Overview

Brief Summary

Meleagris gallopavo

An extremely large (36-48 inches) game bird, the Wild Turkey is most easily identified by its large size, bald bluish head, and iridescent black or brown body feathers. Male Wild Turkeys have large fan-like tails and red wattles on the neck, whereas females are much smaller and plainer. This species is nearly unmistakable among North America birds, although certain varieties of Domestic Turkey resemble their wild ancestors. The Wild Turkey is native to much of the eastern United States, southern Canada, and Mexico. However, its range has been in constant flux over the past 500 years as populations have locally been hunted to extinction or, conversely, introduced into new areas for sport shooting. Due to both factors, Wild Turkeys are absent from portions of the Atlantic Seaboard and upper Midwest but may be found locally in parts of the western U.S.where they did not occur before Europeans arrived in the New World. The Wild Turkey is the only native North American bird to be domesticated, and Domestic Turkeys are farmed around the world. Wild Turkeys inhabit a wide array of habitats, including deciduous woodland, dry scrub, and grassland. While this species is rarely found in urban or suburban areas, Wild Turkeys will visit agricultural fields and pastures. In fact, the ancestors of the Domestic Turkey likely became associated with humans through visiting maize fields in Mexico. This species primarily eats seeds, nuts, leaves, and insects. In forests, clearings, and more open habitats, it may be possible to observe Wild Turkeys standing or walking, singly or in small groups, while foraging for food. The male’s call, a series of “gobble” sounds, is familiar and identifying. Wild Turkeys are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Geographic Range

Wild turkeys (Meleagris gallopavo) are one of the most widely distributed game bird species in North America. They are found throughout most of the eastern United States, and in pockets throughout the western United States. They are also found in parts of northern Mexico, particularly in the Sierra Nevada mountains. Wild turkeys have been introduced to Germany and New Zealand.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); australian (Introduced )

  • Eaton, S. 1992. Wild Turkey (Meleagris gallopavo). Pp. 1-28 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 22. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: Native to the eastern and southwestern U.S., Mexico; southern Ontario. Extirpated or reduced in much of former range but introduced widely within, and outside of, former range. Established in Hawaiian Islands (Niihau, Lanai, Maui, Hawaii).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Wild turkeys (Meleagris_gallopavo) are native to the Nearctic region. They are found throughout most of the eastern United States, and in patches throughout the western United States. They are also found in parts of northern Mexico, including in the Sierra Nevada mountains. Wild turkeys have been introduced to Germany and New Zealand.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); australian (Introduced )

  • Eaton, S. 1992. Wild Turkey (Meleagris gallopavo). Pp. 1-28 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 22. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The wild turkey has been successfully introduced in most states outside
of its native range and has also been introduced in southern
Saskatchewan, southwestern Manitoba, and southern Ontario [1,8]. It is
resident locally from central Arizona and central Colorado to northern
Iowa, central Michigan, southern New Hampshire, and southwestern Maine
south to southern Texas, the Gulf Coast, and Florida; and since being
introduced into the western states, ranges throughout the continental
United States and Hawaii [8,18]. The original ranges of subspecies of
wild turkey in North America are listed below [18]:

M. g. ssp. silvestris - most of the eastern and midwestern United States,
from southern Ontario south through northern
Florida and from the Atlantic Coast to Kansas
and Nebraska
M. g. ssp. osceola - Florida Peninsula
M. g. ssp. mexicana - north-central Mexico
M. g. ssp. merriami - Texas, Arizona, New Mexico, Oklahoma, Colorado
M. g. ssp. intermedia - Texas, northern Mexico, Oklahoma, Kansas
M. g. ssp. gallopavo - east-central Mexico
  • 18. Latham, Roger M. 1976. Complete book of the wild turkey. Harrisburg, PA: Stackpole Books. 118 p. [17688]
  • 1. American Ornithologists' Union. 2004. The A.O.U. check-list of North American birds, 7th edition, [Online]. American Ornithologists' Union (Producer). Available: http://www.aou.org/checklist/index.php3 [2005, January 10]. [50863]
  • 8. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]. 1991. Forest and rangeland birds of the United States: Natural history and habitat use. Agric. Handb. 688. Washington, DC: U.S. Department of Agriculture, Forest Service. 625 p. [15856]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America


AL AK AZ AR CA CO CT DE FL GA
HI ID IL IN IA KS KY LA ME MD
MA MI MN MS MO MT NE NV NH NJ
NM NY NC ND OH OK OR PA RI SC
SD TN TX UT VT VA WA WV WI WY


MB ON SK



MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Wild turkeys are large birds with long legs, long necks and large fan-shaped tails. They have short, rounded wings. Male wild turkeys have dark, metallic feathers. Their wing feathers are black with brown and white stripes. Males have a red wattle (a piece of skin that hangs down under the chin), a knob on their forehead (called a caruncle) and a blackish tuft of feathers on the front of their breast. Their legs are pink, pinkish-gray, or silver-gray. They have spurs on the back of their legs that can grow as long as 3.2 cm. Their heads are red, blue, or white, depending on the season. Male wild turkeys are called gobblers.

Female wild turkeys (called hens) are smaller and lighter-colored than males. Most females do not have a breast tuft. They have a grayish head and feathers on their necks.

Male gobblers weigh 6.8 to 11 kg. Hens usually weigh 3.6 to 5.4 kg. Turkeys' weights change throughout the year depending on how much food is available.

Range mass: 3.6 to 11 kg.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Wild turkeys are large, ground-dwelling birds with long legs, long necks and large fan-shaped tails. They have short, rounded wings. Male wild turkeys have dark, iridescent plumage. Their flight feathers are black with brown stripes and are barred with white. They have a red wattle (a fleshy lobe that hangs down from the chin or throat), a caruncle (a wart-like projection of skin attached to the upper part of the forehead), and a blackish breast tuft. Their pink, pinkish-gray, or silver-gray legs have spurs which can grow as long as 3.2 cm. The heads of adult males (called gobblers) are red, blue, or white depending on the season.

Female wild turkeys (called hens) are smaller and duller than males. Most females do not have a breast tuft. Females have a grayish head and a feathered neck.

