This ground-nesting species often nests in the vicinity of human activities, and many nests are destroyed as a result. Cats, dogs, and populations of native predators that have benefited from anthropogenic food resources probably are significant sources of mortality.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of killdeer on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Any economic/agricultural contribution from killdeer is most likely the result of their ability to control crop pests. Since insects comprise a large majority of the their diet, killdeer eat pests such as mosquitoes, ticks, and locusts.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of killdeer on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Any economic/agricultural contribution from killdeer is most likely the result of their ability to control crop pests. Since insects comprise a large majority of the their diet, killdeer eat pests such as mosquitoes, ticks, and locusts.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Killdeer

The Killdeer (Charadrius vociferus) is a medium-sized plover.

The adults have a brown back and wings, a white belly, and a white breast with two black bands. The rump is tawny orange. The face and cap are brown with a white forehead. The eyering orange-red. The chicks are patterned almost identically to the adults, and are precocial — able to move around immediately after hatching. The Killdeer frequently uses a "broken wing act" to distract predators from the nest. It is named onomatopoeically after its call.[2]

Contents

Nesting

Eggs in a nest on the ground
Parent protecting small chicks by performing a distraction display to draw attention to itself away from the nest

The range of the Killdeer spreads across the Western Hemisphere. In the summer, Killdeer live as far north as the Canadian provinces of British Columbia, the Yukon and Quebec, as well as the southern parts of the U.S. state of Alaska. Killdeer hold a year-round presence across the southern half of the United States and parts of Peru. The Killdeer winters throughout Central America.[3] Although Killdeer are considered shorebirds, they often live far from water. They live in grassland habitats such as fields, meadows, and pastures.[4] The nest itself is merely a shallow depression or bowl in the ground, fringed by some stones and blades of grass.[5] The nest is well camouflaged, as the spots of the eggs disguise them as stones, and the simple structure of the nest resembles its surroundings.[6] Like many other waders, Killdeer hatchlings are precocial birds and are able to see and forage soon after hatching.[6]

Behavior

They are migratory in northern areas and winter as far south as northern South America. They are rare vagrants to western Europe, usually late in the year.

These birds forage for food in fields, mudflats, and shores, usually by sight. They mainly eat insects.

Their name comes from their frequently heard call. These birds will frequently use a distraction display ("broken-wing act") to distract predators from their nests. This involves the bird walking away from its nesting area holding its wing in a position that simulates an injury and then flapping around on the ground emitting a distress call. The predators then think they have easy prey and are attracted to this seemingly injured bird and away from the nest. If the parent sees that a potential predator is not following them, they will move closer and get louder until they get the attention of the predator. This is repeated until the predator is far from the nest, and the killdeer suddenly "heals" and flies away.[5][7]

Their ability to exploit a wide range of agricultural and semi-urban habitat has helped keep them common and widespread in their range.


Gallery

References

  1. ^ BirdLife International (2012). "Charadrius vociferus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Online Etymology Dictionary, Douglas Harper
  3. ^ "Killdeer Range Map". U.S. Geological Survey. Retrieved 2011-03-11
  4. ^ Loftin, Robert W. (2003). "Killdeer Charadrius vociferus". Florida Fish and Wildlife Conservation Commission. Retrieved 2011-03-01. 
  5. ^ a b Hiller, Ilo (2008). "Killdeer". Texas Parks and Wildlife Department. Retrieved 2011-03-01. 
  6. ^ a b Porter, Diane (1997). "The Precocious Killdeer". Birdwatching.com. Retrieved 2010-05-28. 
  7. ^ "Killdeer". Ohio Department of Natural Resources. Retrieved 2011-3-1.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!