Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Brief Summary

Biology

Upon reaching the breeding territory after migration, males begin to call repeatedly for many hours in order to attract a female. After selecting a male, females then choose a nest site (2). Nests are constructed on the ground from dead stems and leaves amongst patches of nettles (Urtica) or other tall vegetation. The female lays one to two eggs per day and the typical clutch size is eight to twelve eggs. The male leaves the female before egg laying is complete, and attempts to attract another female. Females generally produce a second brood by the beginning of July. During the breeding season corncrakes feed on invertebrates taken from plants or from the ground (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Male and female corncrakes are very similar in appearance; both have light yellowish-brown plumage, and the face and upper parts of the breast are pale grey. In flight their long dangling legs, chestnut wings and buff coloured underparts are visible. The corncrake is easier to hear than to see, the call is a repeated rasping 'crrek crrek' similar to a nail scraping along a comb (2). The scientific name of this species, crex crex refers to this call (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Palearctic; winters Mediterranean to Africa and Madagascar.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Crex crex breeds in Europe and central Asia, as far east as western China, and winters in sub-Saharan Africa. There were recently estimated to be 1.3-2 million breeding pairs in Europe (including 1-1.5 million pairs in European Russia)6, higher than the 1.1-1.8 million pairs in Europe previously estimated2, which were in turn significantly higher than the 92,000-233,000 estimated in 1996, the difference resulting from the completion of the first systematic surveys of national populations in eastern Europe and Russia. A further 515,000-1,240,000 pairs are estimated for Asiatic Russia2, yielding a global total of 1.815-3.24 million pairs and 5.45-9.72 million individuals. Given the high level of uncertainty in some of the breeding estimates and the apparent scarcity of the species in its non-breeding areas in sub-Saharan Africa, the total population may fall at the lower end of this range; even in the low millions. Whilst some of these populations may be increasing, population trends are unclear and often show large fluctuations9 in response to changes in agricultural practices or annual rainfall14. Historically, most west European range states have seen major declines, which continued in some countries during 1990-2000 but were reversed elsewhere6. The population in the UK recently increased, from 480 calling males in 1993 to 1,245 calling males in 2007, in response to conservation action9,15, although numbers have since dipped to 1,098 in 200921. Many western European states have observed a partial recovery since 1997, but dominated by large fluctuations9. In Finland the population in 2003-2008 averaged around five times that in the 1990s22. Monitoring since 2002 in 13 regions and republics in Russia (which holds the vast majority of the global population) indicates that numbers have remained stable or are even increasing (with some fluctuations due to extreme weather)20. Whilst it is difficult to accurately predict future trends owing to the species's extensive range, and differing climatic and agricultural conditions in different regions, it is thought that populations in key parts of the range in Russia and Kazakhstan are unlikely to change dramatically in the near future, although agricultural intensification and abandonment may drive some regional declines, and the species's conservation status in much of the western part of its range remains unfavourable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

A globally threatened summer visitor, the corncrake was once widespread throughout the UK and much of northern and central Europe, extending to Siberia. Within this former range the corncrake is now restricted, and occurs in fragmented populations. In the UK it is currently found mainly in the Northern and Western islands of Scotland. The species winters in south-eastern Africa and migrates to Europe in spring (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour The species is a long-distance migrant16. It breeds during the months of April-August, with nests generally well separated but sometimes only 20-55m apart from one another17. It is sequentially polygynous, with some males moving a considerable distance to new singing areas7. A male's territory may encompass several nests17, and local concentrations of breeding birds therefore sometimes occur17. The species normally produces two broods per year. It begins to leave its breeding grounds in August, with a peak in September18, and arrives on its African wintering grounds in November-December18. It migrates at night, travelling at low altitude16. During migration it sometimes travels in pairs18, occasionally forming groups of around 20-40 individuals17, and diurnally resting flocks may contain several hundred birds17. It occurs solitarily during the non-breeding season, individual birds holding territories of 4-9ha17. The return migration begins in late February or March, and the breeding grounds are occupied from mid-April18. Habitat Breeding The species breeds in open or semi-open habitats, mainly meadows with tall grass. The original breeding habitat would almost certainly have been riverine meadows of Carex-Iris-Typhoides and alpine, coastal and fire-created grasslands with few trees or bushes present7. The species is now strongly associated with agricultural grassland managed for the production of hay1. Suitable habitats include moist, unfertilised grassland and regularly cut meadows in areas of low-intensity agriculture where vegetation grows tall in summer. Across its European range, hay or silage fields in valleys liable to flooding seem of most importance, but birds also breed in hay and silage fields in subalpine areas. Wetlands and marsh edges may act as important refuges when drier habitats are unsuitable. Males are also found singing in clear-cuts in forest, pastures and young conifer plantations. Singing males can regularly be heard in fertilised meadows or fields sown with cereals, but successful reproduction here is thought to be infrequent2. In Bulgaria radio tracking showed that the two broods are produced in different locations, the second brood at a significantly higher altitude than the first one, thus benefiting from delayed vegetation development and later hay mowing at higher altitudes19. It avoids very marshy areas, standing water, river and lake margins and open ground with rocks, stones and gravel16, and also those areas with a thick layer of dead grass or very dense vegetation above 50cm tall18. Adults move to areas of high herbage along ditches to moult after breeding17: embankments or fallow areas adjacent to the breeding habitat are very important as moulting sites17. Non-breeding During migration it occurs in a variety of habitats including wheat fields and on golf courses17. In the wintering grounds dry grassland and savanna are preferred with birds also occurring in rank grass near rivers, sewage ponds and pools and in relatively short grass in wetter areas, moist sedgebeds and reedbeds and in tall grass within young conifer plantations1. It also occurs in Eragrostis hayfields, old land and pastures, maize fields bounded by grass, fallow and abandoned cultivation uncut grass on airfields, and the edges of sugarcane1. It occurs where vegetation is between 30cm and 2m in height, and often in areas that are burnt during the dry season17. Diet It feeds on a wide range of invertebrates, including taxa living on plants, on the soil surface and in the soil7. It takes a large number and wide variety of insects18, as well as snails and slugs, arachnids, millipedes, earthworms, young frogs, green parts of plants, young shoots and seeds and possibly even small mammals and birds18. Breeding site The nest is on the ground in dense vegetation and is constructed from dead stems and leaves7. Often surrounding stems are pulled over the top to form a loose canopy16. The average clutch-size is c.10 eggs and two broods may be raised per season7.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Most corncrakes are found in traditionally managed agricultural grasslands. They require tall grasses or herbs of at least 20 centimetres in height so that they can be concealed at all times. Occasionally crops such as barley or oats will be used later in summer (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite
imago of Icosta minor ectoparasitises Crex crex

