Articles on this page are available in 2 other languages: Chinese (Simplified) (6), Dutch (1) (learn more)

Overview

Brief Summary

A small masked dumpy looking bird is a good description of the ringed plover. However, just like the lapwing, it is a master at distracting enemies away from its simple nest by pretending to be an easy prey. Ringed plovers may be small but they are also bold and venturous. They dribble back and forth over the bare sandy ground, pulling worms and larvae out of the ground. They like to nest on sandy bottoms covered with shells or pebbles. You'll even find them on the pebbly roofs of apartment buildings. Their nest is not much more than a hollow in the sand, in which their four perfectly camouflaged eggs are laid.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: Northern Palearctic from Greenland, Iceland, Faroe Islands, and Scandinavia east through northern Russia and northern Siberia to the Chutkotski Peninsula, Anadyrland, and the Sea of Okhotsk; western Alaska (St. Lawrence Island); Ellesmere, Bylot, and eastern Baffin islands. NON-BREEDING: western and southern Europe and southern and eastern Asia south to southern Africa and Australia (Sibley and Monroe 1990, AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 19 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Length: 18-20 cm. Plumage: above dark greyish brown; below white; forehead and superciliary stripe white, collar around neck white; crown and cheeks brown; breast band, line through eye and over forehead black in breeding and dark brown in non-breeding adult. White at base of flight feathers in spread wing. Immature like adult but with pale edges to feathers of back; breast band paler and broken; brown on face paler than adult. Bare parts: iris brown; bill orange-yellow with a black tip; feet and legs bright orange-yellow (diagnostic). Habitat: sandy, muddy or rocky shores of estuaries, marine and inland waters. Palearctic migrant. <389><391><393>
  • Urban, E.K., C.H. Fry & S. Keith (1986). The Birds of Africa, Volume II. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Sandy areas with scattered low vegatation, farmlands, grassy tundra. In migration: mudflats, beaches, and shores of lakes, ponds, and rivers (Sibley and Monroe 1990, AOU 1983). Eggs are laid in depressions in sand or on pebbles or other material of beach, above high-water mark on seashore or sometimes on bare or shingly areas away from the seashore. Nest may be in the open but often is near or sheltered by a plant tuft. In British Isles, some nest in grain fields several miles from the sea (Terres 1980, Harrison 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour The majority of this species is fully migratory (del Hoyo et al. 1996, Hockey et al. 2005) and travels either on a broad or narrow front depending on the location of each population's breeding and wintering grounds (del Hoyo et al. 1996). The species starts to breed from April until June, nesting in solitary pairs or loose semi-colonial groups (especially in undisturbed areas) (del Hoyo et al. 1996). It is a gregarious species (Hayman et al. 1986) and often roosts communally in flocks of several hundred close to its feeding areas (Hayman et al. 1986, del Hoyo et al. 1996), occurring singly, in small (up to 50 individuals) or large flocks (up to 1,200-1,500 individuals) during the non-breeding season (Urban et al. 1986). Habitat Breeding The species breeds primarily on sand or shingle beaches either along the Arctic coast (Hayman et al. 1986, del Hoyo et al. 1996, Snow and Perrins 1998) or around coastal tundra pools or lakes (Johnsgard 1981). In the south of its range it may also breed inland on the Arctic tundra (Hayman et al. 1986, del Hoyo et al. 1996) on muddy plains with stones or pebbles (Johnsgard 1981), on shores and sandbars of inland rivers, lakes, gravel pits or reservoirs (Hayman et al. 1986, del Hoyo et al. 1996, Snow and Perrins 1998), or on short grassland, farmland (del Hoyo et al. 1996, Snow and Perrins 1998) and other well-drained sites (Snow and Perrins 1998). Non-breeding Outside of the breeding season the species inhabits muddy, sandy or pebbly coasts in the tropics and subtropics (Johnsgard 1981) including estuaries (del Hoyo et al. 1996), tidal mudflats, sandflats and exposed coral reefs (Urban et al. 1986). It also frequents mudbanks or sandbanks along rivers and lakes (Urban et al. 1986), lagoons, saltmarshes, short grassland, farmland, flooded fields, gravel pits, reservoirs (del Hoyo et al. 1996), sewage works and saltpans during this season (Hockey et al. 2005). Diet Its diet consists of small crustaceans, molluscs, polycheate worms, isopods, amphipods, insects (e.g. ants, beetles, flies and fly larvae) and millipedes (del Hoyo et al. 1996). Breeding site The nest is a shallow scrape (del Hoyo et al. 1996) positioned near the high-water mark on shingle or sandy beaches (Johnsgard 1981, Hayman et al. 1986). The species is a solitary nester although it may breed at quite high densities in undisturbed areas, neighbouring nests spaced between 5 and 100 m apart (del Hoyo et al. 1996). Management information Removing feral American mink Neovison vison from a large archipelago with many small islands in the Baltic Sea resulted in an increase in the breeding density of this species in the area (Nordstrom et al. 2003).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 18 specimens in 2 taxa.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 8.094 - 12.604
  Nitrate (umol/L): 1.473 - 9.099
  Salinity (PPS): 34.813 - 35.293
  Oxygen (ml/l): 6.138 - 6.701
  Phosphate (umol/l): 0.293 - 0.666
  Silicate (umol/l): 1.720 - 4.456

