Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Brief Summary

Biology

Upon reaching the breeding territory after migration, males begin to call repeatedly for many hours in order to attract a female. After selecting a male, females then choose a nest site (2). Nests are constructed on the ground from dead stems and leaves amongst patches of nettles (Urtica) or other tall vegetation. The female lays one to two eggs per day and the typical clutch size is eight to twelve eggs. The male leaves the female before egg laying is complete, and attempts to attract another female. Females generally produce a second brood by the beginning of July. During the breeding season corncrakes feed on invertebrates taken from plants or from the ground (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Male and female corncrakes are very similar in appearance; both have light yellowish-brown plumage, and the face and upper parts of the breast are pale grey. In flight their long dangling legs, chestnut wings and buff coloured underparts are visible. The corncrake is easier to hear than to see, the call is a repeated rasping 'crrek crrek' similar to a nail scraping along a comb (2). The scientific name of this species, crex crex refers to this call (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 27-30 cm, envergure 46-53 cm, poids 120-230 g.

L’habitat est constitué de milieux herbacés suffisamment hauts (> 20 cm) et denses pour s’y cacher, sans toutefois que la végétation puisse constituer un frein aux déplacements de l’oiseau. De nos jours, les habitats typiques sont des milieux secondaires exploités par l’homme, notamment les prairies inondables de fauche. Les plus fortes densités sont observées là où les pratiques agricoles sont les moins intensives, une fauche tardive et un taux de mécanisation bas favorisant une reproduction régulière.

Le Râle des genêts est omnivore. Il se nourrit préférentiellement de petits invertébrés et complète son alimentation avec de jeunes pousses, des graines et de jeunes grenouilles. La composition spécifique du régime alimentaire présente de fortes variations régionales.

L’espèce est généralement solitaire mais les nids peuvent être à moins de 100 m les uns des autres. Les mâles parcourent de grandes distances en journée, visitant les territoires des mâles voisins. Ils rejoignent les places de chant peu avant le coucher du soleil et s’y tiennent toute la nuit. La structure de végétation y est généralement différente de l’habitat environnant (souvent plus haute : tas de roseaux couchés, buissons isolés…). Les mâles isolés peuvent chanter toute la nuit, alors que les oiseaux appariés chantent de manière intermittente. Lors d’une intrusion par un concurrent, le mâle s’efforce de le chasser par le chant, ce qui génère des joutes vocales où les oiseaux se voient rarement. Si le recul n’est pas obtenu, des combats violents peuvent avoir lieu.

Le Râle des genêts est polyandre et polygyne. Le nid est au sol dans la végétation dense. C’est une coupe d’herbes sèches qui ne dépasse pas 15 cm de diamètre. La ponte débute en mai, avec une seconde ponte en juillet qui produit des jeunes s’envolant en septembre. L’intervalle de temps entre deux œufs pondus est en moyenne de 18 h, ce qui est le plus court intervalle connu pour un non-passereau. Les poussins nidifuges sont surveillés par la femelle seule, le mâle l’ayant généralement quittée peu avant l’incubation. En cas de danger, ils s’enfuient dans différentes directions. Les juvéniles sont volants à l’âge de 35 jours.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Crex crex breeds in Europe and central Asia, as far east as western China, and winters in sub-Saharan Africa. There were recently estimated to be 1.3-2 million breeding pairs in Europe (including 1-1.5 million pairs in European Russia) (BirdLife International 2004), higher than the 1.1-1.8 million pairs in Europe previously estimated (Schffer and Mammen 1999), which were in turn significantly higher than the 92,000-233,000 estimated in 1996, the difference resulting from the completion of the first systematic surveys of national populations in eastern Europe and Russia. A further 515,000-1,240,000 pairs are estimated for Asiatic Russia (Schffer and Mammen 1999), yielding a global total of 1.815-3.24 million pairs and 5.45-9.72 million individuals. Given the high level of uncertainty in some of the breeding estimates and the apparent scarcity of the species in its non-breeding areas in sub-Saharan Africa, the total population may fall at the lower end of this range; even in the low millions. Whilst some of these populations may be increasing, population trends are unclear and often show large fluctuations (K. Koffijberg in litt. 2007) in response to changes in agricultural practices or annual rainfall (A. Mischenko in litt. 2006). Historically, most west European range states have seen major declines, which continued in some countries during 1990-2000 but were reversed elsewhere (BirdLife International 2004). The population in the UK recently increased, from 480 calling males in 1993 to 1,245 calling males in 2007, in response to conservation action (P. Walton in litt. 2006, K. Koffijberg in litt. 2007), although numbers have since dipped to 1,098 in 2009 (RSPB 2010). Many western European states have observed a partial recovery since 1997, but dominated by large fluctuations (K. Koffijberg in litt. 2007). In Finland the population in 2003-2008 averaged around five times that in the 1990s (T. Lehtiniemi in litt. 2010). Monitoring since 2002 in 13 regions and republics in Russia (which holds the vast majority of the global population) indicates that numbers have remained stable or are even increasing (with some fluctuations due to extreme weather) (A. Mischenko in litt. 2010). Whilst it is difficult to accurately predict future trends owing to the species's extensive range, and differing climatic and agricultural conditions in different regions, it is thought that populations in key parts of the range in Russia and Kazakhstan are unlikely to change dramatically in the near future, although agricultural intensification and abandonment may drive some regional declines, and the species's conservation status in much of the western part of its range remains unfavourable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Palearctic; winters Mediterranean to Africa and Madagascar.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

