Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

Geographic Range

Purple swamphens are native to the tropical and sub-tropical regions of Europe, Africa, Asia, and Australasia. They have been introduced to Florida. In Europe, purple swamphens live in the Atlantic and Mediterranean basins where there are suitable lagoons, rivers, and other wetlands. There are 13 recognized subspecies of purple swamphen.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Native ); ethiopian (Native ); australian (Native ); oceanic islands (Native )

  • Celdran, J., F. Polo, V. Peinado, G. Viscor, J. Palomeque. 1994. Haematology of captive herons, egrets, spoonbill, ibis and gallinule. Comparative Biochemical Physiology, 107A: 337-341.
  • Balasubramaniam, S., P. Guay. 2008. Purple Swamphens (Porphyrio porphyrio) Attempting to Prey upon Black Swan (Cygnus atratus) Eggs and Preying upon a Cygnet on an Urban Lake in Melbourne, Australia. The Wilson Journal of Ornithology, 120 (3): 633-635.
  • Pacheco, C., P. McGregor. 2004. Conservation of the purple gallinule (Porphyrio porphyrio L.) in Portugal: causes of decline, recovery and expansion. Biological Conservation, 119: 115-120.
  • Sanchez-Lafuente, A., P. Rey, F. Valera, J. Munoz-Cobo. 1992. Past and current distribution of the purple swamphen Porphyrio porphyrio L. in the Iberian Peninsula. Biological Conservation, 61: 23-30.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Purple swamphens are large members of the rail family (Rallidae). Males are larger than females, males average 1,050 g and females 850 g. They are chicken-sized birds with dark, shiny indigo or purple feathers and red bills and frontal shields. Although plumage color varies regionally, in general their backs and wings are dark green, brown or black with a green sheen and their breasts and heads are from pale blue to purple blue. Their tails are short, and they have bright white feathers on the undersides of their tails. Their legs are long, scaly, and orange-red.

Range mass: 850 to 1050 g.

Average length: 51 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is sedentary, nomadic or partially migratory, with many populations making local seasonal movements in response to changing habitat conditions1 (e.g. the drying of marshes)2. The timing of breeding varies geographically (in relation to peaks in local rainfall)1. It breeds in solitary territorial pairs1, 2 (especially in pastures)2 or in small communal groups containing several breeding males, breeding females and non-breeding helpers1, 2 (especially in swamps)2. When not breeding the species occurs in pairs, small groups of 12 or more individuals (Africa) or in larger congregations of 50 to several hundred individuals (India and New Zealand)2. The species is mainly crepuscular and forages in the early-morning and late-evening1. Habitat It shows a preference for permanent, fresh or brackish, still or slow-flowing, sheltered, extensive wetlands1 with floating mats of water-lilies2, tall, dense emergent vegetation (e.g. reeds Phragmites spp., Typha spp., sedge Carex spp., papyrus Cyperus spp.1, 2, Scirpus spp. or Eleocharis spp.2), muddy or sandy shorelines and patches of shallow water1. It may however occur in saline, eutrophic or turbid wetlands, and may be found on small waters and seasonal or temporary wetlands (e.g. in Africa)1. Suitable habitats include ponds, lakes, dams, marshes, swamps, rivers, flood-plains, artesian wells, sewage farms1 and wet rice-fields2. The species also extends into open habitats adjacent to wetlands including grasslands, agricultural land, parks, gardens, hedgerows and forest margins1. Diet Its diet consists predominantly of plant matter including shoots, leaves, roots, stems, flowers and seeds (e.g. of Typha spp., Scripus spp., rice, grasses, sedges, Rumex spp., Polygonum spp., water-lilies1, clover Trifolium spp., fern Salvonia repens, bananas, tapioca and yam Dioscorea spp.2). It also takes animal matter including molluscs, leeches, small crustaceans1 (Isopods, Amphipods and crabs)2, adult and larval insects1 (Coleoptera, grasshoppers, Hemiptera, Diptera, Lepidoptera)2, earthworms2, spiders, fish and fish eggs, frogs and frog spawn, lizards1, water snakes Natrix maura2, adult birds, bird eggs and nestlings, small rodents and carrion1. Breeding site The nest is a shallow cup in a large substantial structure of vegetation1 built on a platform of vegetation floating on or standing in shallow water1, 2 30-120 cm deep2 and concealed in thick vegetation1. Management information There is evidence that the application of rabbit Oryctolagus cuniculus control measures may lead to an increase in nest predation on this species by rabbit-specialising predators (New Zealand)6.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Purple swamphens live in freshwater and brackish wetlands containing plenty of emergent vegetation. The vegetation often includes reedmace (Typha), sedges (Carex), and reeds (Phragmites). They prefer marshes and swamps with consistent water levels. They can also be found in pastures and disturbed areas. They spend most of their lives on the ground and are not interested in forests.

