Articles on this page are available in 2 other languages: Chinese (Simplified) (6), Dutch (1) (learn more)

Overview

Brief Summary

Lapwings belong in meadows. The name lapwing describes the sound its broad wings make when in flight. Lapwings are also known as peewits, thanks to their shrill call. They are very vocal during mating season and have glorious courting rituals in the air. In the spring, the male makes several simple hollows in the ground and the female chooses one to make brood her eggs in. Both males and females brood the eggs and care for the chicks. Should their nest with chicks be threatened, they will defend their young with all their might. Sometimes, you see them flying after a harrier, constantly attacking the raptor. If it really gets serious, they will pretend to have a broken wing, luring the predator away from the nest.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

The lapwing is a gregarious species that forms large flocks between June and March (8). They feed on worms and a variety of invertebrates on or close to the surface of the soil (4). They are subject to food stealing by black headed gulls (Larus ridibundus); by feeding mainly at night, however, lapwings are able to minimise this threat (8). Nocturnal feeding increases around the time of the full moon, when these birds tend to roost during the day (5).  During February, males begin to perform display flights over breeding territories in which they climb steeply upwards before tumbling down close to the ground (9). Between March and early July, three or four well-camouflaged eggs are laid in a scrape on the ground (4) (9). Incubation of the eggs takes between 26 and 28 days (3) and the chicks are able to run shortly after hatching (6). If the nest is threatened, lapwings will mob predators (4) and try to distract them away from the young, which lie flat against the ground (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The lapwing is a familiar wader of open farmland (4). It has a striking appearance, with its black and white plumage, iridescent green and purple back and wispy crest (2). In flight they can be recognised by their rounded wing tips and slow wing beats. When flying, the dense flocks have a flickering appearance brought about by the alternating white then black of the flapping wings (2). This effect may have given rise to the common name of this species, which derives from the Old English word hleapewince, which means 'leap with a flicker in it' (6). Males and females are generally similar in appearance, but the male has a longer crest in summer. During winter, both sexes develop a buff-coloured border to the feathers of the upperparts. Juveniles have similar plumage to adults in winter, but they can be identified by their shorter, stumpy crests (2). The characteristic shrill call has given rise to the imitative local name 'peewit' (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The speciesbreeds from Europe, Turkey and north-west Iran through western Russia and Kazakhstan to southern and eastern Siberia, Mongolia and northern China.It winters from western Europe, the east Atlantic islands and North Africa through the Mediterranean, Middle East and Iran across northern India to south-east China, the Korean peninsulaand southern Japan (Wiersma and Sharpe 2015).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Palearctic; winters to n Africa, India, Myanmar and s China.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The lapwing has undergone a massive decline in numbers in the last 20 years (4), with a 49% reduction between 1987 and 1998 (7). It is found throughout Britain, but avoids high ground, with the highest numbers occurring in central and southern Britain (8). Many British lapwings are resident (they stay in this country throughout the year) but many birds migrate to Britain from Germany, Scandinavia, Denmark and Holland during winter (5). Globally, lapwings have a wide distribution, being found throughout Europe, reaching east to the Pacific coast of Russia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species shows a preference for breeding on wet natural grasslands (Trolliet 2003), meadows and hay meadows (del Hoyoet al.1996) with short swards (Haymanet al.1986, Devereuxet al.2004) and patches of bare soil (Johnsgard 1981) at low altitudes (Haymanet al.1986) (less than 1,000 m) (Snow and Perrins 1998). It will also breed on grassy moors, swampy heaths, bogs and arable fields(Johnsgard 1981, del Hoyoet al.1996).The nest is a shallow scrape in short grass vegetation (del Hoyoet al.1996).During the winter the species utilises large open pastures for roosting (del Hoyoet al.1996) and forages on damp grassland, irrigated land (Urbanet al.1986), stubble and ploughed fields (del Hoyoet al.1996), riverbanks, lake shores, fresh and saline marshes, drainage ditches, estuaries and mudflats (Africa) (Urbanet al.1986).Its diet consists of adult and larval insects (e.g. beetles, ants, Diptera, crickets, grasshoppers, dragonflies, mayflies, cicadas and Lepidoptera), spiders, snails, earthworms, frogs, small fish (Africa) and seeds or other plant material (Africa) (Urbanet al.1986,del Hoyoet al.1996).Most populations of this species are fully migratoryand travel on a broad front out of Europe although some breeding populations in more temperate regions are sedentary(del Hoyoet al.1996, Snow and Perrins 1998). The species breeds from April to July (Hayman et al. 1986) in solitary pairs (del Hoyo et al. 1996) although pairs may also nest close together in optimal habitat (Johnsgard 1981,Trolliet 2003).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 28 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.558 - 12.224
  Nitrate (umol/L): 1.402 - 7.309
  Salinity (PPS): 34.170 - 35.157
  Oxygen (ml/l): 6.221 - 6.500
  Phosphate (umol/l): 0.321 - 0.630
  Silicate (umol/l): 0.987 - 4.938

