Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

Perhaps oystercatchers used to eat mainly oysters, but the ones we know nowadays prefer mussels and cockles. And even jellyfish! Actually, they either live along the shores of tidal flats and eat mostly bivalves, or they have adapted to meadows and eat worms and insect larvae. They are busy birds, dribbling and chatting among themselves with a typical te-peet, te-peet sound. They are easy to recognize at night as they communicate among themselves while flying overhead. During the day, oystercatchers are easy to identify by their black and white plumage and orange bill. The bivalve consumers have very strong bills, being the wader to open a thick cockle.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The strong, flattened bill allows the oystercatcher to prize open cockles, mussels and other bivalves that other waders cannot exploit. They also feed on worms, limpets and crabs (3). The nest is a scrape on the ground, after mid-April between 2 and 4 (but usually 3) cream eggs, spotted with brown are laid (4). Both sexes share the duty of incubation, which takes 24-27 days (4). The young are very well camouflaged, and they leave the nest after about a day. Both the male and the female care for the young until they become independent at between 34 and 37 days (4). Oystercatcher pairs usually produce just one brood a year, although if the brood is lost for some reason, a replacement brood may be produced (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The oystercatcher is well known as a coastal species (3), and is easily recognised by virtue of its large size and combination of black and white plumage, long, bright orange-red bill and pink legs (2). In flight there is a prominent white wing-bar, and during winter a white 'chin-strap' develops (2). The sexes are similar in appearance, although males often have relatively shorter, thicker bills (2). Juveniles have brownish-black upperparts, grey legs, and a dark tip to the bill (2). Calls include a loud 'pic-pic-pic' (4), and a high 'peep' (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Originally, the oystercatcher was mainly a coastal species in Britain; it is still found around the coastline, but between 1974 and 1986 it increasingly colonised inland waterways, particularly in Scotland and northern England (5). During winter, resident birds are joined by immigrants from Iceland, Norway and the Faeroe Islands (3). It also occurs around the coasts of northern and western Europe, patchily around the Mediterranean and parts of the coast of eastern Asia, as well as inland from the Caspian Sea towards central Asia (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Length: 40-44 cm. Plumage: brownish black to black above to chest; tip of tail black; white below and on back, rump and base of tail feathers; white band in rear of wing; white stripe at base of throat in non-breeding plumage and young birds. Immature browner than adult. Bare parts: iris red; bill orange-red, brown in immature; eyering orange-red ; feet and legs robust, pink, greyer in immature. Habitat: mainly sandy marine beaches. Palearctic migrant. <389><391><393>
  • Urban, E.K., C.H. Fry & S. Keith (1986). The Birds of Africa, Volume II. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Most populations of this species are fully migratory, inland breeders moving to the coast for the winter (del Hoyo et al. 1996). The species breeds from April to July (Hayman et al. 1986) in solitary pairs or small groups (Flint et al. 1984), during the winter foraging singly or in small groups of up to 10 individuals (Snow and Perrins 1998) and with larger flocks often forming in major bays and estuaries and at roosting sites (Hayman et al. 1986, del Hoyo et al. 1996, Snow and Perrins 1998). Habitat Breeding The species breeds on coastal saltmarshes, sand and shingle beaches (del Hoyo et al. 1996), dunes, cliff-tops with short grass (Hayman et al. 1986) and occasionally rocky shores (del Hoyo et al. 1996), as well as inland along the shores of lakes, reservoirs and rivers (Hayman et al. 1986) or on agricultural (del Hoyo et al. 1996) grass and cereal fields, often some distance from water (Hayman et al. 1986). Non-breeding Outside of the breeding season the species is chiefly coastal, frequenting estuarine mudflats, saltmarshes and sandy and rocky shores (del Hoyo et al. 1996). Diet When foraging on soft intertidal substrates bivalves and gastropods are the most important food items for this species (del Hoyo et al. 1996). Polychaetes and crustaceans are more important in estuaries however, and molluscs (e.g. mussels, limpets and whelks) are most important on rocky shores (del Hoyo et al. 1996). When inland, prey such as earthworms and insect larvae (e.g. caterpillars and cranefly larvae) are also taken (del Hoyo et al. 1996). Breeding site The nest is a shallow scrape on the ground (del Hoyo et al. 1996) often on raised surfaces (e.g. earth banks) (Hayman et al. 1986) in the open or in short vegetation (Snow and Perrins 1998) on cultivated or uncultivated land, cliff-tops, rocky outcrops or clearings in taller vegetation including woods and moorland (Snow and Perrins 1998). Management information The breeding numbers of this species may decline if cattle grazing regimes are implemented on coastal grassland, possibly as a result of changes in food availability and increased predation risks (Olsen and Schmidt 2004). Removing large numbers of gulls (e.g. Larus argentatus and Larus fuscus) from islands may attract higher breeding numbers of the species but may not improve the overall breeding conditions (Harris and Wanless 1997). There is also evidence that the creation of large marine protected areas (MPAs) to protect this species from the threat of anthropogenic shellfish over-fishing may not be an effective management or conservation technique on a global scale, especially if over-fishing continues to occur in adjacent areas (Verhulst et al. 2004).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 76 specimens in 1 taxon.
Water temperature and chemistry ranges based on 41 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.995 - 12.200
  Nitrate (umol/L): 1.473 - 10.000
  Salinity (PPS): 27.525 - 35.305
  Oxygen (ml/l): 6.154 - 6.963
  Phosphate (umol/l): 0.273 - 0.704
  Silicate (umol/l): 1.720 - 4.416