Habitat Regions: temperate ; tropical ; terrestrial ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Wetlands: marsh ; swamp

Other Habitat Features: agricultural ; riparian ; estuarine

  • Freifeld, H., D. Steadman, J. Sailer. 2001. Landbirds on offshore islands in Samoa. Journal of Field Ornithology, 72 (1): 72-85.
  • Jamieson, I. 1988. Provisioning behavior in a communal breeder: an epigenetic approach to the study of individual variation in behavior. Behavior, 104 (3-4): 262-279.
  • Jamieson, I. 1997. Testing reproductive skew models in a communally breeding birds, the pukeko, Porphyrio porphyrio . Proceedings of the Royal Society of London B, 264: 335-340.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Purple swamphens eat vegetable matter and small animal prey. They eat the bulbs of Scirpus plants and browse on the shoots of marsh grasses and reeds. Animal prey is usually arthropods and other invertebrates, such as snails, although they occasionally take vertebrate prey, including fish, birds, and lizards. When they eat birds, they generally eat eggs, nestlings, and juveniles. They have been recorded preying on passerines and waterfowl, including teal, swans, and ducks. They also swallow grit, like sand or other sediment, to help their gizzards grind up their food. They sometimes lift food to their mouths with their feet, rather than eating it on the ground.

Animal Foods: birds; amphibians; reptiles; fish; eggs; insects; terrestrial non-insect arthropods; mollusks

Plant Foods: leaves; roots and tubers

Primary Diet: omnivore

  • Gomez, G., R. Baos, B. Gomara, B. Jimenez, V. Benito, R. Montoro, F. Hiraldo, M. Gonzalez. 2004. Influence of a Mine Tailing Accident Near Donana National Park (Spain) on Heavy Metals and Arsenic Accumulation in 14 Species of Waterfowl (1998 to 2000). Archives of Environmental Contamination and Toxicology, 47: 521-529.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Purple swamphens are important predators of marsh invertebrates and impact marsh communities through their predation and browsing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Purple swamphens are one of New Zealand’s most successful bird species because they have appropriate responses to terrestrial mammalian predators. New Zealand has no native terrestrial predators, so many native New Zealand birds are very vulnerable to predation by introduced mammalian predators. One of their responses to predators is to physically attack the predator. They also use wing flapping, calls, and flashing their white rump patches to alert conspecifics to the presence of a predator and disturb the predator itself.

Purple swamphens use a conspicuous rump patch to signal their awareness of a predator’s proximity. To call attention to the patch, they flick their tails up and down rapidly. Interestingly, it appears the signal is not meant to alarm other swamphens as much as it is meant to tell the predator it’s been spotted. If the prey communicates its awareness of the predator’s presence, the predator may be less likely to attempt a pursuit. Also, purple swamphens have been noted to signal their awareness less when they are closer to cover. This may be due to decreased vigilance or to the lower visibility of the signal when the swamphen is close to cover.

Sometimes purple swamphens form groups to mob stoats and rats. The shrieking calls they emit during these hunts are called “blue murder” by overhearing humans. When not attacking, they will flee.