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crex crex

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATAAATCGATGATTATTCTCAACCAACCACAAAGACATCGGAACACTTTACTTAATTTTTGGAGCATGGGCCGGAATAATTGGTACCGCCCTCAGCCTACTTATTCGAGCAGAACTAGGACAGCCTGGCACCCTATTAGGAGATGACCAAATTTATAATGTAATCGTTACTGCTCATGCCTTCGTAATAATCTTTTTCATAGTAATACCAATTATAATTGGAGGGTTCGGCAATTGACTAGTCCCTCTCATAATTGGAGCACCAGACATAGCCTTCCCCCGCATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCCTTCCTACTCCTCCTAGCATCTTCCACAGTAGAAGCAGGAGCAGGGACAGGATGAACAGTTTATCCCCCATTAGCTGGTAACCTAGCCCATGCAGGAGCCTCAGTAGATTTAGCTATCTTCTCACTCCACCTAGCAGGTGTATCATCCATCCTAGGCGCAATTAATTTCATCACAACAGCTATTAATATAAAACCACCGGCTTTATCACAATATCAAACCCCCCTATTCGTATGATCTGTCCTCATCACAGCCGTTCTCCTACTACTATCCCTCCCCGTCCTCGCTGCAGGAATTACCATACTCCTAACCGACCGTAATCTAAACACCACATTCTTCGACCCCGCTGGAGGAGGAGACCCAATCCTATATCAACACCTTTTCTGATTCTTCGGACACCCAGAAGTTTACATCCTAATTCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Crex crex

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
BirdLife International

Reviewer/s
Burfield, I., Symes, A., Butchart, S.

Contributor/s
Kirwan, G., Delov, V., Kamp, J., Baha El Din, S., Eken, G., Szabó, Z., Decueninck, B., Demeter, L., Elts, J., Green, R., Papp, T., Koffijberg, K., Ellermaa, M., Sandor, A., Donaghy, A., Oien, I., Pomeroy, D., Walton, P., Sultanov, E., Folvik, A., Flade, M., Lehtiniemi, T., Schäffer, N., Inderwildi, E., Mischenko, A., Demko, M., Keiss, O., Ibrahim, W.

Justification
Data from ongoing (albeit modest) monitoring in Russia (which holds the vast majority of the global population) indicate that the predicted declines have not taken place and that numbers have remained stable since 2002 or are even increasing. Whilst it is difficult to accurately predict future trends owing to the species's extensive range and differing climatic and agricultural conditions in different regions, it is thought that populations in key parts of the range in Russia and Kazakhstan are unlikely to change dramatically in the near future. The species has consequently been reclassified as Least Concern because global population declines approaching 30% (predicted in 2004) have not taken place, and there is little evidence to suggest that they will do so in the next 11 years (three generations). The reclassification has taken place on the basis of improved knowledge of the species's global extinction risk, as opposed to a genuine recovery to favourable conservation status across its range. The species remains a high conservation priority in significant parts of its range (at both national and regional levels), and continued conservation interventions, research and monitoring are essential. Evidence of a downturn in its fortunes or adequately documented projections of imminent rapid declines would warrant a further review of its status.

History
  • 2008
    Near Threatened
  • 2006
    Near Threatened
  • 2004
    Near Threatened
  • 2000
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List 2007. Listed under Annex 1 of the EC Birds Directive and Appendix II of the Bern Convention. Included in the Birds of Conservation Concern Red List, and protected under Schedule 1 of the Wildlife and Countryside Act 1981 in the UK (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
BirdLife International (2004) estimated 1.3-2 million breeding pairs in Europe (including 1-1.5 million pairs in European Russia). This is higher than the 1.1-1.8 million pairs in Europe previously estimated by Schäffer and Mammen 1999). A further 515,000-1,240,000 pairs are estimated for Asiatic Russia (Schäffer and Mammen 1999), yielding a global total of 1.815-3.24 million pairs and 5.45-9.72 million individuals. Given the high level of uncertainty in some of the breeding estimates and the apparent scarcity of the species in its non-breeding areas in sub-Saharan Africa, the total population may fall at the lower end of this range; even in the low millions.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Chick mortality due to mechanized mowing and consequent increased predation is considered to be the primary threat in Europe11. Intensification of grassland management and the loss of hay meadows and wetlands are considered as the critical threats to its habitats11. Following privatisation, potential changes to land-use and management of agricultural land in the species's core breeding range in Russia and eastern Europe are also possible threats2. Land abandonment temporarily favours the species, but areas become unsuitable as vegetation becomes too dense and scrub develops. Intensified management of hay meadows, or their conversion to arable, is resulting in widespread habitat loss2. Across western and central Europe, intensification of grassland management, leading to earlier and rapid mowing of hay and silage, is the main threat5. Early mowing and the use of mechanised methods results in the destruction of nests and chicks11. It is a quarry species in Russia, Ukraine and Georgia, but hunting pressure is considered low. Illegal hunting of the species during the Common Quail Coturnix coturnix hunting season has been reported from Bulgaria and Croatia, and 0.5-2.7% of the European population may be susceptible to capture in netting set up for C. coturnix in Egypt each autumn. Introduced mammals, such as domestic cats and the American mink Mustela vison, are reported to be predators of the species's nests, in addition to native species. The species may be disturbed by recreational activities and developments, such as motorways11. Late spring floods can reduce local populations by around 50%12.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The decline in the UK was first noticed in the south and east of England during the late 19th century; it continued into the 20th century and became more severe. After the 1930s corncrakes were lost from most of England, southern Wales and from large areas of Scotland. They are currently fairly common only in the northern and western islands of Scotland. This decline coincided with the increased use of farm machinery to cut hay meadows. Meadows were also cut earlier, which caused massive losses of adults, juveniles and nests. Other causes of the decline include loss of habitat due to conversion of grassland to arable and sheep pasture, or unsuitable management such as over-grazing. Disturbance and predation by domestic and feral cats and mink may also cause significant losses (3). Between 1978 and 1979 there were just 730 to 750 calling males in the UK; by 1993 this had fallen to 478, but by 2001 there were around 630 (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
CMS (Bonn Convention) Appendix II. Bern Convention Appendix II. EU Birds Directive Annex I. The species is legally protected from hunting in most of the countries in its breeding range11. Conservation measures have been taken in 14 European range states. National action plans have been prepared in Switzerland, Norway, the Netherlands, Czech Republic, Hungary, Germany, Denmark, UK, and Slovakia. Appropriate habitat management techniques have been researched, and local repeat surveys in Russia show relative stability of the population14. A European action plan was published in 1996 and a revised version published in 200611, and a Corncrake Conservation Team was established in 1998. There is an ongoing reintroduction programme in England, UK13.