Male turkeys weigh 6.8 to 11 kg. Hens usually weigh 3.6 to 5.4 kg. Weight varies considerably with time of year and resource availability.

There are six subspecies of Meleagris gallopavo. These subspecies differ in size, plumage and distribution.

Range mass: 3.6 to 11 kg.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 117 cm

Weight: 7400 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Central Pacific Coastal Forests Habitat

This taxon is found in the Central Pacific Coastal Forests ecoregion, as one of its North American ecoregions of occurrence. These mixed conifer rainforests stretch from stretch from southern Oregon in the USA to the northern tip of Vancouver Island, Canada. These forests are among the most productive in the world, characterized by large trees, substantial woody debris, luxuriant growths of mosses and lichens, and abundant ferns and herbs on the forest floor. The major forest complex consists of Douglas-fir (Pseudotsuga menziesii) and Western hemlock (Tsuga heterophylla), encompassing seral forests dominated by Douglas-fir and massive old-growth forests of Douglas-fir, Western hemlock, Western red cedar (Thuja plicata), and other species. These forests occur from sea level up to elevations of 700-1000 meters in the Coast Range and Olympic Mountains. Such forests occupy a gamut of environments with variable composition and structure and includes such other species as Grand fir (Abies grandis), Sitka spruce (Picea sitchensis), and Western white pine (Pinus monticola).

Characteristic mammalian fauna include Elk (Cervus elaphus), Black-tailed Deer (Odocoileus hemionus), Coyote (Canis latrans), Black Bear (Ursus americanus), Mink (Mustela vison), and Raccoon (Procyon lotor).

The following anuran species occur in the Central Pacific coastal forests: Coastal tailed frog (Ascaphus truei); Oregon spotted frog (Rana pretiosa VU); Northern red-legged frog (Rana pretiosa); Pacific chorus frog (Pseudacris regilla); Cascade frog (Rana cascadae NT), generally restricted to the Cascade Range from northern Washington to the California border; Foothill yellow-legged frog (Rana boylii) and the Western toad (Anaxyrus boreas NT).  A newt found in the ecoregion is the Rough skinned newt (Taricha granulosa).

Salamanders within the ecoregion are: Del Norte salamander (Plethodon elongatus NT);  Van Dyke's salamander (Plethodon vandykei); Western redback salamander (Plethodon vehiculum); Northwestern salamander (Ambystoma gracile);  Olympic torrent salamander (Rhyacotriton olympicus VU), whose preferred habitat is along richly leafed stream edges; Long-toed salamander (Ambystoma macrodactylum), whose adults are always subterranean except during the breeding season; Dunn's salamander (Plethodon dunni), usually found in seeps and stream splash zones; Clouded salamander (Aneides ferreus NT), an aggressive insectivore; Monterey ensatina (Ensatina eschscholtzii), usually found in thermally insulated micro-habitats such as under logs and rocks; Pacific giant salamander (Dicamptodon tenebrosus), found in damp, dense forests near streams; and Cope's giant salamander (Dicamptodon copei), usually found in rapidly flowing waters on the Olympic Peninsula and Cascade Range.

There are a small number of reptilian taxa that are observed within this forested ecoregion, including: Pacific pond turtle (Emys marmorata); Common garter snake (Thamnophis sirtalis), an adaptable snake most often found near water; Northern alligator lizard (Elgaria coerulea); and the Western fence lizard.

Numerous avian species are found in the ecoregion, both resident and migratory. Example taxa occurring here are the Belted kingfisher (Megaceryle alcyon); Wild turkey (Meleagris gallopavo); and the White-headed woodpecker (Picoides albolarvatus) and the Trumpeter swan (Cygnus buccinator), the largest of the North American waterfowl.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Forest and open woodland, scrub oak, deciduous or mixed deciduous-coniferous areas, especially in mountainous regions (Subtropical and Temperate zones) (AOU 1983). Also agricultural areas in some regions, which may provide important food resources in winter (e.g., in Massachusetts, Vander Haegen et al. 1989). Roosts in trees at night. Severe winters and/or lack of winter habitat are important limiting factors in many northern areas. In a South Dakota ponderosa pine ecosystem, females with young selected mainly large meadows (Rumble and Anderson 1993).

Nests normally on the ground, usually in open areas at the edge of woods; rarely nests in trees (Fletcher, 1994, Wilson Bull. 106:562-563). In South Dakota, almost all nests initiated in April were in woodland communities whereas nests started after the first week of May were primarily in grassland communities; selected nest sites with concealing vegetation immediately above the nest; nests were placed in habitats associated with high interspersion; shrubs were strongly selected for as nesting cover in grassland; grassland nest sites had a high degree of visual obstruction immediately around the nest site (Day et al. 1991). Sites with good concealment also were selected in Arkansas (Badyaev 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wild turkeys prefer hardwood and mixed conifer-hardwood forests with scattered openings such as pastures, fields, orchards and seasonal marshes.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Wetlands: marsh

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, forb

Wild turkeys need mature, open forests (for traveling and seeing
predators) interspersed with grassy openings. The amount of openings
required by wild turkeys varies from 10 to 25 percent of the total
range. Clearings should be spaced so that hens with broods do not have
to travel more than 1 to 2 miles (1.6-3.2 km) [22]. Areas considered
unsuitable include large tracts of even-aged pine on short rotations,
intensely farmed fields, and areas with a lot of human activity. Healy
(in Shroeder [22]) estimated that the best cover for poults in the
Southeast is a grass and forb mixture 15.7 to 27.6 inches (40-70 cm)
tall and with a biomass of 600 to 3,000 kilograms per hectare dry
weight. This should be mixed with trees and a 60 to 100 percent cover
in the understory. For more detailed habitat suitability index models,
see Schroeder [22].
  • 22. Schroeder, Richard L. 1985. Habitat suitability index models: eastern wild turkey. Biol. Rep. 82(10.106). Washington, DC: U.S. Department of Agriculture, Fish and Wildlife Service. 33 p. [17686]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the term: cover