Known Predators:

  • Bunin, J., I. Jamieson. 1996. Responses to a Model Predator of New Zealand's Endangered Takahe and Its Closest Relative, the Pukeko. Conservation Biology, 10 (5): 1463-1466.
  • Alvarez, F. 1993. Alertness signalling in two rail species. Animal Behavior, 46: 1229-1231.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Purple swamphens communicate visually and with vocalizations. Their calls are varied, including their shrieking warning and attack calls and their hummed courtship calls. They also use a flash of their white rumps to tell predators they’ve been spotted.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is little information on lifespan in purple swamphens in the literature. In New Zealand the oldest recorded pukeho was 9 years old. The related American species, Porphyrio martinica, has been recorded living up to 22 years in the wild.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Purple swamphens use a variety of mating systems, ranging from monogamous mating to communal mating. In communal mating, two breeding females share one nest and are fertilized by several males. In addition to the parents, non-breeding helpers of both sexes help raise the young. These groups generally contain 6 to 9 birds and the helpers are usually close kin to the breeders. Dominance hierarchies in these groups exist and there is generally a dominant female that breeds the most. Some populations of purple swamphens are monogamous. The full range of mating systems can be found in other populations, including smaller social breeding arrangements consisting of 1 or 2 females, 1 or several males, and helpers at the nest or not.

Courtship in New Zealand populations begins in late July and continues until early December. Males use an elaborate courtship display where they hold reeds in their bill, bow, and emit a chuckling vocalization. Preening is a common behavior, and it is often invited by one bird preening and bowing while another approaches. Courtship feeding occurs more often in communal settings than in pairs. Copulation could be initiated by a bird giving a humming call or by the male chasing her. Copulation within communal settings involves every type of pairing possible, including heterosexual, homosexual, and multiple participants. Group mating activity appears to have a function in synchronizing all the birds’ sexual cycles, thus allowing clutches to be laid and hatched simultaneously. Birds nesting in exclusive pairs copulate less than those in communal settings.

Mating System: monogamous ; polyandrous ; polygynous ; polygynandrous (promiscuous) ; cooperative breeder

Males become sexually mature when they are three years old. They mate with the two oldest and most dominant females in their group. Two to seven breeding males are possible in one communal breeding group. Young from previous seasons may be present to help with rearing the young. Both sexes of parents, but not sexually immature helpers, incubate the eggs. If a helper is old enough to breed but didn’t, it may help incubate near the end of the incubation period. Because of this system, yearling birds encounter their first hatchlings while under the supervision of more experienced birds. Non-breeders two or three years old have already had at least one year experience with young, and the parents themselves have had three or more years experience raising young. It appears raising chicks is partly a learned behavior, since non-breeders observe and learn how to provision the young. They build nests out of grass and tussock and sometimes both breeding females lay in the same nest. Neither female attempts to damage the other female’s eggs. The eggs hatch within four days of each other and the hatchlings are ready to leave the nest after about two days. They are brooded for a week and parents and helpers feed them until they are about ten weeks old. Breeding groups often attempt a second brood in a season, but these broods are not often successful.

Males build several nests. The ones built early in the season appear to be practice nests, as they are poorly constructed and lack a well-shaped bowl. They use stems of Typha and Juncus and tussocks of Carex and Cyperus. Nests are protected by a canopy of plants and are accessible by a ramp. After hatching, males then construct new nests specifically for brooding. Nests made of Typha are preferred for this purpose. Brood nests are often abandoned in favor of ones built nearer feeding sites.

Females usually lay their eggs around dawn. Females sharing a nest typically lay their eggs on the same days. Clutches are laid between mid August and mid February. Most breeders lay one or two clutches per season, but if a clutch is lost, extra clutches will be laid to make up for it. Each female will lay 3 to 6 eggs per clutch, with up to 12 eggs in a communal nest. Dominant females lay at least one egg more than submissive females when in communal settings. Incubation begins when half the clutch is laid, so individual eggs will end up hatching between 23 and 29 days after being laid. Hatching occurs over a two to three day interval. Only adults incubate, and females incubate more than males. In communal settings, the dominant female incubates the most. Interestingly, in group settings females will incubate most often during the day and allow males to concentrate on defense. Males are better at defense and incubate at night, when they aren’t needed for protection. In pair settings, this division of labor is difficult to implement and nest defense is not as effective.

Breeding interval: Purple swamphens have one breeding season per year and produce 1 or 2 clutches at that time.

Breeding season: Breeding varies with region, coinciding with spring.

Range eggs per season: 3 to 6.

Range time to hatching: 23 to 29 days.