Conservation Actions Proposed
Monitor numbers through regular coordinated surveys, and improve monitoring in key countries (e.g. Russia, Belarus)8,11. Monitor habitat condition and extent8,11. Ensure that agri-environmental measures for the species in the EU are well targeted and implemented, and focus on mowing date and methods suitable for the species. Increase the area of suitable habitat with protected status. Restore lost habitat where possible. Conduct further research into the species's ecology and demography11. Work with farmers and land managers to ensure that traditional farming methods are retained, areas of grass are left uncut and harvest times are delayed8. Monitor levels of illegal trapping and hunting11. Lobby governments in remaining countries where it is not protected to afford the species legal protection11.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The latest corncrake survey in 1998 estimated that there were 589 calling males in the UK. This indicates that the population is beginning to increase in response to conservation measures. These measures include agri-environment schemes that pay farmers to manage their fields in ways that benefit the corncrake, such as cutting the meadows later to prevent losses, and maintaining crop rotation systems that create a mosaic of habitat types. It has been suggested that cutting should proceed from the centre of a field outwards as this minimises losses; in addition, leaving uncut patches at the field margins provides shelter for juveniles during the harvest. Over ten percent of the British corncrake population is located within RSPB managed land, and ten of these sites have been managed specifically for the species. In addition, nine corncrake Special Protection Areas (SPAs) were established in 1998 (3). The corncrake is a UK Biodiversity Action Plan (UK BAP) species; the Species Action Plan aims to maintain the population, increase its range and in the long-term, restore the species to parts of its former UK range (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Corn Crake

The Corn Crake, Corncrake or Landrail (Crex crex) is a bird in the rail family. It breeds in Europe and Asia as far east as western China, and migrates to Africa for the northern hemisphere's winter. It is a medium-sized crake with buff- or grey-streaked brownish-black upperparts, chestnut markings on the wings, and blue-grey underparts with rust-coloured and white bars on the flanks and undertail. The strong bill is flesh-toned, the iris is pale brown, and the legs and feet are pale grey. The juvenile is similar in plumage to the adult, and the downy chicks are black, as with all rails. There are no subspecies, although individuals from the east of the breeding range tend to be slightly paler than their western counterparts. The male's call is a loud krek krek, from which the scientific name is derived. The Corn Crake is larger than its closest relative, the African Crake, which shares its wintering range; that species is also darker-plumaged, and has a plainer face.

The Corn Crake's breeding habitat is grassland, particularly hayfields, and it uses similar environments on the wintering grounds. This secretive species builds a nest of grass leaves in a hollow in the ground and lays 6–14 cream-coloured eggs that are covered with rufous blotches. These hatch in 19–20 days, and the black precocial chicks fledge after about five weeks. This crake is in steep decline across much of its former breeding range because modern farming practices often destroy nests before breeding is finished. The Corn Crake is omnivorous, but mainly feeds on invertebrates, the occasional small frog or mammal, and plant material including grass seed and cereal grain. Natural threats include introduced and feral mammals, large birds, and various parasites and diseases.

Although numbers have declined steeply in western Europe, this bird is classed as Least Concern on the IUCN Red List because of its huge range and large, apparently stable, populations in Russia and Kazakhstan.[1] Numbers in western China are more significant than previously thought, and conservation measures have facilitated an increase in population in some of the countries which had suffered the greatest losses. Despite its elusive nature, the loud call has ensured that the Corn Crake has been noted in literature, and garnered a range of local and dialect names.

Contents

Taxonomy [edit]

The rails are a bird family comprising nearly 150 species. Although the origins of the group are lost in antiquity, the largest number of species and the least specialised forms are found in the Old World, suggesting that this family originated there. The taxonomy of the small crakes is complicated, but the closest relative of the Corn Crake is the African Crake, C. egregia, which has sometimes been given its own genus, Crecopsis, but is now more usually placed in Crex.[3][4] Both species are short-billed brown birds with a preference for grassland rather the wetland habitats typical of rails. Porzana crakes, particularly the Ash-throated Crake (Porzana albicollis) are near relatives of the Crex genus.[5]

The Corn Crake was first described by Linnaeus in his Systema Naturae in 1758 as Rallus crex,[6] but was subsequently moved to the genus Crex, created by German naturalist and ornithologist Johann Matthäus Bechstein in 1803, and named Crex pratensis.[7] The earlier use of crex gives it priority over Bechstein's specific name pratensis, and leads to the current name of Crex crex.[8] The binomial name, Crex crex, from the Ancient Greek "κρεξ", is onomatopoeic, referring to the crake's repetitive grating call.[9][10] The common name was formerly spelt as a single word, "Corncrake", but the official version is now "Corn Crake". The English names refer to the habit of the species of nesting in dry hay or cereal fields, rather than the marshes used by most members of this family.[11]

Description [edit]