Graphical representation

Temperature range (°C): 7.995 - 12.200

Nitrate (umol/L): 1.473 - 10.000

Salinity (PPS): 27.525 - 35.305

Oxygen (ml/l): 6.154 - 6.963

Phosphate (umol/l): 0.273 - 0.704

Silicate (umol/l): 1.720 - 4.416
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurs in estuaries, on rocky, sandy and muddy shores, as well as along the banks of rivers, lakes (4) and gravel pits (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Haematopus ostralegus (Haematopus ostralegus oysertcatcher) preys on:
Nereis diversicolor
Corophium volutator
Hydrobia ulvae
Littorina littorea
Macoma balthica
Mytilus edulis

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Haematopus ostralegus (Haematopus ostralegus oysertcatcher) is prey of:
Amidostomum
Haploparaksis crassirostris
Ophryocotyle insignis
Psilostomum brevicolle
Catatropis terrucosa
Parvatrema affine
Levinseniella brachysoma

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 43.3 years (wild) Observations: In the wild, these animals have been known to live up to 43.3 years (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Haematopus ostralegus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Haematopus ostralegus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCCACAAAGACATTGGCACCCTATACCTAATCTTTGGTGCATGAGCCGGTATAGTCGGTACCGCCCTCAGCTTACTCATCCGCGCAGAACTAGGTCAACCAGGAACCCTGCTAGGAGATGACCAAATTTACAATGTAATCGTCACGGCCCACGCCTTCGTGATAATCTTCTTCATAGTTATACCGATTATGATCGGCGGATTCGGAAACTGACTAGTCCCACTCATAATCGGTGCTCCCGACATAGCATTCCCCCGCATGAACAACATAAGCTTCTGACTACTACCCCCATCATTCCTTCTCCTCCTTGCCTCCTCTACAGTAGAAGCAGGGGCAGGCACAGGATGAACCGTATACCCCCCTCTAGCTGGCAACCTCGCCCATGCTGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTTCACCTAGCAGGTGTATCCTCCATCCTGGGTGCAATCAACTTTATCACAACCGCCATCAACATAAAACCACCTGCCCTCTCACAATACCAAACCCCCCTATTTGTATGATCCGTACTCATTACCGCCGTCCTACTACTCCTATCCCTCCCAGTCCTTGCTGCTGGCATCACAATACTCCTAACAGACCGGAATCTAAACACTACATTCTTCGACCCTGCTGGAGGCGGTGACCCCGTCCTATACCAACACCTTTTCTGATTCTTCGGCCACCCAGAAGTCTACATTCTAATCCTACCAGGATTTGGAAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Widespread and common species (2). Included in the Birds of Conservation Concern Amber List (medium conservation concern) (6)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is estimated to number c.1,100,000-1,200,000 individuals (Wetlands International 2006), while national population estimates include: c.100-10,000 breeding pairs, c.1,000-10,000 individuals on migration and c.1,000-10,000 wintering individuals in China; < c.50 individuals on migration and < c.50 wintering individuals in Taiwan; c.100-10,000 breeding pairs in Korea; < c.1,000 wintering individuals in Japan and c.100-10,000 breeding pairs and c.50-1,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The main threat to the species is the over-fishing of benthic shellfish and the resulting disappearance of intertidal mussel and cockle beds (Atkinson et al.2003, Verhulst et al. 2004, Ens 2006). The species is also threatened by habitat degradation on its wintering grounds due to land reclamation, pollution, human disturbance (Kelin and Qiang 2006) (e.g. from construction work) (Burton et al. 2002), coastal barrage construction (Burton 2006) and reduced river flows (Kelin and Qiang 2006). The species is susceptible to avian influenza so may be threatened by future outbreaks of the virus (Melville and Shortridge 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not currently threatened (5), though commercial harvesting of shellfish can reduce food supplies considerably, and developments on estuaries can remove important feeding areas (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