A globally threatened summer visitor, the corncrake was once widespread throughout the UK and much of northern and central Europe, extending to Siberia. Within this former range the corncrake is now restricted, and occurs in fragmented populations. In the UK it is currently found mainly in the Northern and Western islands of Scotland. The species winters in south-eastern Africa and migrates to Europe in spring (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour The species is a long-distance migrant (Del Hoyo et al. 1996). It breeds during the months of April-August, with nests generally well separated but sometimes only 20-55m apart from one another (Taylor and van Perlo 1998). It is sequentially polygynous, with some males moving a considerable distance to new singing areas (Green et al. 1997). A male's territory may encompass several nests (Taylor and van Perlo 1998), and local concentrations of breeding birds therefore sometimes occur (Taylor and van Perlo 1998). The species normally produces two broods per year. It begins to leave its breeding grounds in August, with a peak in September (Cramp and Simmons 1980), and arrives on its African wintering grounds in November-December (Cramp and Simmons 1980). It migrates at night, travelling at low altitude (Del Hoyo et al. 1996). During migration it sometimes travels in pairs (Cramp and Simmons 1980), occasionally forming groups of around 20-40 individuals (Taylor and van Perlo 1998), and diurnally resting flocks may contain several hundred birds (Taylor and van Perlo 1998). It occurs solitarily during the non-breeding season, individual birds holding territories of 4-9ha (Taylor and van Perlo 1998). The return migration begins in late February or March, and the breeding grounds are occupied from mid-April (Cramp and Simmons 1980). Habitat Breeding The species breeds in open or semi-open habitats, mainly meadows with tall grass. The original breeding habitat would almost certainly have been riverine meadows of Carex-Iris-Typhoides and alpine, coastal and fire-created grasslands with few trees or bushes present (Green et al. 1997). The species is now strongly associated with agricultural grassland managed for the production of hay (Barnes 2000). Suitable habitats include moist, unfertilised grassland and regularly cut meadows in areas of low-intensity agriculture where vegetation grows tall in summer. Across its European range, hay or silage fields in valleys liable to flooding seem of most importance, but birds also breed in hay and silage fields in subalpine areas. Wetlands and marsh edges may act as important refuges when drier habitats are unsuitable. Males are also found singing in clear-cuts in forest, pastures and young conifer plantations. Singing males can regularly be heard in fertilised meadows or fields sown with cereals, but successful reproduction here is thought to be infrequent (Schffer and Mammen 1999). In Bulgaria radio tracking showed that the two broods are produced in different locations, the second brood at a significantly higher altitude than the first one, thus benefiting from delayed vegetation development and later hay mowing at higher altitudes (Niemann 1995). It avoids very marshy areas, standing water, river and lake margins and open ground with rocks, stones and gravel (Del Hoyo et al. 1996), and also those areas with a thick layer of dead grass or very dense vegetation above 50cm tall (Cramp and Simmons 1980). Adults move to areas of high herbage along ditches to moult after breeding (Taylor and van Perlo 1998): embankments or fallow areas adjacent to the breeding habitat are very important as moulting sites (Taylor and van Perlo 1998). Non-breeding During migration it occurs in a variety of habitats including wheat fields and on golf courses (Taylor and van Perlo 1998). In the wintering grounds dry grassland and savanna are preferred with birds also occurring in rank grass near rivers, sewage ponds and pools and in relatively short grass in wetter areas, moist sedgebeds and reedbeds and in tall grass within young conifer plantations (Barnes 2000). It also occurs in Eragrostis hayfields, old land and pastures, maize fields bounded by grass, fallow and abandoned cultivation uncut grass on airfields, and the edges of sugarcane (Barnes 2000). It occurs where vegetation is between 30cm and 2m in height, and often in areas that are burnt during the dry season (Taylor and van Perlo 1998). Diet It feeds on a wide range of invertebrates, including taxa living on plants, on the soil surface and in the soil (Green et al. 1997). It takes a large number and wide variety of insects (Cramp and Simmons 1980), as well as snails and slugs, arachnids, millipedes, earthworms, young frogs, green parts of plants, young shoots and seeds and possibly even small mammals and birds (Cramp and Simmons 1980). Breeding site The nest is on the ground in dense vegetation and is constructed from dead stems and leaves (Green et al. 1997). Often surrounding stems are pulled over the top to form a loose canopy (Del Hoyo et al. 1996). The average clutch-size is c.10 eggs and two broods may be raised per season (Green et al. 1997).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Most corncrakes are found in traditionally managed agricultural grasslands. They require tall grasses or herbs of at least 20 centimetres in height so that they can be concealed at all times. Occasionally crops such as barley or oats will be used later in summer (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite
imago of Icosta minor ectoparasitises Crex crex