The Corn Crake is a medium-sized rail, 27–30 cm (10.6–11.8 in) long with a wingspan of 42–53 cm (16.5–20.9 in). Males weigh 165 g (5.8 oz) on average and females 145 g (5.1 oz). The adult male has the crown of its head and all of its upperparts brown-black in colour, streaked with buff or grey. The wing coverts are a distinctive chestnut colour with some white bars. The face, neck and breast are blue-grey, apart from a pale brown streak from the base of the bill to behind the eye, the belly is white, and the flanks, and undertail are barred with chestnut and white. The strong bill is flesh-coloured, the iris is pale brown, and the legs and feet are pale grey. Compared to the male, the female has warmer-toned upperparts and a narrower duller eye streak. Outside the breeding season, the upperparts of both sexes become darker and the underparts less grey. The juvenile is like the adult in appearance, but has a yellow tone to its upperparts, and the grey of the underparts is replaced with buff-brown. The chicks have black down, as with all rails. While there are no subspecies, all populations show great individual variation in colouring, and the birds gradually become paler and greyer towards the east of the range. Adults undergo a complete moult after breeding, which is normally finished by late August or early September, before migration to south eastern Africa. There is a pre-breeding partial moult prior to the return from Africa, mainly involving the plumage of the head, body and tail. Young birds have a head and body moult about five weeks after hatching.[12]

The Corn Crake is sympatric with the African Crake on the wintering grounds, but can be distinguished by its larger size, paler upperparts, tawny upperwing and different underparts pattern. In flight, it has longer, less rounded wings, and shallower wingbeats than its African relative, and shows a white leading edge to the inner wing. In both the breeding and wintering ranges it is unlikely to be confused with any other rails, since sympatric species are smaller, with white markings on the upperparts, different underparts patterns and shorter bills. A flying Corn Crake can resemble a gamebird, but its chestnut wing pattern and dangling legs are diagnostic.[12]

Voice [edit]

On the breeding grounds, the male Corn Crake's advertising call is a loud, repetitive, grating krek krek normally delivered from a low perch with the bird's head and neck almost vertical and its bill wide open. The call can be heard from 1.5 km (1 mi) away, and serves to establish the breeding territory, attract females, and challenge intruding males. Slight differences in vocalisations mean that individual males can be distinguished by their calls. Early in the season, the call is given almost continuously at night, and often during the day too.[12] It may be repeated more than 20,000 times a night, with a peak between midnight and 3 am.[13] The call has evolved to make a singing male's location clear, as this species hides in vegetation.[14] The frequency of calling reduces after a few weeks, but may intensify again near the end of the laying period before falling away towards the end of the breeding season. To attract males, mechanical imitations of their call can be produced by rubbing a piece of wood down a notched stick, or by flicking a credit card against a comb or zip-fastener.[13] The male also has a growling call, given with the bill shut and used during aggressive interactions.[12]

The female Corn Crake may give a call similar to that of the male, but additionally has a distinctive barking sound, with a similar rhythm to the main call, but lacking the grating quality.[15] The female also has a high-pitched cheep call, and a oo-oo-oo sound to call the chick. The chicks make a quiet peeick-peeick contact call, and a chirp used to beg for food.[12] Because of the difficulty in seeing this species, it is usually censused by counting males calling between 11 pm and 3 am;[16] the birds do not move much at night, whereas they may wander up to 600 m (650 yd) during the day, which could lead to double-counting if monitored then.[17] Identifying individual males suggests that just counting calling birds underestimates the true count by nearly 30%, and the discrepancy is likely to be greater, since only 80% of males may call at all on a given night.[18] The Corn Crake is silent in Africa.[19]

Distribution and habitat [edit]

Field of hay with green field beyond
Hayfields are the preferred nesting habitat.

The Corn Crake breeds from Britain and Ireland east through Europe to central Siberia. Although it has vanished from much of its historic range, this bird was once found in suitable habitats in Eurasia everywhere between latitudes 41°N and 62°N.[20] There is also a sizable population in western China,[21] but this species nests only rarely in northern Spain and in Turkey. Old claims of breeding in South Africa are incorrect, and result from misidentification of eggs in a museum collection which are actually those of the African Rail.

The Corn Crake winters mainly in Africa, from the Democratic Republic of the Congo and central Tanzania south to eastern South Africa. North of this area, it is mainly seen on migration, but occasionally winters in North Africa and to the west and north of its core area in southeast Africa. Most of the South African population of about 2,000 birds occurs in KwaZulu-Natal and the former Transvaal Province, and numbers elsewhere in Africa are uncertain. There are several nineteenth-century records, when populations were much higher than now, of birds being seen in western Europe, mainly Britain and Ireland, between December and February.[22]

Old painting of two adults with a black, downy chick
Adults and young

This crake migrates to Africa along two main routes: a western route through Morocco and Algeria, and a more important flyway through Egypt. On passage, it has been recorded in most countries between its breeding and wintering ranges, including much of West Africa.[12] Birds from Coll following the western route paused in West Africa on their way further south, and again on the return flight, when they also rested in Spain or North Africa.[23] Eastern migrants have been recorded in those parts of southern Asia that lie between the east of the breeding range and Africa. Further afield, the Corn Crake has been recorded as a vagrant to Sri Lanka, Vietnam and Australia,[21] the Seychelles,[24] Bermuda,[25] Canada, the US, Greenland,[12] Iceland, the Faroes, the Azores, Madeira, and the Canary Islands.[22]

The Corn Crake is mainly a lowland species, but breeds up to 1,400 m (4,600 ft) altitude in the Alps, 2,700 m (8,600 ft) in China and 3,000 m (9,800 ft) in Russia.[21][22] When breeding in Eurasia, the Corn Crake's habitats would originally have included river meadows with tall grass and meadow plants including sedges and irises. It is now mainly found in cool moist grassland used for the production of hay, particularly moist traditional farmland with limited cutting or fertiliser use. It also utilises other treeless grasslands in mountains or taiga, on coasts, or where created by fire. Moister areas like wetland edges may be used, but very wet habitats are avoided, as are open areas and those with vegetation more than 50 cm (20 in) tall, or too dense to walk through. The odd bush or hedge may be used as a calling post. Grassland which is not mown or grazed becomes too matted to be suitable for nesting, but locally crops such as cereals, peas, rape, clover or potatoes may be used. After breeding, adults move to taller vegetation such as common reed, iris, or nettles to moult, returning to the to hay and silage meadows for the second brood.[12] In China, flax is also used for nest sites.[21] Although males often sing in intensively managed grass or cereal crops, successful breeding is uncommon, and nests in the field margins or nearby fallow ground are more likely to succeed.[20]