Average time to independence: 2 months.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Purple swamphens generally have help when raising young. Monogamous pairs are often assisted by the young they’ve raised from earlier broods. Promiscuous mating groups all help each other. Also, both of the above groups may receive aid from non-breeders of either sex and different ages. When young hatch they are nidifugous and precocial. During the hatching period, one parent will sit on the nest and the hatched chick(s) while others bring food to feed the sitter or the young. Within three days new hatchlings are led away from the nest and fed elsewhere, sometimes on floating platforms of aquatic vegetation. Hatchlings begin to eat on their own after two days, but are still fed by adults until they are two months old. Hatchlings learn to stay close to cover and whenever a predator is spotted adults rush to protect the young. In pair territories, the young become independent earlier because their parents re-nest and hand over care to helpers.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents

  • Jamieson, I., J. Craig. 1987. Male-Male and Female-Female Courtship and Copulation Behavior in a Communally Breeding Bird. Animal Behavior, 35 (4): 1251-1253.
  • Jamieson, I. 1988. Provisioning behavior in a communal breeder: an epigenetic approach to the study of individual variation in behavior. Behavior, 104 (3-4): 262-279.
  • Craig, J. 1980. Pair and group breeding behavior of a communal gallinule, the pukeko, (Porphyrio p. melanotus). Animal Behavior, 28: 593-603.
  • Jamieson, I. 1997. Testing reproductive skew models in a communally breeding birds, the pukeko, Porphyrio porphyrio . Proceedings of the Royal Society of London B, 264: 335-340.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Porphyrio porphyrio

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTATCTCATCTTCGGCGCATGGGCCGGCATAATTGGCACCGCTCTCAGCCTTCTTATCCGAGCAGAGCTCGGACAGCCCGGCAGCCTATTAGGGGATGACCAAATCTACAATGTAATTGTCACCGCACATGCCTTTGTAATAATCTTTTTTATAGTAATACCAGTCATAATCGGCGGATTTGGCAACTGATTAGTACCCTTAATAATCGGAGCCCCAGACATGGCATTCCCACGCATAAACAACATAAGCTTCTGACTCCTTCCCCCATCCTTCCTACTACTACTAGCATCCTCCACAGTAGAAGCAGGGGCGGGCACAGGCTGAACAGTCTACCCCCCACTAGCAGGCAACCTAGCCCACGCAGGAGCCTCAGTAGATCTAGCTATCTTCTCCCTCCATCTAGCAGGTGTCTCATCCATTCTAGGTGCCATCAACTTCATTACAACTGCCATCAACATAAAACCACCTGCTCTGTCCCAATACCAAACCCCCTTATTCGTATGATCCGTACTAATCACCGCAGTCTTGCTACTGCTATCACTCCCAGTACTTGCCGCAGGCATCACCATACTACTAACCGACCGAAACCTAAACACTACATTCTTCGACCCTGCTGGCGGAGGAGATCCAATCCTATATCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Porphyrio porphyrio

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Purple swamphens are not considered threatened from a global viewpoint. However, in Europe populations have declined as a result of habitat loss. They are considered rare and protected species throughout most of Europe. In Portugal they are considered endangered and they have been extirpated from parts of their former range. Hunting of purple swamphens is illegal, although hunters sometimes mistake them for legal gamebirds, like common coots (Fulica atra) and moorhens (Gallinula chloropus). Because they don’t move far by flying, they don't readily colonize available habitat that is isolated. In some areas more suitable wetland habitats are being created as a result of human expansion. Rice fields built along the Guadalquivir river encourage growth of Typha and Phragmites. New reservoirs result in build up of silt layers and the formation of new marshes. Reintroductions are also being attempted. European populations seem to be recovering.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Resident breeder.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The main threats to this species are habitat loss through wetland drainage1, 2, habitat degradation through the introduction of exotic species (e.g. coypu Myocastor coypus)2, direct mortality from pesticide contamination1, 4 (e.g. brodifacoum, a pesticide applied aerially to exterminate rodents)4, poisoning by cyanobacterial toxins (from dense blooms of cyanobacteria in wetlands)7 and hunting1. The species is also susceptible to avian influenza3, 8 and avian botulism so may be threatened by future outbreaks of these diseases5.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Purple swamphens eat crop and pasture plants, including potatoes, kumara, clover, and grass.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Purple swamphens eat pest insects in crop areas. They also hunt and kill rats and stoats.