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crex crex

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATAAATCGATGATTATTCTCAACCAACCACAAAGACATCGGAACACTTTACTTAATTTTTGGAGCATGGGCCGGAATAATTGGTACCGCCCTCAGCCTACTTATTCGAGCAGAACTAGGACAGCCTGGCACCCTATTAGGAGATGACCAAATTTATAATGTAATCGTTACTGCTCATGCCTTCGTAATAATCTTTTTCATAGTAATACCAATTATAATTGGAGGGTTCGGCAATTGACTAGTCCCTCTCATAATTGGAGCACCAGACATAGCCTTCCCCCGCATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCCTTCCTACTCCTCCTAGCATCTTCCACAGTAGAAGCAGGAGCAGGGACAGGATGAACAGTTTATCCCCCATTAGCTGGTAACCTAGCCCATGCAGGAGCCTCAGTAGATTTAGCTATCTTCTCACTCCACCTAGCAGGTGTATCATCCATCCTAGGCGCAATTAATTTCATCACAACAGCTATTAATATAAAACCACCGGCTTTATCACAATATCAAACCCCCCTATTCGTATGATCTGTCCTCATCACAGCCGTTCTCCTACTACTATCCCTCCCCGTCCTCGCTGCAGGAATTACCATACTCCTAACCGACCGTAATCTAAACACCACATTCTTCGACCCCGCTGGAGGAGGAGACCCAATCCTATATCAACACCTTTTCTGATTCTTCGGACACCCAGAAGTTTACATCCTAATTCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Crex crex

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Baha El Din, S., Decueninck, B., Delov, V., Demeter, L., Demko, M., Donaghy, A., Eken, G., Ellermaa, M., Elts, J., Flade, M., Folvik, A., Green, R., Ibrahim, W., Inderwildi, E., Kamp, J., Keiss, O., Kirwan, G., Koffijberg, K., Lehtiniemi, T., Mischenko, A., Oien, I., Papp, T., Pomeroy, D., Sandor, A., Schffer, N., Sultanov, E., Szab, Z. & Walton, P.

Justification
Data from ongoing (albeit modest) monitoring in Russia (which holds the vast majority of the global population) indicate that the predicted declines have not taken place and that numbers have remained stable since 2002 or are even increasing. Whilst it is difficult to accurately predict future trends owing to the species's extensive range and differing climatic and agricultural conditions in different regions, it is thought that populations in key parts of the range in Russia and Kazakhstan are unlikely to change dramatically in the near future. The species has consequently been reclassified as Least Concern because global population declines approaching 30% (predicted in 2004) have not taken place, and there is little evidence to suggest that they will do so in the next 11 years (three generations). The reclassification has taken place on the basis of improved knowledge of the species's global extinction risk, as opposed to a genuine recovery to favourable conservation status across its range. The species remains a high conservation priority in significant parts of its range (at both national and regional levels), and continued conservation interventions, research and monitoring are essential. Evidence of a downturn in its fortunes or adequately documented projections of imminent rapid declines would warrant a further review of its status.


History
  • Least Concern (LC)
  • Near Threatened (NT)
  • Near Threatened (NT)
  • Near Threatened (NT)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Threatened (T)