When wintering in Africa, the Corn Crake occupies dry grassland and savanna habitats, occurring in vegetation 30–200 cm (1–6 ft) tall, including seasonally burnt areas and occasionally sedges or reed beds. It is also found on fallow and abandoned fields, uncut grass on airfields, and the edges of crops. It occurs at up to at least 1,750 m (5,700 ft) altitude in South Africa.[12] Each bird stays within a fairly small area.[23] Although it sometimes occurs with the African Crake, that species normally prefers moister and shorter grassland habitats than does the Corn Crake.[26] On migration, the Corn Crake may also occur in wheatfields and around golf courses.[12]

Behaviour [edit]

upstretched head and neck
Adult

The Corn Crake is a difficult bird to see in its breeding sites, usually being hidden by vegetation, but will sometimes emerge into the open. Occasionally, individuals may become very trusting; for five consecutive summers, an individual crake on the Scottish island of Tiree entered a kitchen to feed on scraps, and, in 1999, a wintering Barra bird would come for poultry feed once the chickens had finished.[13] In Africa, it is more secretive than the African Crake, and, unlike its relative, it is rarely seen in the open, although it occasionally feeds on tracks or road sides. The Corn Crake is most active early and late in the day, after heavy rain and during light rain. Its typical flight is weak and fluttering, although less so than that of the African Crake. For longer flights, such as migration, it has a steadier, stronger action with legs drawn up. It walks with a high-stepping action, and can run swiftly through grass with its body held horizontal and laterally flattened. It will swim if essential. When flushed by a dog, it will fly less than 50 m (150 ft), frequently landing behind a bush or thicket, and then crouch on landing. If disturbed in the open, this crake will often run in a crouch for a short distance, with its neck stretched forward, then stand upright to watch the intruder. When captured it may feign death, recovering at once if it sees a way out.[12]

The Corn Crake is solitary on the wintering grounds, where each bird occupies 4.2–4.9 ha (10.4–11.6 acres) at one time, although the total area used may be double that, since an individual may move locally due to flooding, plant growth, or grass cutting. Flocks of up to 40 birds may form on migration, sometimes associating with Common Quails. Migration takes place at night, and flocks resting during the day may aggregate to hundreds of birds at favoured sites.[12] The ability to migrate is innate, not learned from adults. Chicks raised from birds kept in captivity for ten generations were able to migrate to Africa and return with similar success to wild-bred young.[27]

Breeding [edit]

cream-coloured egg with red-brown blotches
Illustration of a Corn Crake egg

Until 1995, it was assumed that the Corn Crake is monogamous, but it transpires that a male may have a shifting home range, and mate with two or more females, moving on when laying is almost complete. The male's territory can vary from 3 to 51 ha (7.5–126 acres), but averages 15.7 ha (39 acres). The female has a much smaller range, averaging only 5.5 ha (13.5 acres). A male will challenge an intruder by calling with his wings drooped and his head pointing forward. Usually the stranger moves off; if it stays, the two birds square up with heads and necks raised and the wings touching the ground. They then run around giving the growling call and lunging at each other. A real fight may ensue, with the birds leaping at each other and pecking, and sometimes kicking. Females play no part in defending the territory.

The female may be offered food by the male during courtship. He has a brief courtship display in which the neck is extended and the head held down, the tail is fanned, and the wings are spread with the tips touching the ground. He will then attempt to approach the female from behind, and then leap on her back to copulate. The nest is typically in grassland, sometimes in safer sites along a hedge, or near an isolated tree or bush, or in overgrown vegetation. Where grass is not tall enough at the start of the season, the first nest may be constructed in herby or marsh vegetation, with the second brood in hay.[12] The second nest may also be at a higher altitude that the first, to take advantage of the later-developing grasses further up a hill.[28] The nest, well hidden in the grass, is built in a scrape or hollow in the ground. It is made of woven coarse dry grass and other plants, and lined with finer grasses.[29] Although nest construction is usually described as undertaken by the female,[22] a recent aviary study found that in the captive population the male always built the nest.[30]

The nest is 12–15 cm (5–6 in) in diameter and 3–4 cm (1–1.5 in) deep. The clutch is 6–14, usually 8–12 eggs; these are oval, slightly glossy, creamy or tinted with green, blue or grey, and blotched red-brown. They average 37 × 26 mm, (1.5 × 1.0 in) and weigh about 13–16 g, (0.46–0.56 oz),[12] of which 7% is shell.[31] The eggs are laid at daily intervals, but second clutches may sometimes have two eggs added per day. Incubation is by the female only; her tendency to sit tight when disturbed, or wait until the last moment to flee, leads to many deaths during hay-cutting and harvesting. The eggs hatch together after 19–20 days, and the precocial chicks leave the nest within a day or two. They are fed by the female for three or four days, but can find their own food thereafter. The juveniles fledge after 34–38 days. The second brood is started about 42 days after the first, and the incubation period is slightly shorter at 16–18 days. The grown young may stay with the female until departure for Africa.

Nest success in undisturbed sites is high, at 80–90%, but much lower in fertilised meadows and on arable land. The method and timing of mowing is crucial; mechanized mowing can kill 38–95% of chicks in a given site, and losses average 50% of first brood chicks and somewhat less than 40% of second brood chicks.[12] The influence of weather on chick survival is limited; although chick growth is faster in dry or warm weather, the effects are relatively small. Unlike many precocial species, chicks are fed by their mother to a greater or lesser extent until they become independent, and this may cushion them from adverse conditions. The number of live chicks hatched is more important than the weather, with lower survival in large broods.[32] The annual adult survival rate is under 30%,[31][33] although some individuals may live for 5–7 years.[34]

Feeding [edit]

The Corn Crake is omnivorous, but mainly feeds on invertebrates, including earthworms, slugs and snails, spiders, beetles, dragonflies, grasshoppers and other insects. In the breeding areas, it is a predator of Sitona weevils, which infest legume crops.[12] and in the past consumed large amounts of the former grassland pests, leatherjackets and wireworms.[35] This crake will also eat small frogs and mammals, and plant material including grass seed and cereal grain. Its diet on the wintering grounds is generally similar, but includes locally available items such as termites, cockroaches and dung beetles. Food is taken from the ground, low-growing plants and from inside grass tussocks; the crake may search leaf litter with its bill, and run in pursuit of active prey. Hunting is normally in cover, but, particularly in the wintering areas, it will occasionally feed on grassy tracks or dirt roads.[12] Indigestible material is regurgitated as 1 cm (0.5 in) pellets.[22] Chicks are fed mainly on animal food, and when fully grown they may fly with the parents up to 6.4 km (4 mi) to visit supplementary feeding areas. As with other rails, grit is swallowed to help break up food in the stomach.[12][36]

Predators and parasites [edit]

large black and white stork
The White Stork will kill chicks exposed by early mowing.