Because they are the closest relatives of endangered takahes (Porphyrio hochstetteri and Porphyrio mantelli), purple swamphens are valuable research animals for takahe conservation. One problem plaguing takahe is their low fertility rates. Gunn et al. (2008) performed experiments to find out what was the best method to retrieve sperm from purple swamphens. Perfecting artificial insemination in swamphens may make it easier to help takahe with their breeding needs. Purple swamphens may also be valuable as potential foster parents to takahe. Unlike purple swamphens, takahe do not possess good responses to terrestrial predators. This lack of response has caused serious declines in their populations since the introductions of mammalian predators. Bunin and Jamieson (1996) took one takahe chick and placed it with purple swamphens. This cross-fostered chicks grew up to display swamphen responses, including increased vigilance and tail flicking.

Positive Impacts: research and education; controls pest population

  • Gunn, M., Z. Champion, M. Casey, P. Teal, P. Casey. 2008. Testicular and spermatozoan parameters in the pukeko (Porphyrio porphyrio melanotus). Animal Reproduction Science, 109: 330-342.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Purple Swamphen

This article is about the old-world Purple Swamphen (Porphyrio porphyrio). For the new-world equivalent (Porphyrio martinicus), see American Purple Gallinule.

The Purple Swamphen Porphyrio porphyrio is a "swamp hen" in the rail family Rallidae. Also known locally as the Pūkeko, African Purple Swamphen, Purple Moorhen, Purple Gallinule or Purple Coot. From its French name talève sultane, it is also known as the Sultana Bird. This chicken-sized bird, with its huge feet, bright plumage and red bill and frontal shield is easily-recognisable in its native range.

Contents

Taxonomy and physical description

Porphyrio porphyrio melanotus in Wollongong Botanic Garden

There are 13 or more subspecies of the Purple Swamphen (depending on the authority) which differ mainly in plumage colour. The subspecies groups are: P. p. porphyrio in the Mediterranean, P. p. madagascariensis in Africa, P. p. poliocephalus in tropical Asia, P. p. melanotus in much of Australasia, P. p. indicus in Indonesia and P. p. pulverulentis in the Philippines. European birds are overall purple-blue, African and south Asian birds have a green back, and Australasian and Indonesian birds have black backs and heads.

The nominate subspecies, P. p. porphyrio (Linnaeus, 1758), is found in Iberia, France, Sardinia and North Africa to Tunisia. P. p. madagascariensis (Latham, 1801) occurs in Egypt, sub-Saharan Africa and Madagascar, and resembles the nominate but with bronze green or green-blue back and scapulars. P. p. caspius (Hartert, 1917) from the Caspian Sea area, is like poliocephalus, but larger.

P. p. seistanicus (Zarudny & Harms, 1911) occurs from Iraq to Pakistan, as poliocephalus, but larger; smaller than caspius. P. p. poliocephalus (Latham, 1801) is found from India and Sri Lanka to south China and north Thailand, and has been introduced to Florida. It has cerulean blue scapulars, face throat and breast. P. p. indicus (Horsfield, 1821) occurs from Sumatra to Sulawesi and Bali, and has a large shield, black upperparts, and the side of the head is blackish. P. p. virdis (Begbie, 1834) occurs in South East Asia, and resembles indicus but the side of the head is cerulean blue. P. p. pulverulentus (Temminck, 1826) from the Philippines has olive-chestnut mantle and scapulars, and the whole plumage is tinged with ash-grey.

P. p. melanotus (Temminck, 1820) occurs in north and east Australia, New Zealand and the surrounding islands. It has a small shield, shorter toes, black upperparts, and a purple throat and breast. P. p. pelewensis (Hartlaub & Finsch, 1872) from Palau, resembles melanotus but has greener upperparts and is smaller. P. p. melanopterus (Bonaparte, 1856) is found from the Lesser Sundas and Moluccas to New Guinea. It is as melanotus but smaller, more variable and less blue in the upperparts. P. p. bellus (Gould, 1820) from West Australia is as melanotus but has a cerulean blue throat and breast. P. p. samoensis (Peale, 1848) occurs from New Guinea to New Caledonia and Samoa, and is as melanotus but smaller, with a brown tinge on the back.