Graphical representation

Temperature range (°C): 9.558 - 12.224

Nitrate (umol/L): 1.402 - 7.309

Salinity (PPS): 34.170 - 35.157

Oxygen (ml/l): 6.221 - 6.500

Phosphate (umol/l): 0.321 - 0.630

Silicate (umol/l): 0.987 - 4.938
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 28 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.558 - 12.224
  Nitrate (umol/L): 1.402 - 7.309
  Salinity (PPS): 34.170 - 35.157
  Oxygen (ml/l): 6.221 - 6.500
  Phosphate (umol/l): 0.321 - 0.630
  Silicate (umol/l): 0.987 - 4.938

Graphical representation

Temperature range (°C): 9.558 - 12.224

Nitrate (umol/L): 1.402 - 7.309

Salinity (PPS): 34.170 - 35.157

Oxygen (ml/l): 6.221 - 6.500

Phosphate (umol/l): 0.321 - 0.630

Silicate (umol/l): 0.987 - 4.938
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits open farmland and shows a strong preference for mixed farms that have large areas of arable land or grassland as well as unimproved grassland. They can also be found on winter stubbles, fallow fields, wet grassland, marshes and pasture (4) (3). During the breeding season, the lapwing needs sites with a combination of tilled ground and grassland rich in invertebrates, which are fed to the young (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Vanellus vanellus (Vanellus vanellus lapwing) preys on:
Nereis diversicolor
Hydrobia ulvae
Macoma balthica

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Vanellus vanellus (Vanellus vanellus lapwing) is prey of:
Amidostomum

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 23.6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vanellus vanellus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTAATCTTCGGTGCATGAGCAGGTATAGTTGGTACCGCACTCAGCCTTCTCATCCGTGCAGAACTAGGCCAACCAGGAACCCTACTAGGCGATGACCAAATCTACAATGTAATCGTCACTGCCCATGCCTTTGTAATAATCTTTTTCATAGTAATGCCAATCATAATTGGCGGCTTTGGCAACTGACTAGTCCCGCTCATAATTGGCGCACCTGACATGGCATTCCCACGCATAAATAATATAAGCTTTTGACTACTACCCCCCTCATTCCTACTCCTTCTCGCATCCTCCACAGTAGAAGCAGGAGCAGGCACAGGATGAACTGTCTACCCCCCTCTAGCCGGCAACCTAGCCCATGCTGGAGCTTCAGTAGACCTGGCCATCTTCTCTCTCCACCTGGCAGGCGTATCCTCCATCCTAGGTGCAATCAACTTCATCACAACCGCCATCAACATAAAACCCCCCGCCCTTTCACAATACCAAACACCCTTGTTCGTATGATCAGTACTTATTACTGCCGTTCTACTGCTTCTATCACTTCCAGTTCTCGCTGCTGGCATCACCATACTACTAACAGACCGAAATTTAAATACAACATTCTTCGACCCTGCTGGAGGAGGTGACCCAGTCCTATACCAACACCTATTCTGATTTTTCGGCCACCCAGAAGTTTATATCTTAATTTTACCAGGATTTGGAATTATCTCCCACGTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Vanellus vanellus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Symes, A.

Contributor/s
Chan, S., Mischenko, A., Stroud, D., Trolliet, B., Singh, R.K.B., Perlman, Y., Vogrin, M., Sorrenti, M., Choudhury, U., Verkuil, Y., Petkov, N., Raudonikis, L. & Fefelov, I.

Justification
This species is suspected to be decreasing at a moderately rapid rate. It is therefore classified as Near Threatened. Should new information suggest these declines are occurring more rapidly it would warrant uplisting; it almost meets the requirements for listing as threatened under criteria A2abce+3bce+4abce.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5