Predators on the breeding grounds include feral and domestic cats, introduced American mink, feral ferrets, otters and red foxes, and birds including the Common Buzzard and Hooded Crow.[12] In Lithuania, the introduced Raccoon Dog has also been recorded as taking Corn Crakes. When chicks are exposed by rapid mowing, they may be taken by large birds including the White Stork, harriers and other birds of prey, gulls and corvids.[37] At undisturbed sites nests and broods are rarely attacked, as reflected in a high breeding success. There is a record of a Corn Crake on migration through Gabon being killed by a Black Sparrowhawk.[12]

The widespread fluke Prosthogonimus ovatus, which lives in the oviducts of birds, has been recorded in the Corn Crake,[38] as have the parasitic worm Plagiorchis elegans,[39] the larvae of parasitic flies,[40] and hard ticks of the genera Haemaphysalis and Ixodes.[41]

During the reintroduction of Corn Crakes to England in the 2003 breeding season, enteritis and ill heath in pre-release birds was due to bacteria of a pathogenic Campylobacter species. Subsequently, microbiology tests were done to detect infected individuals and to find the source of the bacteria in their environment.[42]

Status [edit]

Old photo of hay wagonTractor in crops
The move from manual to mechanised hay-making has seriously threatened the European breeding population.

Until 2010, despite a breeding range estimated at 12,400,000 km2 (4,800,000 mi2), the Corn Crake was classified as Near Threatened on the IUCN Red List because of serious declines in Europe, but improved monitoring in Russia indicates that anticipated losses there have not occurred and numbers have remained stable or possibly increased. It is therefore now classed as Least Concern, since the major populations in Russia and Kazakhstan are not expected to change much in the short term. There are an estimated 1.3–2.0 million breeding pairs in Europe, three-quarters of which are in European Russia, and a further 515,000–1,240,000 pairs in Asiatic Russia; the total Eurasian population has been estimated at between 5.45 and 9.72 million individuals. In much of the western half of its range, there have been long-term declines that are expected to continue, although conservation measures have enabled numbers to grow in several countries, including a five-fold increase in Finland, and a doubling in the UK.[28] In the Netherlands, there were 33 breeding territories in 1996, but this number had increased to at least 500 by 1998.[43]

The breeding Corn Crake population had begun to decline in the 19th century, but the process gained pace after World War II.[44] The main cause of the steep declines in much of Europe is the loss of nests and chicks from early mowing. Haymaking dates have moved forward in the past century due to faster crop growth, made possible by land drainage and the use of fertilisers, and the move from manual grass-cutting using scythes to mechanical mowers, at first horse-drawn and later pulled by tractors. Mechanisation also means that large areas can be cut quickly, leaving the crake with no alternative sites to raise either a first brood if suitable habitat has gone, or a replacement brood if the first nest is destroyed.[37] The pattern of mowing, typically in a circular pattern from the outside of a field to its centre, gives little chance of escape for the chicks, which are also exposed to potential animal predators. Adults can often escape the mowers, although some incubating females sit tight on the nest, with fatal results.[12]

page of recipe book
Mrs Beeton's recipe

Loss of habitat is the other major threat to the Corn Crake. Apart from the reduced suitability of drained and fertilised silage fields compared to traditional hay meadows, in western Europe the conversion of grassland to arable has been aided by subsidies, and further east the collapse of collective farming has led to the abandonment and lack of management of much land in this important breeding area.[37] More localised threats include floods in spring,[45] and disturbance by roads or wind farms.[37] This bird is good eating; when they were common in England, Mrs Beeton recommended roasting four on a skewer.[46] More significant than direct hunting is the loss of many birds, up to 14,000 a year, in Egypt, where migrating birds are captured in nets set for the quail with which they often migrate.[13] Although this may account for 0.5–2.7% of the European population, the losses to this form of hunting are less than when the targeted species were more numerous and predictable.[47]

Most European countries have taken steps to conserve the Corn Crake and produce national management policies; there is also an overall European action plan. The focus of conservation effort is to monitor populations and ecology and to improve survival, principally through changing the timing and method of hay harvesting.[28] Later cutting gives time for breeding to be completed, and leaving uncut strips at the edges of fields and cutting from the centre outwards reduces the casualties from mowing.[12] Implementing these changes is predicted to stop the population decline if the measures are applied on a sufficiently large scale.[48] Reduction of illegal hunting, and protection in countries where hunting is still allowed, are also conservation aims.[28] Reintroduction of the Corn Crake is being attempted in England, and breeding sites are scheduled for protection in many other countries.[49] Where breeding sites impinge on urban areas, there are cost implications, estimated in one German study at several million euros per Corn Crake.[50] The Corn Crake does not appear to be seriously threatened on its wintering grounds and may benefit from deforestation, which creates more open habitats.[26]

In culture [edit]

Most rails are secretive wetland birds that have made little cultural impression, but as a formerly common farmland bird with a loud nocturnal call that sometimes led to disturbed sleep for rural dwellers, the Corn Crake has acquired a variety of folk names and some commemoration in literature.[13]

Names [edit]

old drawing of a Corn Crake
Land Rail, by Thomas Bewick

The favoured name for this species among naturalists has changed over the years, with "Landrail" and variants of "Corncrake" being preferred at various times. "Crake Gallinule" also had a period of popularity between 1768 and 1813.[51] The originally Older Scots "Cornecrake" was popularised by Thomas Bewick, who used this term in his 1797 A History of British Birds.[52] Other Scots names include "Corn Scrack" and "Quailzie"; the latter term, like "King of the Quail",[52] "Grass Quail",[53] and the French "roi de caille" refer to the association with the small gamebird.[13] Another name, "Daker", has been variously interpreted as onomatopoeic,[54] or derived from the Old Norse Ager-hoene, meaning "Cock of the field";[52] variants include "Drake", "Drake Hen" and "Gorse Drake".[55]

In literature [edit]

Corn Crakes are the subject of three stanzas of the seventeenth century poet Andrew Marvell's "Upon Appleton House", written in 1651 about the North Yorkshire country estate of Thomas Fairfax. The narrator depicts the scene of a mower cutting the grass, before his "whistling Sithe" unknowingly carves the Rail. The farmhand draws out the scythe "all bloody from its breast" and "does the stroke detest". It continues with a stanza that demonstrates the problematic nature of the Corn Crake's nesting habits:[56]

Unhappy Birds! What does it boot
To build below the Grass' Root;
When Lowness is unsafe as Hight,
And Chance o'ertakes, what scapeth spight?