Graphical representation

Temperature range (°C): 8.094 - 12.604

Nitrate (umol/L): 1.473 - 9.099

Salinity (PPS): 34.813 - 35.293

Oxygen (ml/l): 6.138 - 6.701

Phosphate (umol/l): 0.293 - 0.666

Silicate (umol/l): 1.720 - 4.456
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Population in eastern Canada migrates eastward through Greenland to western Europe (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats aquatic insects, worms, mollusks, crustaceans, and seeds of POLYGONUM and other species (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Charadrius hiaticula (Charadris hiaticula ringed plover) preys on:
Nereis diversicolor
Neomysis integer
Gammarus
Littorina littorea

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Charadrius hiaticula (Charadris hiaticula ringed plover) is prey of:
Haploparaksis crassirostris
Maritrema gratiosum

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

100,000 - 1,000,000 individuals

Comments: Global population estimated at 442,500; that in North America numbers less than 10,000 (Morrison et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 20.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Eggs are laid from mid-June to mid-July in northeastern Greenland. Clutch size is 3-4, usually 4. Incubation, by both sexes, lasts 23-26 days. Young are independent in about 25 days. Produces one brood annually in far north, multiple broods occur farther south (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Charadrius hiaticula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Charadrius hiaticula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTATACCTAATCTTTGGTGCATGAGCTGGTATAGTTGGTACAGCCCTCAGCTTGCTTATTCGTGCAGAACTTGGCCAACCAGGAACACTCCTAGGCGATGACCAAATCTACAACGTAATCGTTACTGCCCATGCCTTCGTAATAATCTTCTTCATAGTCATGCCAATCATAATTGGTGGTTGCGGTAACTGACTAGTCCCACTAATAATTGGTGCACCGGACATAGCATTTCCCCGCATAAACAACATAAGCTTCTGACTACTTCCTCCATCATTCCTGCTCCTTCTCGCTTCCTCTACAGTTGAAGCCGGAGCAGGTACAGGATGAACCGTCTACCCACCCCTGGCTGGCAACCTAGCACATGCCGGAGCATCAGTAGACCTAGCTATCTTCTCACTACACCTAGCAGGTGTCTCCTCCATCCTAGGTGCAATCAACTTCATCACAACCGCCATCAACATAAAACCGCCCGCTCTCTCACAATACCAAACCCCCTTATTCGTATGATCAGTACTTATTACTGCCGTCCTACTACTCCTCTCACTCCCAGTTCTTGCCGCAGGCATCACTATGCTGCTAACAGACCGAAACCTAAACACCACATTCTTCGACCCTGCTGGAGGAGGCGATCCAGTCCTATACCAACATCTCTTCTGATTTTTCGGCCACCCAGAGGTCTACATCTTAATCCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large geographic range, no evidence of decline or major threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is estimated to number c.360,000-1,300,000 individuals (Wetlands International 2006), while national population sizes have been estimated at < c.1,000 individuals on migration and < c.1,000 wintering individuals in Japan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Important migratory stop-over habitats for this species on the Baltic Sea coastline are threatened by petroleum pollution, wetland drainage for irrigation, land abandonment and changing land management practices leading to scrub overgrowth (Grishanov et al. 2006). The species is also susceptible to avian botulism (so may be threatened by future outbreaks of the disease) (Blaker 1967), and suffers predation from feral America mink Neovison vison in some regions (Nordstrom et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common ringed plover

The common ringed plover or ringed plover (Charadrius hiaticula) is a small plover.

Adults are 17-19.5 cm in length with a 35–41 cm wingspan. They have a grey-brown back and wings, a white belly, and a white breast with one black neckband. They have a brown cap, a white forehead, a black mask around the eyes and a short orange and black bill. The legs are orange and only the outer two toes are slightly webbed, unlike the slightly smaller but otherwise very similar semipalmated plover, which has all three toes slightly webbed, and also a marginally narrower breast band; it was in former times included in the present species. Juvenile ringed plovers are duller than the adults in colour, with an often incomplete grey-brown breast band, a dark bill and dull yellowish-grey legs.

Common ringed plover (juvenile) feeding
Common ringed plover (adult), with a redshank behind
Common ringed plover (adult)
Egg – MHNT
Mating

This species differs from the smaller little ringed plover in leg colour, the head pattern, and the lack of an obvious yellow eye-ring.

The common ringed plover's breeding habitat is open ground on beaches or flats across northern Eurasia and in Arctic northeast Canada. Some birds breed inland, and in western Europe they nest as far south as northern France. They nest on the ground in an open area with little or no plant growth.

If a potential predator approaches the nest, the adult will walk away from the scrape, calling to attract the intruder and feigning a broken wing. Of course, once the intruder is far enough from the nest, the plover flies off.

Common ringed plovers are migratory and winter in coastal areas south to Africa. Many birds in Great Britain and northern France are resident throughout the year.

These birds forage for food on beaches, tidal flats and fields, usually by sight. They eat insects, crustaceans and worms.

There are three weakly defined subspecies, which vary slightly in size and mantle colour; they intergrade where their ranges meet:

  • Charadrius hiaticula hiaticula - breeds temperate western Europe north to central Scandinavia; resident or short-distance migrant to southwest Europe. Largest and palest subspecies.
  • Charadrius hiaticula psammodroma - breeds Iceland, Greenland, northeast Canada; wintering west Africa. Intermediate in size and colour.
  • Charadrius hiaticula tundrae - breeds Arctic northern Scandinavia and Asia; wintering Africa and southwest Asia. Smallest and darkest subspecies.

C. h. hiaticula and C. h. tundrae are among the taxa to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: C. HIATICULA and C. SEMIPALMATUS are considered conspecific by some authors (AOU 1983). It has been suggested that SEMIPALMATUS and HIATICULA represent two morphs of a single species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!