Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

The Kelp Gull breeds on coasts and islands through much of the southern hemisphere. It is found on a number of subantarctic islands, on the Antarctic peninsula, on the southern coast of Australia and all of New Zealand, on the southern cost of Africa and Madagascar, and on the coast of South America as far north as Ecuador and southern Brazil1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Length: 56-60 cm. Plumage: wings and back black; rest of plumage white; white training edge to wing. Immature mottled brownish grey on white, back and wings grey brown, below whiter with less mottling. Bare parts: iris light grey to straw yellow or hazel; eyering orange to red; bill bright yellow with red near tip of lower mandible; feet and legs greenish with darker joints. Habitat: estuaries, coastal beaches, off-shore waters; rare inland. Breeding resident in southern Africa, vagrant elsewhere. <389><391><393>
  • Urban, E.K., C.H. Fry & S. Keith (1986). The Birds of Africa, Volume II. Academic Press, London.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Although this species is largely sedentary some southern populations migrate north after the breeding season (del Hoyo et al. 1996). The species breeds between late-September and January (del Hoyo et al. 1996, Hockey et al. 2005) in colonies of up to several hundred pairs (occasionally nesting solitarily) (del Hoyo et al. 1996) and remains gregarious outside of the breeding season (Hockey et al. 2005). Habitat It inhabits sheltered coastal (Higgins and Davies 1996, del Hoyo et al. 1996) harbours, bays, inlets, estuaries, beaches and rocky shores (Higgins and Davies 1996), usually foraging within 10 km of the shore but also following fishing boats beyond the continental shelf (Higgins and Davies 1996, del Hoyo et al. 1996). It may forage and roost in near-coastal inland habitats including lagoons (Higgins and Davies 1996, Hockey et al. 2005), lakes, swampy basins, rivers, streams (Higgins and Davies 1996), reservoirs (del Hoyo et al. 1996), pastures (Higgins and Davies 1996, del Hoyo et al. 1996), cultivated land, tussock grassland, scrubland and cleared areas in pine plantations (Higgins and Davies 1996). It often also forages around abattoirs, fish- or seafood-factories and at sewage outfalls (del Hoyo et al. 1996). The species will form breeding colonies in a number of locations including headlands (Higgins and Davies 1996, del Hoyo et al. 1996), sea cliffs (Higgins and Davies 1996, del Hoyo et al. 1996, Hockey et al. 2005), rocky outcrops, stacks (Higgins and Davies 1996, Hockey et al. 2005), offshore islands (Higgins and Davies 1996, del Hoyo et al. 1996, Hockey et al. 2005), low sandy, pebbly or rocky beaches, spits or islands (Higgins and Davies 1996, del Hoyo et al. 1996) in estuaries and lagoons (Hockey et al. 2005), on reefs, peninsulas, mudflats, sandbanks (Higgins and Davies 1996) and occasionally on the roofs of coastal buildings or in salt and sewage works (Hockey et al. 2005). Locally (e.g. in New Zealand) it may also breed inland on flat rocky mountaintops near permanent water (Higgins and Davies 1996). Diet Its diet consists of molluscs (e.g. mussels, cuttlefish Sepia spp. and terrestrial snails), echinoderms (del Hoyo et al. 1996, Hockey et al. 2005), sponges (Hockey et al. 2005), arthropods (e.g. swarming termites, crabs, isopods, amphipods) (del Hoyo et al. 1996, Hockey et al. 2005), macrozooplankton (Hockey et al. 2005), fish, worms, reptiles (del Hoyo et al. 1996) (e.g. snakes) (Hockey et al. 2005), amphibians (del Hoyo et al. 1996) (e.g. frogs) (Hockey et al. 2005), small mammals (del Hoyo et al. 1996, Hockey et al. 2005), birds (del Hoyo et al. 1996) and berries (Hockey et al. 2005). The species also scavenges refuse, sewage and carrion (del Hoyo et al. 1996, Hockey et al. 2005). Breeding site The nest is a bulky structure of dried plants or seaweed (del Hoyo et al. 1996) placed on bare rock, sand or mud substrates (Higgins and Davies 1996, del Hoyo et al. 1996) in well-vegetated sites (del Hoyo et al. 1996) (with grasses, sedge, rushes and other herbaceous plants) (Higgins and Davies 1996) at the base of bushes, trees, rocks (del Hoyo et al. 1996), walls (Hockey et al. 2005) or other vertical structures (del Hoyo et al. 1996). Breeding habitats include headlands (Higgins and Davies 1996, del Hoyo et al. 1996), sea cliffs (Higgins and Davies 1996, del Hoyo et al. 1996, Hockey et al. 2005), rocky outcrops, stacks (Higgins and Davies 1996, Hockey et al. 2005), offshore islands (Higgins and Davies 1996, del Hoyo et al. 1996, Hockey et al. 2005), reefs, peninsulas, mudflats, sandbanks (Higgins and Davies 1996), the roofs of coastal buildings, salt and sewage works, guano platforms, shipwrecks (Hockey et al. 2005) and above the high water mark on low sandy, pebbly or rocky beaches (Higgins and Davies 1996, del Hoyo et al. 1996), spits or islands (Higgins and Davies 1996) in estuaries and lagoons (Hockey et al. 2005). Locally (e.g. in New Zealand) it may also breed inland on flat rocky mountaintops near permanent water (Higgins and Davies 1996). Management information Attaching high-visibility plastic cones to trawler warp cables can significantly reduce the mortality and bycatch of this species due to trawler fisheries (Gonzalez-Zevallos et al. 2007).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 61 specimens in 1 taxon.
Water temperature and chemistry ranges based on 32 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.122 - 5.152
  Nitrate (umol/L): 17.448 - 28.640
  Salinity (PPS): 33.745 - 34.182
  Oxygen (ml/l): 7.057 - 8.188
  Phosphate (umol/l): 1.444 - 1.997
  Silicate (umol/l): 7.861 - 76.480