The wild turkey occurs in a variety of habitats from bottomland hardwood
forests to upland woods and pine forests. These forests must be
interspersed with pastures, grasslands, or agricultural land and other
openings that can provide feeding, dusting, and brooding habitat [22].
In Oregon, wild turkeys prefer to roost in large ponderosa pines on
easterly slopes. They also may roost in logging slash on north slopes
between 2,000 and 3,000 feet (610-914 m). In this same part of Oregon,
wild turkeys prefer ponderosa pine-Douglas-fir-oak stands in spring and
summer, mixed conifer stands in spring and winter, and oak stands in
winter [6]. Eastern Texas brooding hens selected low stocked stands
with abundant herbaceous cover [5]. In the Black Hills of South Dakota
wild turkeys nest in slash and on rock outcrops [20]. In Arizona they
will roost in valleys and in ponderosa pines on northerly slopes [23].
In Massachusetts, wild turkeys select agricultural land during winter,
where they have a better chance of surviving severe winters than if they
remained in the forests [27]. In the fields, wild turkeys can feed on
manure.
  • 5. Campo, Joseph J.; Swank, Wendell G.; Hopkins, Curtis R. 1989. Brood habitat use by eastern wild turkeys in eastern Texas. Journal of Wildlife Management. 53(1): 479-482. [17691]
  • 20. Rumble, Mark A.; Anderson, Stanley H. 1987. Turkey habitat use and nesting characteristics in ponderosa pine. In: Fisser, Herbert G., ed. Wyoming shrublands: Proceedings, 16th Wyoming shrub ecology workshop; 1987 May 26-27; Sundance, WY. Laramie, WY: University of Wyoming, Department of Range Management, Wyoming Shrub Ecology Workshop: 36-39. [13917]
  • 22. Schroeder, Richard L. 1985. Habitat suitability index models: eastern wild turkey. Biol. Rep. 82(10.106). Washington, DC: U.S. Department of Agriculture, Fish and Wildlife Service. 33 p. [17686]
  • 23. Scott, Virgil E.; Boeker, Erwin L. 1977. Responses of Merriam's turkey to pinyon-juniper control. Journal of Range Management. 30(3): 220-223. [16742]
  • 27. Vander Haegen, W. Matthew; Sayre, Mark W.; Dodge, Wendell E. 1989. Winter use of agricultural habitats by wild turkeys in Massachusetts. Journal of Wildlife Management. 53(1): 30-33. [17690]
  • 6. Crawford, John A.; Lutz, R. Scott. 1984. Merriam's wild turkey. Final Report on Project No. PR-W-79-R-2. [Place of publication unknown]: [Publisher unknown]. 39 p. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [17156]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the term: hardwood

Wild turkeys predominantly inhabit oak (Quercus spp.) and pine (Pinus
spp.)-oak forests across North America [18,21]. They also frequent
bottomland hardwood sites such as those dominated by cottonwood and
aspen (Populus spp.). In the West wild turkeys use ponderosa pine
(Pinus ponderosa)-Douglas-fir (Pseudotsuga menziesii)-oak forests and
mature mixed conifer forests [6]. In the Southwest they use pinyon
(Pinus spp.)-juniper (Juniperus spp.) types mixed with oak [23]. In the
Southeast wild turkeys inhabit loblolly pine (Pinus taeda), slash pine
(P. elliottii), and pond pine (P. serotina) forests mixed with
hardwoods. They also use baldcypress (Taxodium distichum)-water tupelo
(Nyssa aquatica) types [24].

REFERENCES :
NO-ENTRY
  • 18. Latham, Roger M. 1976. Complete book of the wild turkey. Harrisburg, PA: Stackpole Books. 118 p. [17688]
  • 21. Schorger, A. W. 1966. The wild turkey; its history and domestication. Norman, OK: University of Oklahoma Press. 625 p. [17689]
  • 23. Scott, Virgil E.; Boeker, Erwin L. 1977. Responses of Merriam's turkey to pinyon-juniper control. Journal of Range Management. 30(3): 220-223. [16742]
  • 24. Still, Hugh R.; Baumann, David P. 1989. Wild turkey activities in relation to timber types on the Francis Marion National Forest. In: Waldrop, Thomas A., ed. Proceedings of pine-hardwood mixtures: a symposium on management and ecology of the type; 1989 April 18-19; Atlanta, GA. Gen. Tech. Rep. SE-58. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southeastern Forest Experiment Station: 137-141. [10270]
  • 6. Crawford, John A.; Lutz, R. Scott. 1984. Merriam's wild turkey. Final Report on Project No. PR-W-79-R-2. [Place of publication unknown]: [Publisher unknown]. 39 p. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [17156]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the terms: hardwood, swamp

24 Hemlock - yellow birch
25 Sugar maple - beech - yellow birch
28 Black cherry - maple
39 Black ash - American elm - red maple
40 Post oak - blackjack oak
42 Bur oak
43 Bear oak
44 Chestnut oak
52 White oak - black oak - northern red oak
53 White oak
55 Northern red oak
60 Beech - sugar maple
63 Cottonwood
70 Longleaf pine
71 Longleaf pine - scrub oak
76 Shortleaf pine - oak
78 Virginia pine - oak
81 Loblolly pine
82 Loblolly pine - hardwood
84 Slash pine
85 Slash pine - hardwood
89 Live oak
98 Pond pine
102 Baldcypress - tupelo
103 Water tupelo - swamp tupelo
105 Tropical hardwoods
109 Hawthorn
210 Interior Douglas-fir
217 Aspen
220 Rocky Mountain juniper