John Clare, the nineteenth-century English poet based in Northamptonshire, wrote "The Landrail", a semi-comic piece which is primarily about the difficulty of seeing Corn Crakes – as opposed to hearing them. In the fourth verse he exclaims: "Tis like a fancy everywhere/A sort of living doubt". Clare wrote about Corn Crakes in his prose works too, and his writings help to clarify the distribution of this rail when it was far more widespread than now.[57]

The proverbial use of the Corn Crake's call to describe someone with a grating or unmelodious voice is illustrated in the quotation "thanks to a wee woman with a voice like a corncrake who believed she was an apprentice angel".[58] This usage dates from at least the first half of the nineteenth century,[59] and continues through to the present.[60]

References [edit]

  1. ^ a b BirdLife International (2012). "Crex crex". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Stone, Witmer (1894). "A Review of the Old World Rallinae". Proceedings of the Academy of Natural Sciences of Philadelphia 46: 130–149. 
  3. ^ Taylor & van Perlo (2000) p. 30
  4. ^ Livezey (1998) p. 2098
  5. ^ Livezey (1998) p. 2134
  6. ^ Linnaeus, Carolus (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata (in Latin) 1. Holmiae (Stockholm): Laurentii Salvii. p. 153. 
  7. ^ Bechstein, Johann Matthäus (1803). Ornithologisches Taschenbuch von und für Deutschland oder kurze Beschreibung aller Vogel Deutschlands, vol 2 (in German). Leipzig: Richter. p. 336. 
  8. ^ Sclater, Philip Lutley (1896). "Remarks on the divergencies between the "Rules for naming Animals" of the German Zoological Society and the Stricklandian Code of Nomenclature". Proceedings of the Zoological Society of London 54 (2): 306–319. 
  9. ^ Wood, John George (1855). The Illustrated Natural History. London: G Routledge. p. 302. 
  10. ^ Smith, John Maynard; Harper, David (2003). Animal Signals. Oxford: Oxford University Press. p. 11. ISBN 0-19-852685-7. 
  11. ^ "Bustards to Limpkin". IOC World Bird List. International Ornithologists' Union. Retrieved 5 June 2011. 
  12. ^ a b c d e f g h i j k l m n o p q r s t u v Taylor & van Perlo (2000) pp. 320–327
  13. ^ a b c d e f Cocker, Mark; Mabey, Richard (2005). Birds Britannica. London: Chatto & Windus. pp. 178–180. ISBN 0-7011-6907-9. 
  14. ^ Osiejuk, Tomasz S; Olech, Bogumia (2004). "Amplitude spectra of Corncrake calls: what do they signalise?". Animal Biology 54 (2): 207–220. doi:10.1163/1570756041445218. 
  15. ^ Ottvall, Richard (1999). "Female Corncrake (Crex crex) singing in the wild" (PDF). Journal of Ornithology 140 (4): 453–456. doi:10.1007/BF01650989. 
  16. ^ Bibby, Colin J; Burgess, Neil D; Hill, David A; Mustoe, Simon; Lambton, Sandra (2000). Bird Census Techniques. Kidlington, Oxfordshire: Academic Press. p. 180. ISBN 978-0-12-095831-3. 
  17. ^ Hudson, Anne V; Stowe, Tim J; Aspinall, Simon J (1990). "Status and distribution of Corncrakes in Britain in 1988". British Birds 83 (5): 173–187. 
  18. ^ Peake, T M; McGregor, P K (2001). "Corncrake Crex crex census estimates: a conservation application of vocal individuality" (PDF). Animal Biodiversity and Conservation 24 (1): 81–90. 
  19. ^ Newman, Kenneth (2002). Newman's Birds of Southern Africa. Cape Town: Struik. pp. 120–122. ISBN 1-86872-735-1. 
  20. ^ a b Green, Rhys E; Rocamora, Gerard; Schäffer, Norbert (1997). "Populations, ecology and threats to the Corncrake Crex crex in Europe" (PDF). Vogelwelt 118: 117–134. 
  21. ^ a b c d Bräunlich, Axel; Rank, Michael (2001). "Notes on the occurrence of the Corncrake (Crex crex) in Asia and in the Pacific region". In Schäffer, N; Mammen, U (PDF). Proceedings International Corncrake Workshop 1998. Hilpoltstein, Germany. pp. 10–13. http://www.corncrake.net/Download/asia.pdf.
  22. ^ a b c d e Snow, David; Perrins, Christopher M (editors) (1998). The Birds of the Western Palearctic concise edition: vol 1. Oxford: Oxford University Press. pp. 496–499. ISBN 0-19-854099-X. 
  23. ^ a b Pitches, Adrian (2013). "Corn Crakes—a Scottisn conservation success story". British Birds 106 (5): 241–242. 
  24. ^ Skerrett, Adrian; Betts, Michael; Bullock, Ian; Fisher, David; Gerlach, Ron; Lucking, Rob; Phillips, John; Scott, Bob (2006). "Third report of the Seychelles Bird Records Committee". Bulletin of the African Bird Club 13 (1): 65–72. 
  25. ^ Bourne, W P R (1957). "The breeding birds of Bermuda". Ibis 99 (1): 94–105. doi:10.1111/j.1474-919X.1957.tb01935.x. 
  26. ^ a b Taylor & van Perlo (2000) pp. 316–320
  27. ^ Pain, Debbie; Green, Rhys; Clark, Nigel (2011). "Bird on the edge: can the Spoon-billed Sandpiper Eurynorhynchus pygmeus be saved?". BirdingASIA 15: 26–35. 