Some authorities separate various subspecies as full species, for example P. p. madagascariensis is split by Sinclair et al. as African Purple Swamphen, P. madagascariensis.

Ecology

Porphyrio porphyrio poliocephalus; in Coimbatore, Tamil Nadu, India

The species is highly dispersive. Purple Swamphens are considered to be the ancestors of several island species including the extinct Lord Howe Swamphen and two species of Takahē in New Zealand.[2][3] On islands where closely related species have become extinct or declined due to human interference, such as New Zealand or New Caledonia, this species has established itself relatively recently.[4]

Behaviour

The species makes loud, quick, bleating and hooting calls, which are hardly bird-like in tone. It is particularly noisy during the breeding season. Despite being clumsy in flight it can fly long distances, and it is a good swimmer, especially for a bird without webbed feet.

Breeding

Purple swamphen (P. p. melanotus) nesting.
Feeding chicks
Parent with a chick in New South Wales, Australia
Parent and juveniles in New Zealand

The Purple Swamphens are generally seasonal breeders, but the season varies across their large range, correlating with peak rainfall in many places, or summer in more temperate climes.[5] The Purple Swamphen breeds in warm reed beds. The male has an elaborate courtship display, holding water weeds in his bill and bowing to the female with loud chuckles.[6] In the western parts of the range the pattern of social behaviour tends to be monogamy, but cooperative breeding groups are more common in the eastern parts of the range. These groups may consist of multiple females and males sharing a nest or a male female pair with helpers drawn from previous clutches.[5]

Pairs nest in a large pad of interwoven reed flags, etc., on a mass of floating debris or amongst matted reeds slightly above water level in swamps, clumps of rushes in paddocks or long unkempt grass. Multiple females may lay in the one nest and share the incubation duties. Each bird can lay 3–6 speckled eggs, pale yellowish stone to reddish buff, blotched and spotted with reddish brown. A communal nest may contain up to 12 eggs. The incubation period is 23–27 days, and is performed by both sexes as well as any helpers that might be present. The precocious chicks are feathered with downy black feathers and able to leave the nest soon after hatching, but will often remain in the nest for a few days. Young chicks are fed by their parents (and group members) for between 10–14 days, after which they begin to feed themselves.[5]

Diet and feeding

Feeding in community near Hodal, Faridabad, Haryana, India.

The Purple Swamphen prefers wet areas with high rainfall, swamps, lake edges and damp pastures. The birds often live in pairs and larger communities. It clambers through the reeds, eating the tender shoots and vegetable-like matter. They have been known to eat eggs, ducklings, small fish and invertebrates such as snails. They have even been known to attack large eels, however there is no consensus amongst ornithologists if they actually eat eel. They will often use one foot to bring food to their mouth rather than eat it on the ground. Where they are not persecuted they can become tame and be readily seen in towns and cities.

Relationship with humans

Roman times

Evidence from Pliny the Elder and other sources shows that the Romans kept Purple Swamphens as decorative birds at large villas and expensive houses. They were regarded as noble birds and were among the few birds that Romans did not eat.

Polynesia

The common name in New Zealand, used for the subspecies P. p. melanotus, is the Māori language name Pūkeko. The purple swamphen was held in high regard as a chiefly pet in New Zealand and in Samoa, where it is called "manuali'i" (literally, "chiefly bird"). Red was the prized color of Polynesian aristocracy and while birds with red plumage (such as the Red-tailed Tropicbird, some Hawaiian honeycreepers like the 'i'iwi' and Maroon Shining Parrot) were highly prized, the swamphen was unique in deriving its prestige not from plumage but from its reddish face, beak, and legs. In old Samoa only chiefs could keep such birds as pets, and early European sailors noticed tethered and/or caged swamphens treated by Samoan chiefs as tamed pets. Some Samoans also considered the swamphen to be the incarnation of a mischievous, aggressive demon called Vave (Corey & Shirley Muse, "The Birds and Birdlore of Samoa," 1982). There is no tradition of swamphens being taken as sport game or poultry food, except perhaps in time of necessity.

Escapes and introductions

The Purple Swamphen is occasionally recorded as an escape from captivity in Britain and elsewhere.