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: shrub

K005 Mixed conifer forest
K010 Ponderosa shrub forest
K011 Western ponderosa forest
K012 Douglas-fir forest
K016 Eastern ponderosa forest
K017 Black Hills pine forest
K018 Pine - Douglas-fir forest
K019 Arizona pine forest
K022 Great Basin pine forest
K023 Juniper - pinyon woodland
K024 Juniper steppe woodland
K026 Oregon oakwoods
K029 California mixed evergreen forest
K030 California oakwoods
K031 Oak - juniper woodlands
K032 Transition between K031 and K037
K037 Mountain-mahogany - oak scrub
K051 Wheatgrass - bluegrass
K059 Trans-Pecos shrub savanna
K061 Mesquite - acacia savanna
K062 Mesquite - live oak savanna
K066 Wheatgrass - needlegrass
K067 Wheatgrass - bluestem - needlegrass
K079 Palmetto prairie
K080 Marl - Everglades
K081 Oak savanna
K083 Cedar glades
K084 Cross Timbers
K086 Juniper - oak savanna
K087 Mesquite - oak savanna
K090 Live oak - sea oats
K091 Cypress savanna
K092 Everglades
K098 Northern floodplain forest
K099 Maple - basswood forest
K100 Oak - hickory forest
K101 Elm - ash forest
K102 Beech - maple forest
K103 Mixed mesophytic forest
K104 Appalachian oak forest
K106 Northern hardwoods
K109 Transition between K104 and K106
K110 Northeastern oak - pine forest
K111 Oak - hickory - pine forest
K112 Southern mixed forest
K113 Southern floodplain forest
K115 Sand pine scrub

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES26 Lodgepole pine
dFRES28 Western hardwoods
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wild turkeys prefer hardwood and mixed conifer-hardwood forests with scattered openings such as pastures, fields, orchards and seasonal marshes.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Wetlands: marsh

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on seeds, nuts, acorns, fruits, and grains, buds, and young grass blades. During summer eats many insects; may also eat some small vertebrates (frogs, toads, snakes, etc). Principal winter foods in the northeastern part of the range include acorns, fruits of multiflora rose and barberry, apples, field corn, fertile fronds of sensitive fern and various other ferns, mosses, and hardwood seeds and buds. In Massachusetts, manure spread on fields was an important source of food in winter (Vander Haegen et al. 1989). Usually forages on the ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Wild turkeys are omnivorous. They mostly eat plant material, including acorns, nuts, seeds, buds, leaves and fern fronds. They also eat insects and salamanders. Wild turkeys search for food on the ground, but they occasionally fly to the top of a shrub or a small tree to feed on fruit or buds. They usually feed for 2 to 3 hours after dawn and before dusk.

Animal Foods: amphibians; insects

Plant Foods: leaves; roots and tubers; seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

More info for the term: mast

Wild turkeys eat fruits, seeds, tubers, bulbs, and greens of locally
common plants. They also eat animals such as snails, spiders,
grasshoppers, millipedes, and salamanders [22]. Grasses are usually
important spring foods, while mast and fruits are important during the
fall and winter. Poults rely on insects for protein. Some plant food
species of the wild turkey include flowering dogwood (Cornus florida),
wild cherry (Prunus serotina), black gum (Nyssa sylvatica), hackberry
(Celtis occidentalis), hickory (Carya spp.), hawthorn (Crateagus spp.),
oak, cottonwood and aspen (Populus spp.), pinyon, juniper, prickly pear
(Opuntia spp.), sumac (Rhus spp.), wheat (Triticum aestivum), alfalfa
(Medicago sativa), rye (Secale cereale), soybean (Glycine max), paspalum
(Paspalum spp.), and panic grass (Panicum spp.) [18,22,23]. Wild
turkeys must be near drinking water on a daily basis [26].
  • 18. Latham, Roger M. 1976. Complete book of the wild turkey. Harrisburg, PA: Stackpole Books. 118 p. [17688]
  • 22. Schroeder, Richard L. 1985. Habitat suitability index models: eastern wild turkey. Biol. Rep. 82(10.106). Washington, DC: U.S. Department of Agriculture, Fish and Wildlife Service. 33 p. [17686]
  • 23. Scott, Virgil E.; Boeker, Erwin L. 1977. Responses of Merriam's turkey to pinyon-juniper control. Journal of Range Management. 30(3): 220-223. [16742]
  • 26. U.S. Department of Agriculture, Soil Conservation Service. 1981. Habitat management for turkeys. Salina, KS: U.S. Department of Agriculture, Soil Conservation Service. 4 p. [17687]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Wild turkeys are omnivorous. They primarily eat vegetable matter such as acorns, nuts, seeds, buds, leaves and fern fronds. They also eat ground-dwelling insects and salamanders, which account for about 10% of their diet. Wild turkeys forage primarily on the ground, though they occasionally mount shrubs and low trees to reach fruits and buds. Most foraging occurs during the 2 to 3 hours after dawn and before dusk.

Animal Foods: amphibians; insects

Plant Foods: leaves; roots and tubers; seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Wild turkeys provide food for their predators and impact populations of the plants whose seeds and nuts they eat.

Wild turkeys also host at least 60 different species of parasites. These include 9 Myxozoa, 11 trematodes, 10 Cestoda, 1 Acanthocephala, 17 Nematoda and 12 Arthropoda.

Commensal/Parasitic Species:

  • Myxozoa
  • trematodes
  • Cestoda
  • Acanthocephala
  • Nematoda
  • Arthropoda

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Predators of wild turkey eggs and nestlings include Procyon lotor, Didelphis virginana, Mephitis mephitis, Urocyon cinereoargenteus, Aves, Marmota monax, Rodentia, Spilogale putorius, Felis rufus, Elaphe obsoleta and Pituophis melanoleucus.

Humans are the primary predator of adult wild turkeys. Other predators include Canis latrans, Felis rufus, Procyon lotor, Felis concolor, Aquila chrysaetos, and Bubo virginianus.

Known Predators:

  • Procyon lotor
  • Didelphis virginana
  • Mephitis mephitis
  • Urocyon cinereoargenteus
  • Aves
  • Marmota monax
  • Rodentia
  • Spilogale putorius
  • Felis rufus
  • Elaphe obsoleta
  • Pituophis melanoleucus
  • Canis latrans
  • Felis concolor
  • Aquila chrysaetos
  • Bubo virginianus
  • homo sapiens

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Predators of the turkey include humans, coyote (Canis latrans), skunks,
weasels, mink (Mustelidae), raccoon (Procyon lotor), opossum (Didephis
virginiana), feral dog (Canis commonis), bobcat (Felis rufus), foxes
(Vulpes spp., Urocyon spp.), squirrels, chipmunks (Sciuridae), hawks
(Buteo spp., Accipiter spp.), raven, crow, magpie (Corvidae), and
various snake species [18,21,22].
  • 18. Latham, Roger M. 1976. Complete book of the wild turkey. Harrisburg, PA: Stackpole Books. 118 p. [17688]
  • 21. Schorger, A. W. 1966. The wild turkey; its history and domestication. Norman, OK: University of Oklahoma Press. 625 p. [17689]
  • 22. Schroeder, Richard L. 1985. Habitat suitability index models: eastern wild turkey. Biol. Rep. 82(10.106). Washington, DC: U.S. Department of Agriculture, Fish and Wildlife Service. 33 p. [17686]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Wild turkeys provide food for their predators and impact populations of the plants whose seeds and nuts they eat.