  28. ^ a b c d "BirdLife International Species factsheet: Crex crex ". BirdLife International. Retrieved 7 June 2011. 
  29. ^ Seebohm, Henry; edited posthumously by Richard Bowdler Sharpe (1896). Coloured Figures of the Eggs of British Birds. Sheffield: Pawson & Brailsford. p. 83. 
  30. ^ Graham, Jamie (2009). "Corn Crake pair-bonding and nesting behaviour". British Birds 102 (4): 217. 
  31. ^ a b "Corncrake Crex crex (Linnaeus, 1758)". BTOWeb BirdFacts. British Trust for Ornithology. Retrieved 12 June 2011. 
  32. ^ Tyler, G A; Green, Rhys E (2004). "Effects of weather on the survival and growth of Corncrake Crex crex chicks" (PDF). Ibis 146 (1): 69–76. doi:10.1111/j.1474-919X.2004.00225.x. 
  33. ^ Green, Rhys E (2004). "A new method for estimating the adult survival rate of the Corncrake Crex crex and comparison with estimates from ring-recovery and ring-recapture data" (PDF). Ibis 146 (3): 501–508. doi:10.1111/j.1474-919x.2004.00291.x. 
  34. ^ Hume, Rob; Royal Society for the Protection of Birds (2009). RSPB Complete Birds of Britain and Europe. London: Dorling Kindersley. p. 264. ISBN 1-4053-4589-6. 
  35. ^ Stone, Witmer (1932). "Collinge on the Corn-crake" (PDF). The Auk 49 (1): 126–127. doi:10.2307/4076773. 
  36. ^ Taylor & van Perlo (2000) pp. 39–41
  37. ^ a b c d Koffijberg & Schaffer (2006) p. 21
  38. ^ Rothschild, Miriam; Clay, Theresa (1953). Fleas, Flukes and Cuckoos. A Study of Bird Parasites. London: Collins. pp. 204–205. 
  39. ^ Yildirimhan, Hikmet S; Bursey Charles R; Altunel, F Naci (2011). "Helminth parasites of the Balkan green lizard, Lacerta trilineata Bedriaga 1886, from Bursa, Turkey" (PDF). Turkish Journal of Zoology 35 (3): 1–17. doi:10.3906/zoo-0910-1. 
  40. ^ Matyukhin, V; Krivosheina, M G (2008). "Contribution to the knowledge of Diptera (Insecta) parasitizing on birds". Entomological Review 88 (2): 258–259. doi:10.1134/S0013873808020115. 
  41. ^ Hoogstraal, Harry; Traylor, Melvin A; Gaber, Sobhy; Malakatis, George; Guindy, Ezzat; Helmy, Ibrahim (1964). "Ticks (Ixodidae) on migrating birds in Egypt, spring and fall 1962". Bulletin of the World Health Organisation 30 (3): 355–367. PMC 2554818. PMID 14163959. 
  42. ^ Mudenda, N; Sainsbury, A W; Macgregor, S K; Flach, E J; Owen, R J (2008). "Prevalence of Campylobacter species in corncrakes (Crex crex) in a reintroduction programme in the UK". Veterinary Record 163 (9): 274–275. doi:10.1136/vr.163.9.274. PMID 18757906. 
  43. ^ van den Berg, Arnoud B (1999). "European news 45". British Birds 92 (6): 278–300. 
  44. ^ Koffijberg & Schaffer (2006) p. 6
  45. ^ Donaghy, A (2007). "Corncrakes: a lot done, more to do". Wings 46: 26–27. 
  46. ^ Beeton, Isabella (1861). The Book of Household Management. London: S O Beeton. p. 210. 
  47. ^ Newton, Ian (2010). Bird Migration (Collins New Naturalist Library 113). London: Collins. p. 532. ISBN 0-00-730732-2. 
  48. ^ Green, Rhys E; Tyler, G A; Stowe, T J; Newton A V (1997). "A simulation model of the effect of mowing of agricultural grassland on the breeding success of the corncrake (Crex crex)". Journal of Zoology 243 (1): 81–115. doi:10.1111/j.1469-7998.1997.tb05758.x. 
  49. ^ Holden, Peter; Cleeves, Tim (2010). RSPB Handbook of British Birds. Robertsbridge, East Sussex: Christopher Helm. p. 110. ISBN 1-4081-2735-0. 
  50. ^ Matauschek, Jan Marcus (2005). "The impact of endangered species law on the real estate development process explored with cost-benefit analysis: The case of the corncrake in Hamburg/Germany" (PDF). German Working Papers in Law and Economics 2005 (Paper 7): 1–30. 
  51. ^ Lockwood (1984) p. 93
  52. ^ a b c Hull, Robin (2001). Scottish Birds: Culture and Tradition. Edinburgh: Mercat Press. p. 156. ISBN 1-84183-025-9. 
  53. ^ Coward, Thomas Alfred (1930). The Birds of the British Isles and their Eggs. London: Frederick Warne. p. 326. 
  54. ^ Lockwood (1984) p. 52
  55. ^ Lockwood (1984) p. 55
  56. ^ Smith, Nigel (2006). Marvell: The Poems of Andrew Marvell (Longman Annotated English Poets). London: Longman. p. 210. ISBN 978-1-4058-3283-0. 
  57. ^ Mynott, Jeremy (2009). Birdscapes: Birds in Our Imagination and Experience. Princeton: Princeton University Press. p. 1. ISBN 978-0-691-13539-7. 
  58. ^ Bell, John L (1998). States of Bliss & Yearning:. Glasgow: Wild Goose Publications. p. 86. ISBN 1-901557-07-3. 
  59. ^ Morgan, Sir Thomas Charles; Lady Morgan (1841). The Book Without a Name, Volume 1. New York: Wiley and Putnam. p. 162. 
  60. ^ Aston, Elizabeth (2005). The Exploits & Adventures of Miss Alethea Darcy. New York: Simon and Schuster. p. 198. ISBN 0-7432-6193-3. 

Cited texts [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!