The Purple Swamphen was introduced to North America in the late 1990s due to avicultural escapes in the Pembroke Pines, Florida area. State wildlife biologists attempted to eradicate the birds, but they have multiplied and can now be found in many areas of southern Florida. Ornithological authorities consider it likely that the swamphen will become an established part of Florida's avifauna.[7] It was added to the American Birding Association checklist in February 2013.[8] These Florida birds are mostly or entirely of the gray-headed race poliocephalus, native to the area around the Caspian Sea.

Status and conservation

The species is considered to be Least Concern globally by the IUCN. While the species as a whole is not threatened, some subspecies have declined. In New Zealand and Australia it has expanded due to the creation of new artificial lakes and ponds, but the nominate race in the Mediterranean has declined due to habitat loss, hunting and pesticide use, and requires strict protection. In Portugal the species declined greatly in the 19th and 20th centuries, but has increased more recently thanks to protection and some reintroduction schemes, although it remains rare and has a fragmented distribution.[9] In Africa it varies from being common to being uncommon. The subspecies endemic to Palau has been considered endangered as well,[5] although a 2005 survey found that the subspecies, while potentially threatened, is at least now still common.[10]

References

  1. ^ BirdLife International (2012). "Porphyrio porphyrio". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Trewick, S.A. (1996). "Morphology and evolution of two takahe: flightless rails of New Zealand". Journal of Zoology 238 (2): 221–237. doi:10.1111/j.1469-7998.1996.tb05391.x. 
  3. ^ Trewick, S.A. (1997). "Flightlessness and Phylogeny amongst Endemic Rails (Aves: Rallidae) of the New Zealand Region". Philosophical Transactions: Biological Sciences 352 (1352): 429–446. doi:10.1098/rstb.1997.0031. PMC 1691940. PMID 9163823. 
  4. ^ Steadman D, (2006). Extinction and Biogeography in Tropical Pacific Birds, University of Chicago Press. ISBN 978-0-226-77142-7
  5. ^ a b c d Taylor, P.B. (1996): Family Rallidae (Rails, Gallinules and Coots). In: del Hoyo, Josep; Elliott, Andrew & Sargatal, Jordi (eds.) : Handbook of Birds of the World Vol. 3 (Hoatzin to Auks): 197, Lynx Edicions, Barcelona. ISBN 84-87334-20-2
  6. ^ Ali, Salim; JC Daniel (1983). The book of Indian Birds, Twelfth Centenary edition. Bombay Natural History Society/Oxford University Press. 
  7. ^ Pranty, Bill, Kim Schnitzius, Kevin Schnitzius, and Helen W. Lovell. 2000. Discovery, distribution, and origin of the Purple Swamphen (Porphyrio porphyrio) in Florida.' Florida Field Naturalist 28: 1–11.
  8. ^ Floyd, Ted (13 FEB 2013). "#977, Purple Swamphen!". American Birding Association. Retrieved 13FEB2013. 
  9. ^ Pacheco, Carlos; Peter K. McGregor (2004). "Conservation of the purple gallinule (Porphyrio porphyrio L.) in Portugal: causes of decline, recovery and expansion". Biological Conservation 119 (1): 15–120. doi:10.1016/j.biocon.2003.11.001. 
  10. ^ Vanderwerf, Eric; Wiles, Gary; Marshall, Ann & Melia Knetch (2006). "Observations of migrants and other birds in Palau, April–May 2005, including the first Micronesian record of a Richard’s Pipit". Micronesica 39 (1): 11–29. ISSN 0026-279X. 
  • Leo, Roger (2006). 'Shorebirds in Art: Looking at history through the purple swamphen'. Sanctuary: The Journal of the Massachusetts Audubon Society, Summer 2006, 45 (4):18-19
  • Moon, Geoff (1994) The Reed field guide to New Zealand birds, ISBN -X
  • Taylor, Barry and Van Perlo, Ber Rails (a volume in the Helm Identification Guides series) ISBN
  • Ian Sinclair, Phil Hockey and Warwick Tributon, SASOL Birds of Southern Africa (Struik 2002) ISBN
  • Mike Clary, "State aims to eradicate exotic purple swamphens in wetlands," South Florida Sun-Sentinel, Sept. 8 2007
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!