Wild turkeys also host at least 60 different species of parasites. These include 9 protozoans, 11 trematodes, 10 cestodes, 1 acanthocephalan, 17 nematodes and 12 arthropods.

Commensal/Parasitic Species:

  • protozoans
  • trematodes
  • cestodes
  • acanthocephalan
  • nematodes
  • arthropods

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Predators of wild turkey eggs and nestlings include raccoons, opossums, striped skunks, grey foxes, birds, woodchucks, rodents, spotted skunks, bobcats, rat snakes and bull snakes.

Humans are the primary predator of adult wild turkeys. Other predators include coyotes, bobcats, raccoons, mountain lions, golden eagles, and great horned owls.

Known Predators:

  • raccoons
  • opossums
  • striped skunks
  • grey foxes
  • birds
  • woodchucks
  • rodents
  • spotted skunks
  • bobcats
  • rat snakes
  • bull snakes
  • coyotes
  • mountain lions
  • golden eagles
  • great horned owls
  • humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Sexes usually form separate flocks in winter. In Massachusetts, predation exerted greatest influence on productivity; in Minnesota, winter conditions and resulting pre-breeding female condition were important factor in productivity (Vander Haegen et al. 1988). In southeastern Oklahoma, mean seasonal home range sizes for adult females were 225 ha (winter), 865 ha (spring), 780 ha (summer), and 459 ha (fall) (Bidwell et al. 1989). Home range in Montana was 260 to 520 hectares (Jonas 1966). In Colorado, adult males moved an average distance of 5.3 km from winter ranges to spring breeding areas; subadult males moved an average distance of 8.7 km; in spring males moved about 1000 m between morning and evening roosts used on the same day (Hoffman 1991). In north, deep snow restrict movements.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the term: mast

Annual prescribed burns in longleaf-wiregrass (Aristida spp.)-bracken
fern (Pteridium aquilegia) types of Georgia stimulated the growth of
important wild turkey food plants like legumes and panic grass [4].
Following prescribed fires in the Georgia Piedmont, total seed
production of desirable food plants increased during postburn year 1
from 6.4 kilograms per hectare to 26.4 kilograms per hectare [7].
Spring, late summer, and winter fires in Texas slash pine plantations
seriously reduced mast production but increased fruiting of flowering
dogwood [19]. Loblolly pine stands in South Carolina were burned to
determine the effects of fire on wild turkeys [8]. One plot, burned
every winter for 20 years showed an increase in desired food plants like
winged sumac (Rhus copallina), beggartick (Desmodium spp.), and
partridge pea (Cassia nictitans). An adjacent plot burned every summer
for 20 years and one unburned plot showed little to no value for
wildlife.
  • 4. Buckner, James L.; Landers, J. Larry. 1979. Fire and disking effects on herbaceous food plants and seed supplies. Journal of Wildlife Management. 43(3): 807-811. [11966]
  • 7. Cushwa, Charles T.; Martin, Robert E. 1969. The status of prescribed burning for wildlife management in the Southeast. Proceedings, 34th North American Wildlife and Natural Resource Conference. 34: 419-428. [15652]
  • 19. Lay, Daniel W. 1956. Effects of prescribed burning on forage and mast production in southern pine forests. Journal of Forestry. 54: 582-584. [13828]
  • 8. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]. 1991. Forest and rangeland birds of the United States: Natural history and habitat use. Agric. Handb. 688. Washington, DC: U.S. Department of Agriculture, Forest Service. 625 p. [15856]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

Mating Season - February through April
Incubation - 28 days; 10 to 13 eggs; preccocial young
Age of Maturity - 1 year, but may not mate until 2 to 3 years of age;
polygamous
Longevity - can live to 10 or 12 years, but 5 years is considered "old";
annual mortality of 50% in a population is common
[13,18,21,26]
  • 13. Hoffman, Richard W. 1991. Spring movements, roosting activities, and home-range characteristics of male Merriam's wild turkey. The Southwestern Naturalist. 36(3): 332-337. [17088]
  • 18. Latham, Roger M. 1976. Complete book of the wild turkey. Harrisburg, PA: Stackpole Books. 118 p. [17688]
  • 21. Schorger, A. W. 1966. The wild turkey; its history and domestication. Norman, OK: University of Oklahoma Press. 625 p. [17689]
  • 26. U.S. Department of Agriculture, Soil Conservation Service. 1981. Habitat management for turkeys. Salina, KS: U.S. Department of Agriculture, Soil Conservation Service. 4 p. [17687]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Wild turkeys use calls and body signals to communicate. For example, during the spring, males will fan out their tails, strut around and "gobble" to try to attract females. Wild turkeys give at least 15 different calls. The most easily recognized call is the "gobble". Males use the "gobble" call to attract female mates and to tell other males to stay away.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Wild turkeys use vocalizations and physical displays to communicate. For example, during the spring, males will fan out their tails, strut and "gobble" in an attempt to attract and retain a harem of females. Biologists recognize at least 15 different wild turkey vocalizations, including the widely recognized "gobble". The "gobble" is give primarily by males with the purpose of attracting females and repelling competing males. Other vocalizations are used by both sexes to communicate a variety of messages.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Most active in early morning and late afternoon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest known wild turkey lived at least 13 years. Most wild turkeys probably live less than two years.

Range lifespan

Status: wild:
13 (high) years.

Typical lifespan

Status: wild:
1.3 to 1.6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The average life expectancy for wild turkeys is estimated at 1.3 to 1.6 years. The oldest known wild turkey lived at least 13 years.

Range lifespan

Status: wild:
13 (high) years.

