Articles on this page are available in 2 other languages: Chinese (Simplified) (6), Dutch (1) (learn more)

Overview

Brief Summary

Lapwings belong in meadows. The name lapwing describes the sound its broad wings make when in flight. Lapwings are also known as peewits, thanks to their shrill call. They are very vocal during mating season and have glorious courting rituals in the air. In the spring, the male makes several simple hollows in the ground and the female chooses one to make brood her eggs in. Both males and females brood the eggs and care for the chicks. Should their nest with chicks be threatened, they will defend their young with all their might. Sometimes, you see them flying after a harrier, constantly attacking the raptor. If it really gets serious, they will pretend to have a broken wing, luring the predator away from the nest.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

The lapwing is a gregarious species that forms large flocks between June and March (8). They feed on worms and a variety of invertebrates on or close to the surface of the soil (4). They are subject to food stealing by black headed gulls (Larus ridibundus); by feeding mainly at night, however, lapwings are able to minimise this threat (8). Nocturnal feeding increases around the time of the full moon, when these birds tend to roost during the day (5).  During February, males begin to perform display flights over breeding territories in which they climb steeply upwards before tumbling down close to the ground (9). Between March and early July, three or four well-camouflaged eggs are laid in a scrape on the ground (4) (9). Incubation of the eggs takes between 26 and 28 days (3) and the chicks are able to run shortly after hatching (6). If the nest is threatened, lapwings will mob predators (4) and try to distract them away from the young, which lie flat against the ground (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The lapwing is a familiar wader of open farmland (4). It has a striking appearance, with its black and white plumage, iridescent green and purple back and wispy crest (2). In flight they can be recognised by their rounded wing tips and slow wing beats. When flying, the dense flocks have a flickering appearance brought about by the alternating white then black of the flapping wings (2). This effect may have given rise to the common name of this species, which derives from the Old English word hleapewince, which means 'leap with a flicker in it' (6). Males and females are generally similar in appearance, but the male has a longer crest in summer. During winter, both sexes develop a buff-coloured border to the feathers of the upperparts. Juveniles have similar plumage to adults in winter, but they can be identified by their shorter, stumpy crests (2). The characteristic shrill call has given rise to the imitative local name 'peewit' (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Palearctic; winters to n Africa, India, Myanmar and s China.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The lapwing has undergone a massive decline in numbers in the last 20 years (4), with a 49% reduction between 1987 and 1998 (7). It is found throughout Britain, but avoids high ground, with the highest numbers occurring in central and southern Britain (8). Many British lapwings are resident (they stay in this country throughout the year) but many birds migrate to Britain from Germany, Scandinavia, Denmark and Holland during winter (5). Globally, lapwings have a wide distribution, being found throughout Europe, reaching east to the Pacific coast of Russia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Most populations of this species are fully migratory (del Hoyo et al. 1996, Snow and Perrins 1998) and travel on a broad front out of Europe (Snow and Perrins 1998) although some breeding populations in more temperate regions are sedentary (del Hoyo et al. 1996). The species breeds from April to July (Hayman et al. 1986) in solitary pairs (del Hoyo et al. 1996) although pairs may also nest close together (Johnsgard 1981), even semi-colonially (Trolliet 2003), in optimal habitat (Johnsgard 1981). The species may roost communally at night during both the breeding and non-breeding seasons (Urban et al. 1986) and after breeding the species gathers in large flocks for migration (Hayman et al. 1986, del Hoyo et al. 1996) and remains highly gregarious during the winter (Urban et al. 1986, Snow and Perrins 1998) in flocks of several thousand (Hayman et al. 1986). Habitat Breeding The species shows a preference for breeding on wet natural grasslands (Trolliet 2003), meadows and hay meadows (del Hoyo et al. 1996) with short swards (Hayman et al. 1986, Devereux et al. 2004) and patches of bare soil (Johnsgard 1981) at low altitudes (Hayman et al. 1986) (less than 1,000 m) (Snow and Perrins 1998). It will also breed on grassy moors, swampy heaths (Johnsgard 1981, del Hoyo et al. 1996), bogs (Johnsgard 1981) and arable fields (del Hoyo et al. 1996). Non- breeding During the winter the species utilises large open pastures for roosting (del Hoyo et al. 1996) and forages on damp grassland, irrigated land (Urban et al. 1986), stubble and ploughed fields (del Hoyo et al. 1996), riverbanks, lake shores, fresh and saline marshes, drainage ditches, estuaries and mudflats (Africa) (Urban et al. 1986). Diet Its diet consists of adult and larval insects (del Hoyo et al. 1996) (e.g. beetles, ants, Diptera, crickets (del Hoyo et al. 1996), grasshoppers, dragonflies, mayflies, cicadas and Lepidoptera) (Urban et al. 1986), spiders, snails (del Hoyo et al. 1996), earthworms (Urban et al. 1986, del Hoyo et al. 1996), frogs, small fish (Africa) (Urban et al. 1986) and seeds or other plant material (Africa) (Urban et al. 1986). Breeding site The nest is a shallow scrape in short grass vegetation (del Hoyo et al. 1996). Management information Short swards are the most profitable foraging habitat for the species (Devereux et al. 2004) so the application of cattle-grazing (Olsen and Schmidt 2004), preferably intensively (e.g. > 1 cow per hectare), may be successful in increasing abundances of the species on grasslands. On coastal grazing saltmarsh however it may be desirable to exclude cattle from selected areas in the spring where the rate of grass growth is slow (Hart et al. 2002). In the UK it has been found that a mosaic of unflooded grassland, winter-flooded grassland and shallow pools may provide optimal conditions for this species to breed (Ausden et al. 2001). It has also been found that shallow pools on coastal grazing marshes should be maintained until the end of June, as the aquatic invertebrates contained within them can be an important part of this species's diet (Ausden et al. 2003). Another UK study found that the species shows a preference for feeding in rills (relict saltmarsh drainage channels) in coastal grazing marshes, especially those with many branches (Milsom et al. 2002). It is possible to attract breeding pairs just by flooding rills during April and May to create water-margin habitats for feeding, rather than extensively flooding the land (i.e. marshes can therefore be managed to encourage lapwing breeding without preventing the grazing of cattle) (Milsom et al. 2002). At Lower Lough Erne in Northern Ireland the species showed a preference for nesting in the spring on open areas created by cutting rush beds in mid-winter (Robson and Allcorn 2006). It is also known to show increased hatching successes when ground predators have been excluded by erecting protective cages or fences around individual nests or nesting areas (Jackson 2001, Isaksson et al. 2007). The number of breeding pairs on improved grassland was successfully increased on a reserve in Wales by the implementation of a two-year rotation of chisel ploughing, as well as a seasonal sheep and cattle grazing regime and a controlled increase in the water-level (Squires and Allcorn 2006).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 28 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.558 - 12.224
  Nitrate (umol/L): 1.402 - 7.309
  Salinity (PPS): 34.170 - 35.157
  Oxygen (ml/l): 6.221 - 6.500
  Phosphate (umol/l): 0.321 - 0.630
  Silicate (umol/l): 0.987 - 4.938