No specific conservation action has been targeted at this species, but it will have benefited from conservation measures aimed at a range of wintering wader species, particularly the creation and management of coastal nature reserves (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eurasian oystercatcher

The Eurasian oystercatcher (Haematopus ostralegus) also known as the common pied oystercatcher, or (in Europe) just oystercatcher, is a wader in the oystercatcher bird family Haematopodidae. It is the most widespread of the oystercatchers, with three races breeding in western Europe, central Eurasia, Kamchatka, China, and the western coast of Korea. No other oystercatcher occurs within this area.

This oystercatcher is the national bird of the Faroe Islands, where it is called tjaldur.

Description[edit]

Eurasian Oystercatcher flying on Loch Sligachan on the Isle of Skye, Scotland

The oystercatcher is one of the largest waders in the region. It is 40–45 centimetres (16–18 in) long (bill 8–9 cm) with a wing-span 80–85 centimetres (31–33 in).[2] They are obvious and noisy plover-like birds, with black and white plumage, red legs and strong broad red bills used for smashing or prising open molluscs such as mussels or for finding earthworms.[2] Despite its name, oysters do not form a large part of its diet. The bird still lives up to its name, as few if any other wading birds are capable of opening oysters at all.

This oystercatcher is unmistakable in flight, with white patches on the wings and tail, otherwise black upperparts, and white underparts. Young birds are more brown, have a white neck collar and a duller bill. The call is a distinctive loud piping.

The bill shape varies; oystercatchers with broad bill tips open molluscs by prising them apart or hammering through the shell, whereas pointed-bill birds dig up worms. Much of this is due to the wear resulting from feeding on the prey. Individual birds specialise in one technique or the other which they learn from their parents.[2]

Subspecies[edit]

There are three subspecies: the nominate ostralegus found in Europe and the coasts of eastern Europe, longipes from Central Asia and Russia, and osculans found from Kamchatka in the Russian Far East and northern parts of China.

Bill length shows clinal variation with an increase from west to east. The subspecies longipes has distinctly brownish upperparts and the nasal groove extends more than halfway along the bill. In the subspecies ostralegus the nasal groove stops short of the half-way mark. The osculans subspecies lacks white on the shafts of the outer 2–3 primaries and has no white on the outer webs of the outer five primaries.[3]

Ecology[edit]

Egg - MHNT

This is a migratory species over most of its range. The European population breeds mainly in northern Europe, but in winter the birds can be found in north Africa and southern parts of Europe. Although the species is present all year in Ireland, Great Britain and the adjacent European coasts, there is still migratory movement: the large flocks that are found in the estuaries of south-west England in winter mainly breed in northern England or Scotland. Similar movements are shown by the Asian populations. The birds are highly gregarious outside the breeding season.

The nest is a bare scrape on pebbles, on the coast or on inland gravelly islands. 2–4 eggs are laid. Both eggs and chicks are highly cryptic.

Because of its large numbers and readily identified behaviour, the oystercatcher is an important indicator species for the health of the ecosystems where it congregates. Extensive long-term studies have been carried out on its foraging behaviour, in northern Germany, in the Netherlands and particularly on the River Exe estuary in south-west England. These studies form an important part of the foundation for the modern discipline of behavioural ecology.

Etymology[edit]

The scientific name Haematopus ostralegus comes from the Greek haima αἳμα blood, pous πούς foot and Latin ostrea oyster and legere to collect or pick.[4]

The name oystercatcher was coined by Mark Catesby in 1731 as a common name for the North American species H. palliatus, described as eating oysters.[5] Yarrell in 1843 established this as the preferred term, replacing the older name Sea Pie.[5]

Gallery[edit]

Footnotes[edit]

  1. ^ BirdLife International (2012). "Haematopus ostralegus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c The Birds of the Western Palearctic [Abridged]. OUP. 1997. ISBN 0-19-854099-X. 
  3. ^ Hayman et al., 1986
  4. ^ Jobling, James A (1991). A Dictionary of Scientific Bird Names. OUP. ISBN 0-19-854634-3. 
  5. ^ a b Lockwood, W B (1993). The Oxford Dictionary of British Bird Names. OUP. ISBN 978-0-19-866196-2. 

References[edit]

  • Hayman, Peter, John Marchant & Tony Prater. 1986. Shorebirds: An Identification Guide to the Waders of the World. Croom Helm, London.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!