Typical lifespan

Status: wild:
1.3 to 1.6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13 years (wild) Observations: Mortality in wild populations of 50% per year is common. Generally do not live over 5 years in the wild (http://www.fs.fed.us/database/feis/), though record longevity in the wild is 13 years (http://www.demogr.mpg.de/longevityrecords).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Female incubates average of 10-12 eggs for 27-28 days, beginning ning late April-early May in Alabama, Florida, New York, early May in Minnesota; most nests initiated mid-April to mid-May in northeastern Colorado. Hatching begins in May in south, usually early June in north. Young are tended by female; brood stays together until winter. Females first breed as yearlings.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wild turkeys are polygynous (one male mates with many females). Males try to attract females by calling (called "gobbling"). The gobbles of male wild turkeys can be heard more than 1.5 kilometers away (or about a mile). Males also try to attract females by "strutting". They do this by walking around with their tail fanned out, their wings dragging on the ground, their feathers puffed up and their throat puffed out.

Mating System: polygynous

Wild turkeys breed in early spring. Southern populations usually begin courtship activities in late January and northern populations begin in late February. Turkeys raise one brood of chicks per year.

Turkey nests are just shallow bowl-shaped holes scratched in the dirt. They are usually under dense brush or vines, or in deep grass. The female scratches out the nest and lays 4 to 17 eggs. She incubates the eggs for 25 to 31 days. The chicks are well-developed when they hatch. They are able to walk and feed themselves the day after they hatch. For the first two weeks after hatching, the female covers the chicks at night (called brooding) to protect them and keep them warm. She also protects them from predators. The young turkeys are called poults. Male poults stay with their mother through the fall. Female poults stay with their mother until spring.

Turkeys can breed when they are about 10 months old. However, male turkeys usually do not breed this young because females prefer to mate with older males.

Breeding interval: Wild turkeys breed once per year.

Breeding season: Courtship begins in early spring (January to February).

Range eggs per season: 4 to 17.

Range time to hatching: 25 to 31 days.

Range fledging age: 24 (high) hours.

Range time to independence: 4 to 10 months.

Average age at sexual or reproductive maturity (female): 10 months.

Average age at sexual or reproductive maturity (male): 10 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 11.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Male wild turkeys do not care for their chicks. The female parent does all of the parental care. The female makes the nest, incubates the eggs, and cares for the chicks.

Parental Investment: no parental involvement; precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Protecting: Female); pre-independence (Protecting: Female)

  • Eaton, S. 1992. Wild Turkey (Meleagris gallopavo). Pp. 1-28 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 22. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wild turkeys are polygynous. Males attempt to attract females by "gobbling" and "strutting" with their tail fanned out, their wings lowered and dragging on the ground, their back feathers erect, their head thrown back and their crop inflated. The gobbles of male wild turkeys can be heard more than 1.5 kilometers away (or approximately 1 mile).

Mating System: polygynous

Wild turkeys breed in early spring; southern populations begin courtship in late January and northern populations begin in late February. They raise one brood per season. The nest is a shallow depression in the ground, usually surrounded by dense brush, vines, tangles, deep grass, or fallen tree tops. The female scratches out the nest and lays 4 to 17 (usually 8 to 15) eggs. She incubates the eggs for 25 to 31 days. The chicks are precocial, and are able walk and feed themselves within 24 hours of hatching. The female broods the chicks at night for the first 2 weeks after hatching. She also defends them from predators, sometimes pursuing hawks or other predators. The young turkeys (called poults) stay with the female parent through the fall (males) or the early spring (females). Turkeys are capable of breeding at about 10 months old, though young males are typically not successful in competing with older males for mates during their first spring.

Egg dumping (laying eggs in another female's nest) is common in this species. This species is also known to lay eggs in the nests of ruffed grouse. Ring-necked pheasants are known nest parasites of wild turkeys.

Breeding interval: Wild turkeys breed once per year.

Breeding season: Courtship begins in early spring (January to February).

Range eggs per season: 4 to 17.

Range time to hatching: 25 to 31 days.

Range fledging age: 24 (high) hours.

Range time to independence: 4 to 10 months.

Average age at sexual or reproductive maturity (female): 10 months.

Average age at sexual or reproductive maturity (male): 10 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 11.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Male wild turkeys do not provide any parental care. Female wild turkeys prepare the nest, incubate the eggs, and care for the young until the next spring (fall for male poults). The chicks are precocial, and are able to walk and feed themselves within 24 hours of hatching.

Parental Investment: no parental involvement; precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Protecting: Female); pre-independence (Protecting: Female)