Graphical representation

Temperature range (°C): 9.558 - 12.224

Nitrate (umol/L): 1.402 - 7.309

Salinity (PPS): 34.170 - 35.157

Oxygen (ml/l): 6.221 - 6.500

Phosphate (umol/l): 0.321 - 0.630

Silicate (umol/l): 0.987 - 4.938
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits open farmland and shows a strong preference for mixed farms that have large areas of arable land or grassland as well as unimproved grassland. They can also be found on winter stubbles, fallow fields, wet grassland, marshes and pasture (4) (3). During the breeding season, the lapwing needs sites with a combination of tilled ground and grassland rich in invertebrates, which are fed to the young (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Vanellus vanellus (Vanellus vanellus lapwing) preys on:
Nereis diversicolor
Hydrobia ulvae
Macoma balthica

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Vanellus vanellus (Vanellus vanellus lapwing) is prey of:
Amidostomum

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 23.6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Vanellus vanellus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Vanellus vanellus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTAATCTTCGGTGCATGAGCAGGTATAGTTGGTACCGCACTCAGCCTTCTCATCCGTGCAGAACTAGGCCAACCAGGAACCCTACTAGGCGATGACCAAATCTACAATGTAATCGTCACTGCCCATGCCTTTGTAATAATCTTTTTCATAGTAATGCCAATCATAATTGGCGGCTTTGGCAACTGACTAGTCCCGCTCATAATTGGCGCACCTGACATGGCATTCCCACGCATAAATAATATAAGCTTTTGACTACTACCCCCCTCATTCCTACTCCTTCTCGCATCCTCCACAGTAGAAGCAGGAGCAGGCACAGGATGAACTGTCTACCCCCCTCTAGCCGGCAACCTAGCCCATGCTGGAGCTTCAGTAGACCTGGCCATCTTCTCTCTCCACCTGGCAGGCGTATCCTCCATCCTAGGTGCAATCAACTTCATCACAACCGCCATCAACATAAAACCCCCCGCCCTTTCACAATACCAAACACCCTTGTTCGTATGATCAGTACTTATTACTGCCGTTCTACTGCTTCTATCACTTCCAGTTCTCGCTGCTGGCATCACCATACTACTAACAGACCGAAATTTAAATACAACATTCTTCGACCCTGCTGGAGGAGGTGACCCAGTCCTATACCAACACCTATTCTGATTTTTCGGCCACCCAGAAGTTTATATCTTAATTTTACCAGGATTTGGAATTATCTCCCACGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Chan, S., Mischenko, A., Stroud, D. & Trolliet, B.