Graphical representation

Temperature range (°C): -1.122 - 5.152

Nitrate (umol/L): 17.448 - 28.640

Salinity (PPS): 33.745 - 34.182

Oxygen (ml/l): 7.057 - 8.188

Phosphate (umol/l): 1.444 - 1.997

Silicate (umol/l): 7.861 - 76.480
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Larus dominicanus preys on:
Bivalvia
Fissurellidae
limpets
Gastropoda
Neoloricata
Decapoda
Concholepas concholepas
Acanthocyclus

Based on studies in:
Chile, central Chile (Littoral, Rocky shore)

This list may not be complete but is based on published studies.
  • J. C. Castilla, Perspectivas de investigacion en estructura y dinamica de communidades intermareales rocosas de Chile Central. II. Depredadores de alto nivel trofico, Medio Ambiente 5(1-2):190-215, from p. 203 (1981).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding Category

Breeding
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Larus dominicanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGATTATTTTCAACAAACCACAAAGATATCGGCACCTTATACTTAATCTTTGGCGCATGAGCTGGCATAGTAGGTACTGCCCTCAGCCTGCTTATCCGTGCAGAACTTGGCCAACCCGGAACCCTCCTAGGAGAC---GACCAAATCTATAACGTAATTGTCACCGCCCATGCCTTCGTGATAATCTTCTTCATAGTGATACCAATCATGATCGGTGGGTTTGGAAACTGACTAGTCCCACTTATAATCGGTGCCCCTGATATAGCATTTCCACGCATAAACAACATAAGCTTCTGACTATTACCCCCATCATTCCTACTCCTCCTAGCCTCTTCCACAGTAGAAGCTGGAGCCGGCACAGGATGAACAGTATACCCCCCTCTAGCTGGCAATCTAGCCCATGCTGGAGCCTCAGTAGACCTAGCAATCTTCTCTCTTCACTTAGCAGGTGTGTCTTCCATTCTGGGTGCTATCAACTTTATCACTACAGCCATCAACATAAAACCCCCTGCCCTCTCACAATATCAAACCCCACTATTCGTATGATCCGTACTCATCACTGCCGTCCTATTACTACTTTCACTCCCAGTGCTTGCCGCAGGCATTACTATGCTACTTACAGACCGAAACCTAAACACAACATTCTTCGATCCCGCCGGAGGCGGTGACCCTGTACTGTACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTATACATCCTAATCCTACCAGGCTTCGGAATCATCTCTCATGTTGTAACATACTACGCAGGTAAAAAAGAGCCATTTGGCTACATAGGAATAGTCTGAGCCATACTATCCATCGGATTCCTAGGTTTCATTGTCTGAGCTCACCACATGTTTACAGTCGGAATAGACGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Larus dominicanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population is estimated to number 3,300,000-4,300,000 individuals.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species is potentially threatened by future marine oil spills (Parsons and Underhill 2005), and is susceptible to avian cholera (Hockey et al. 2005, Leotta et al. 2006) and avian botulism (Blaker 1967, Hockey et al. 2005) so may be threatened by future outbreaks of these diseases. The species also suffers mortality from interactions with trawler warp cables (Argentina) (Gonzalez-Zevallos et al. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

IUCN Red List Category

Least Concern
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Kelp gull

"Karoro" redirects here. For the suburb of Greymouth, see Karoro, New Zealand.