  • Eaton, S. 1992. Wild Turkey (Meleagris gallopavo). Pp. 1-28 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 22. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Meleagris gallopavo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Meleagris gallopavo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTTTCATCAACCGATGATTATTTTCAACCAACCATAAAGATATTGGCACTCTTTACCTAATTTTTGGCACATGAGCAGGTATAGTCGGCACAGCACTTAGCCTGCTAATCCGTGCAGAACTGGGACAACCTGGGACACTCCTAGGAGACGACCAAATCTATAACGTAATCGTCACAGCCCATGCCTTCGTTATAATCTTCTTTATAGTTATACCTATCATGATCGGAGGCTTCGGTAACTGACTTGTACCACTTATAATTGGTGCCCCAGACATGGCATTCCCACGTATAAATAATATAAGCTTCTGACTCCTTCCACCTTCCTTTCTTCTTCTGCTAGCCTCTTCTACCGTAGAAGCTGGAGCTGGCACTGGATGAACTGTCTACCCACCTTTAGCTAGCAACCTTGCCCACGCTGGTGCATCAGTAGACCTAACTATTTTTTCCCTCCACCTAGCAGGTGTATCCTCCATCCTAGGAGCAATCAACTTTATTACTACTATTATTAACATAAAACCCCCAGCACTGTCACAATACCAAACACCCCTATTTGTTTGATCCGTTCTCATTACCGCTATCCTCCTATTACTCTCTCTACCAGTCCTTGCCGCCGGAATTACAATACTTCTTACTGACCGCAACCTTAACACTACATTCTTTGACCCCGCAGGAGGAGGAGACCCAATCCTATATCAACACCTATTTTGATTTTTTGGCCACCCCGAAGTTTATATCCTCATTCTTCCAGGTTTCGGAATAATCTCCCACGTGGTAGCATATTATGCAGGAAAGAAAGAGCCCTTCGGATATATAGGAATAGTCTGAGCAATACTATCAATTGGATTCTTAGGCTTCATCGTATGAGCCCACCACATATTCACAGTCGGAATGGATGTGGACACCCGAGCTTACTTCACATCAGCCACCATAATTATTGCTATCCCAACTGGCATTAAAGTCTTCAGCTGATTGGCAACCTTGCACGGAGGAACAATTAAATGAGACCCACCTATGCTATGGGCCTTAGGATTTATCTTCCTATTCACTATTGGAGGTCTTACGGGAATTGTCCTCGCCAATTCATCCCTCGACATTGCCCTCCACGACACCTACTACGTAGTTGCCCACTTCCACTATGTCCTCTCAATAGGAGCAGTTTTCGCCATTTTAGCAGGCTTCACCCACTGATTCCCTCTTTTCACAGGCTTCACCCTCCATCCTTCATGAACTAAAGCCCACTTCGGAGTGATATTTACAGGAGTAAACTTAACCTTCTTCCCACAACACTTCTTAGGTTTAGCTGGTATACCCCGACGATACTCGGACTATCCAGATGCCTATACCCTATGAAATACATTATCCTCAATCGGCTCTTTAATCTCAATAACAGCCGTAATCATACTCATGTTCATCGTCTGAGAAGCCTTCTCAGCAAAACGAAAAGTACTACACCCTGAACTAACCTCTACCAACATTGAATGAATCCACGGATGTCCACCCCCATACCACACTTTCGAAGAACCGGCCTTCGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wild turkeys are plentiful and are widespread. Many states are starting to introduce them into previously uninhabited areas, increasing their range and distribution. Current estimates of wild turkey populations are around 4 million in North America (Dickson, 1995).

Wild turkeys are not legally protected. In fact, they are hunted in many states.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wild turkeys are plentiful and are widespread. Many states are starting to introduce them into previously uninhabited areas, increasing their range and distribution. Current estimates of wild turkey populations are around 4 million in North America (Dickson, 1995).

Wild turkeys are not legally protected. In fact, they are hunted in many states.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: Selective thinning of riverfront hardwoods in Louisiana resulted in increased use by females (Zwank et al. 1988). See Pack et al. (1988) for information on the use of prescribed burning and thinning to increase brood habitat in oak-hickory forests.

In South Dakota, grazing by livestock reduced herbaceous biomass necessary for invertebrate food items and cover for young (Rumble and Anderson 1993).

See Rumble and Anderson (1992) for information on methods for stratification of habitats in a way that is useful for forest management (habitat selection was best described by stratifying by dominant species of vegetation and overstory canopy cover; Black Hills, South Dakota). See Sanderson and Shultz (1973), Ligon (1946), Willians and Austin (1988), and Williamson (no date) for additional management information.

Miller (1990) discussed factors affecting survival of transplanted turkeys.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the term: cover

The wild turkey is a popular game species that has been introduced to
almost every state outside the limits of its original range [21].
However, it is not very tolerant of human activity and has suffered from
urbanization as well as intense farming and conversion of native forest
land to pine plantations [11,22]. Wild turkeys are susceptible to
domestic poultry diseases [26]. Pesticide spraying to reduce vegetation
may temporarily result in decreased turkey use of an area [2].

Wild turkey populations declined following cutting, burning, and
chaining of pinyon-juniper types in Arizona [23]. Partially cut units
showed only a temporary reduction in turkey use. Where one-third of a
large tract (800 ha) was treated, use decreased from 32 percent to 3
percent during summer. These authors recommended that cleared areas be
less than 300 feet (90 m) wide and that cover in travel corridors
between feeding and roosting areas be maintained.

REFERENCES :
NO-ENTRY
  • 2. Beasom, Samuel L.; Scifres, Charles J. 1977. Population reactions of selected game species to aerial herbicide applications in south Texas. Journal of Range Management. 30(2): 138-142. [408]
  • 11. Felix, A. C., III; Sharik, T. L.; McGinnes, B. S. 1986. Effects of pine conversion on food plants of northern bobwhite quail, eastern wild turkey, and white-tailed deer in the Virginia piedmont. Southern Journal of Applied Forestry. 100: 47-52. [17692]
  • 21. Schorger, A. W. 1966. The wild turkey; its history and domestication. Norman, OK: University of Oklahoma Press. 625 p. [17689]
  • 22. Schroeder, Richard L. 1985. Habitat suitability index models: eastern wild turkey. Biol. Rep. 82(10.106). Washington, DC: U.S. Department of Agriculture, Fish and Wildlife Service. 33 p. [17686]
  • 23. Scott, Virgil E.; Boeker, Erwin L. 1977. Responses of Merriam's turkey to pinyon-juniper control. Journal of Range Management. 30(3): 220-223. [16742]
  • 26. U.S. Department of Agriculture, Soil Conservation Service. 1981. Habitat management for turkeys. Salina, KS: U.S. Department of Agriculture, Soil Conservation Service. 4 p. [17687]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Use of Fire in Population Management