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Included in the Birds of Conservation Concern Amber List (medium conservation concern) (3). Classified as a bird of conservation concern by the UK Biodiversity Action Plan, but not a priority species (4). Receives general protection in the UK under Schedule 1 of the Wildlife and Countryside Act (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.5,200,000-10,000,000 individuals (Wetlands International 2006), while national population estimates include: < c.10,000 individuals on migration and > c.10,000 wintering individuals in China; c.50-10,000 wintering individuals in Japan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species suffered past declines as a result of land-use intensification, wetland drainage and egg collecting (del Hoyo et al. 1996). Today it is threatened by reduced breeding productivity as a result of intensifying and changing agricultural practices (del Hoyo et al. 1996), especially the improvement of grasslands (e.g. by drainage, inorganic fertilising and reseeding) (Baldi et al. 2005). Important migratory stop-over habitats for this species on the Baltic Sea coastline are threatened by petroleum pollution, wetland drainage for irrigation, land abandonment and changing land management practices leading to scrub overgrowth (Grishanov 2006). Clutch destruction may also occur during spring cultivation (using machinery) on arable fields (del Hoyo et al. 1996). The species is susceptible to avian botulism so may be threatened by future outbreaks of the disease (Hubalek et al. 2005), and may suffer from nest predation by introduced mammals (e.g. European hedgehog Erinaceus europeaus) on some islands (Jackson 2001). Utilisation The species is hunted for commercial use (to be sold as food) and for recreational purposes in Iran (Balmaki and Barati 2006), and is hunted in France, Greece, Italy and Spain (Trolliet 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The decline of this once common bird was due to changes in land use, in particular the decline in mixed farming and the resulting loss of the former patchwork of arable and grassland areas (4). Furthermore, other agricultural changes have affected this species, including the use of fertilisers, denser production of crops, sowing seeds in autumn and winter and the increase in silage production (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Conservation action has not been targeted at this species as yet. Ten percent of the British population presently occurs on sites that are designated as Special Protection Areas (SPAs). The species is monitored well at wetland sites, but the majority of the population on agricultural land is not sufficiently monitored. This is a key issue that is being addressed at present; good monitoring of populations allows conservationists to track the well-being of populations and can indicate when and where conservation action is needed (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Northern lapwing

"Peewit" redirects here. For the fictional dwarf, see Johan and Peewit.
Peewits redirects here. Distinguish from PWITS = "possession with intent to supply" (an illegal drug trade-related criminal charge.)

The northern lapwing (Vanellus vanellus), also known as the peewit or pewit (imitative of its cry), green plover (emphasising the colour of the plumage) or (in the British Isles) just lapwing (which refers to its peculiar, erratic way of flying), is a bird in the plover family. It is common through temperate Eurasia. It is highly migratory over most of its extensive range, wintering further south as far as north Africa, northern India, Pakistan, and parts of China. It migrates mainly by day, often in large flocks. Lowland breeders in westernmost areas of Europe are resident. It occasionally is a vagrant to North America, especially after storms, as in the Canadian sightings after storms in December 1927 and in January 1966.[2]

It is a wader which breeds on cultivated land and other short vegetation habitats. 3 – 4 eggs are laid in a ground scrape. The nest and young are defended noisily and aggressively against all intruders, up to and including horses and cattle.

In winter it forms huge flocks on open land, particularly arable land and mud-flats.

Description[edit]

The northern lapwing is a 28–33 cm (11–13 in) long bird with a 67–87 cm (26–34 in) wingspan and a body mass of 128–330 g (4.5–11.6 oz).[3] It has rounded wings and a crest. It is also the shortest-legged of the lapwings. It is mainly black and white, but the back is tinted green. The male has a long crest and a black crown, throat and breast contrasting with an otherwise white face. Females and young birds have shorter crests, and have less strongly marked heads, but plumages are otherwise quite similar.