The kelp gull (Larus dominicanus), also known as the Dominican gull, is a gull which breeds on coasts and islands through much of the southern hemisphere. The nominate L. d. dominicanus is the subspecies found around South America, parts of Australia (where it overlaps with the Pacific gull), and New Zealand (where it is known as the southern black-backed gull or by its Māori name karoro). L. d. vetula (known as the Cape gull) is a subspecies occurring around southern Africa.

The specific name comes from the Dominican Order of friars, who wore black and white habits.[2]

A kelp gull nest with two eggs, Patagonia, Argentina

Description[edit]

Adult and two chicks in New Zealand
Juvenile in New Zealand

The kelp gull superficially resembles two gulls from further north in the Atlantic Ocean the lesser black-backed gull and the great black-backed gull. The kelp is intermediate in size between these two species. This species ranges from 54 to 65 cm (21 to 26 in) in total length, from 128 to 142 cm (50 to 56 in) in wingspan and from 540 to 1,390 g (1.19 to 3.06 lb) in weight. Adult males and females weigh on average 1,000 g (2.2 lb) and 900 g (2.0 lb) respectively. Among standard measurements, the wing chord is 37.3 to 44.8 cm (14.7 to 17.6 in), the bill is 4.4 to 5.9 cm (1.7 to 2.3 in) and the tarsus is 5.3 to 7.5 cm (2.1 to 3.0 in).[3][4][5] The adult kelp gull has black upperparts and wings. The head, underparts, tail and the small "mirrors" at the wing tips are white. The bill is yellow with a red spot, and the legs are greenish-yellow (brighter and yellower when breeding, duller and greener when not breeding). The call is a strident ki-och. Juveniles have dull legs, a black bill, a dark band in the tail, and an overall grey-brown plumage densely edged whitish, but they rapidly get a pale base to the bill and largely white head and underparts. They take three or four years to reach maturity.

The African subspecies L. d. vetula is sometimes split as the Cape gull, L. vetula. It has a more angular head and a smaller shorter bill. The adult has a dark eye, whereas the nominate kelp gull usually has a pale eye. Young Cape gulls have almost identical plumage to similarly aged kelp gulls.

Behaviour[edit]

Kelp kulls are omnivores like most Larus gulls, and they will scavenge as well as seeking suitable small prey. It gathers on landfills and a sharp increase in its population is therefore considered as an indicator for a degraded environment.[6] Kelp gulls have been observed feeding on live right whales since at least 1996.[7] The kelp gull uses its powerful beak to peck down centimetres into the skin and blubber, often leaving the whales with large open sores, some of which have been observed to be half a meter in diameter. This predatory behavior has been continually documented in Argentinian waters, and continues today.[8] At rocky sites along the southern African coast, such as at Boulders Beach in Cape Town, kelp gulls (Larus dominicanus vetula) can be seen picking up shellfish and repeatedly flying up several meters and dropping them onto the rocks below in order to break them open.[9]

The nest is a shallow depression on the ground lined with vegetation and feathers. The female usually lays 2 or 3 eggs. Both parents feed the young birds.

Various views and plumages[edit]

Cape gull (Larus dominicanus vetula or Larus vetula)[edit]

The Cape gull differs from other forms of kelp gulls by its immaculate white tail and dark eye.

References[edit]

  1. ^ BirdLife International (2012). "Larus dominicanus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "Shelly Farr Biswell", "Southern Black-Backed Gulls", New Zealand Geographic, number 73, May–June 2005
  3. ^ Gulls: Of North America, Europe, and Asia by Klaus Malling Olsen & Hans Larsson. Princeton University Press (2004). ISBN 978-0691119977.
  4. ^ Harrison, Peter, Seabirds: An Identification Guide. Houghton Mifflin Harcourt (1991), ISBN 978-0-395-60291-1
  5. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  6. ^ Cf. José Felipe M. Pereira, Aves e Pássaros Comuns do Rio de Janeiro, Rio de Janeiro: Technical Books, ISBN 978-85-61368-00-5, pg.55
  7. ^ Increased harassment of Right Whales (Eubalaena australis) by Kelp Gulls (Larus dominicanus) at Península Valdés, Argentina. Rowntree, V.J., P. MacGuiness, K. Marshall, R. Payne, J. Seger, and M. Sironi, 1998. Marine Mammal Science. 14(1): 99 - 115. doi:10.1111/j.1748-7692.1998.tb00693.x
  8. ^ Gulls' vicious attacks on whales. BBC News, June 24, 2009.
  9. ^ Siegfried WR (1977) Mussel dropping behaviour of Kelp Gulls. S Afr J Sci 73:337 - 341
  • Ian Sinclair, Phil Hockey and Warwick Tarboton, SASOL Birds of Southern Africa (Struik 2002) ISBN 1-86872-721-1
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!