The name lapwing has been variously attributed to the "lapping" sound its wings make in flight, from the irregular progress in flight due to its large wings (OED derives this from an Old English word meaning "to totter"), or from its habit of drawing potential predators away from its nest by trailing a wing as if broken. This is a vocal bird in the breeding season, with constant calling as the crazed tumbling display flight is performed by the male. The typical contact call is a loud, shrill "pee-wit" from which they get their other name of peewit. Displaying males usually make a wheezy "pee-wit, wit wit, eeze wit" during their display flight, these birds also make squeaking or mewing sounds.

It feeds primarily on insects and other small invertebrates. This species often feeds in mixed flocks with golden plovers and black-headed gulls, the latter often robbing the two plovers, but providing a degree of protection against predators.

Like the golden plovers, this species prefers to feed at night when there is moonlight.

The northern lapwing is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Population decline[edit]

A chick in the Netherlands
Egg – MHNT

National surveys of England and Wales have shown a population decline between 1987 and 1998. The numbers of this species have been adversely affected by intensive agricultural techniques. In the lowlands this includes the loss of rough grassland, conversion to arable or improved grassland, loss of mixed farms, and switch from spring to autumn sown crops. In the uplands the losses may have been due to increases in grazing density.

Natural England gives grant aid to help restore lapwing habitat within its Environmental Stewardship Scheme. The organisation suggests an option within this scheme called 'Fallow plots for ground-nesting birds'. Uncropped plots at least 2 ha in size provide nesting habitat, and are located in suitable arable fields, which provide additional foraging habitat. Locating the plots within 2 km of extensively grazed grassland will provide additional foraging habitat. The plots is cultivated in the spring to produce a rough fallow, which is retained without the input of fertiliser or pesticides.[4]

Cultural significance[edit]

Harvesting eggs[edit]

"Plover's eggs" were an expensive delicacy in Victorian Europe, mentioned in Evelyn Waugh's Brideshead Revisited, about aristocratic British society in 1920–40. In the Netherlands there is a cultural-historical competition to find the first peewit egg of the year (het eerste kievietsei). It is especially popular in the province Friesland, but there are also regional competitions. Gathering peewit eggs is prohibited by the European Union, but Friesland was granted an exception for cultural-historical reasons. The Frisian exception was removed in 2005 by a court, which determined that the Frisian executive councillors had not properly followed procedure.[5][6] As of 2006 it is again allowed to look for peewit eggs between 1 March and 9 April, though harvesting those eggs is now forbidden. The first egg of 2008 was found on 3 March, in Eemnes, Utrecht,[7] as was the first egg of 2009 found on 8 March.[8] Over the last century, the first peewit egg is found earlier and earlier. This is ascribed to both increased use of fertiliser and climate change, causing earlier grass growth needed for egg laying.[9]

Mythology[edit]

The bird referred to in English translations of Ovid's Metamorphoses, book 6 (the story of King Tereus of Thrace, who rapes his wife's sister, Philomela, and cuts out her tongue), as lapwing[10] is probably the northern lapwing. Tereus is turned into an epops (6.674); Ovid presumably had the hoopoe in mind, whose crest indicates his royal status and whose long, sharp beak is a symbol of his violent nature.

References[edit]

  1. ^ BirdLife International (2012). "Vanellus vanellus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ W. Earl Godfrey (1986). The Birds of Canada (Revised Edition ed.). National Museum of Natural Sciences. p. 179. ISBN 0-660-10758-9. 
  3. ^ [1] (2011).
  4. ^ BTO News Number 269 March–April 2007, page 17
  5. ^ Walinga, Ruurd (2005-03-17). "Dertig jaar juridische strijd om kievitseieren" (in Dutch). Friesch Dagblad. Retrieved 2009-02-19. 
  6. ^ Stichting De Faunabescherming and Nederlandse Vereniging tot bescherming van Vogels vs. het college van gedeputeerde staten van Fryslân, LJN: AT0660, Rechtbank Leeuwarden , 03/518 BESLU & 03/547 BESLU (Rechtbank Leeuwarden 2005-03-16).
  7. ^ "Eerste kievitsei van 2008 gevonden" (in Dutch). Nederlandse Omroep Stichting. 2008-03-03. Retrieved 2009-02-19. 
  8. ^ "Dutch spring heralded by lapwing egg". Radio Netherlands / Expatica. 2009-03-08. Retrieved 2009-03-09. 
  9. ^ "Vinddatum eerste kievitsei in Friesland" (in Dutch). Milieu & Natuurcompendium. 2008-06-06. Retrieved 2009-02-19. 
  10. ^ Garth, Sir Samuel; John Dryden; et al. "'Metamorphoses' by Ovid". 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!