Prescribed fire can be used to stimulate the growth of food plants and
promote early spring green up of grasses [22]. Fire can also reduce
litter, exposing seeds and insects; and reduce brush so that turkeys can
be wary of predators [14,15,25]. Fire can be used to create edges to
increase nesting habitat [25]. It can also reduce parasites such as
ticks and lice [16]. Devet and Hopkins [8] recommended burning
loblolly-longleaf pine stands every 3 years, and burning every 4 to 6
years in Piedmont regions. For burning recommendations of
mast-producing oak species see the desired species in the FEIS database.
  • 14. Hurst, George A. 1978. Effects of controlled burning on wild turkey poult food habits. Proceedings, Annual Conference of Southeastern Association of Fish and Wildlife Agencies. 32: 30-37. [14648]
  • 15. Hurst, George A. 1981. Effects of prescribed burning on the eastern wild turkey. In: Wood, Gene W., ed. Prescribed fire and wildlife in southern forests: Proceedings of a symposium; 1981 April 6-8; Myrtle Beach, SC. Georgetown, SC: Clemson University, Belle W. Baruch Forest Science Institute: 81-88. [14813]
  • 16. Jacobson, H. A.; Hurst, G. A. 1979. Prevalence of parasitism by Amblyomma americanum on wild turkey poults as influenced by prescribed burning. Journal of Wildlife Diseases. 15: 43-47. [16067]
  • 22. Schroeder, Richard L. 1985. Habitat suitability index models: eastern wild turkey. Biol. Rep. 82(10.106). Washington, DC: U.S. Department of Agriculture, Fish and Wildlife Service. 33 p. [17686]
  • 8. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]. 1991. Forest and rangeland birds of the United States: Natural history and habitat use. Agric. Handb. 688. Washington, DC: U.S. Department of Agriculture, Forest Service. 625 p. [15856]
  • 25. Stoddard, Herbert L. 1961. Wild turkey management. In: The Cooperative Quail Study Association: May 1, 1931-May 1, 1943. Misc. Publ. No. 1. Tallahassee, FL: Tall Timbers Research Station: 426-433. [Reprinted from: Transactions, 21st American game conference; 1935 January 21-23; New York, NY. Washington, DC: American Game Association.]. [15077]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

We do not know of any ways that wild turkeys hurt humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Wild turkeys are one of the most popular game bird species in the United States. State Departments of Natural Resources earn money from turkey hunting by selling hunting permits.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of wild turkeys on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Wild turkeys are one of the most popular game bird species in the United States. Turkey hunting brings millions of dollars to states' Departments of Natural Resources, as well as to public and private organizations each year. Conservation efforts may benefit from turkey hunting through habitat improvement projects. Numerous organizations work to keep wild turkeys plentiful throughout the country.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Wild turkey

For other uses, see Wild Turkey (disambiguation).

The wild turkey (Meleagris gallopavo) is native to North America and is the heaviest member of the diverse Galliformes. It is the same species as the domestic turkey, which was originally derived from a southern Mexican subspecies of wild turkey (not the related ocellated turkey). Although native to North America, the turkey probably got its name from the domesticated variety being imported to Britain in ships coming from the Levant via Spain. The British at the time therefore, associated the wild turkey with the country Turkey and the name stuck.[2]

Description[edit]

Closeup of hen taken at Cincinnati Zoo

Adult wild turkeys have long reddish-yellow to grayish-green legs. The body feathers are generally blackish and dark brown overall with a coppery sheen that becomes more complex in adult males. Adult males, called toms or gobblers, have a large, featherless, reddish head, red throat, and red wattles on the throat and neck. The head has fleshy growths called caruncles. Juvenile males are called jakes, the difference between an adult male and a juvenile is that the jake has a very short beard and his tail fan has longer feathers in the middle. The adult male's tail fan will be all the same length.[3] When males are excited, a fleshy flap on the bill expands, and this, the wattles and the bare skin of the head and neck all become engorged with blood, almost concealing the eyes and bill. The long fleshy object over a male's beak is called a snood. When a male turkey is excited, its head turns blue; when ready to fight, it turns red. Each foot has three toes in front, with a shorter, rear-facing toe in back; males have a spur behind each of their lower legs.[4]

Male turkeys have a long, dark, fan-shaped tail and glossy bronze wings. As with many other species of the Galliformes, turkeys exhibit strong sexual dimorphism. The male is substantially larger than the female, and his feathers have areas of red, purple, green, copper, bronze, and gold iridescence. Females, called hens, have feathers that are duller overall, in shades of brown and gray. Parasites can dull coloration of both sexes; in males, coloration may serve as a signal of health.[5] The primary wing feathers have white bars. Turkeys have 5000 to 6000 feathers.[6] Tail feathers are of the same length in adults, different lengths in juveniles. Males typically have a "beard", a tuft of coarse hair (modified feathers) growing from the center of the breast. Beards average 230 mm (9.1 in) in length. In some populations, 10 to 20% of females have a beard, usually shorter and thinner than that of the male. The adult male (or "tom") normally weighs from 5 to 11 kg (11 to 24 lb) and measures 100–125 cm (39–49 in) in length. The adult female (or "hen") is typically much smaller at 2.5–5.4 kg (5.5–11.9 lb) and is 76 to 95 cm (30 to 37 in) long.[7][8] The wings are relatively small, as is typical of the galliform order, and the wingspan ranges from 1.25 to 1.44 m (4 ft 1 in to 4 ft 9 in). The wing chord is only 20 to 21.4 cm (7.9 to 8.4 in). The bill is also relatively small, as adults measure 2 to 3.2 cm (0.79 to 1.26 in) in culmen length.[9] The tarsus of the wild turkey is quite long and sturdy, measuring from 9.7 to 19.1 cm (3.8 to 7.5 in). The tail is also relatively long, ranging from 24.5 to 50.5 cm (9.6 to 19.9 in).[10] The record-sized adult male wild turkey, according to the National Wild Turkey Federation, weighed 16.85 kg (37.1 lb), with records of tom turkeys weighing over 13.8 kg (30 lb) uncommon but not rare.[11] While it is usually rather lighter than the waterfowl, after the trumpeter swan, the turkey has the second heaviest maximum weight of any North American bird. Going on average mass, several other birds on the continent, including the American white pelican and the very rare California condor and whooping crane surpass the mean weight of turkeys, although none of these other species are as sexually dimorphic in size.[12][13]

Habitat[edit]

Eastern subspecies

Wild turkeys prefer hardwood and mixed conifer-hardwood forests with scattered openings such as pastures, fields, orchards and seasonal marshes. They seemingly can adapt to virtually any dense native plant community as long as coverage and openings are widely available. Open, mature forest with a variety of interspersion of tree species appear to be preferred. In the Northeast of North America, turkeys are most profuse in hardwood timber of oak-hickory (Quercus-Carya) and forests of red oak (Quercus rubra), beech (Fagus grandifolia), cherry (Prunus serotina) and white ash (Fraxinus americana). Best ranges for turkeys in the Coastal Plain and Piedmont sections have an interspersion of clearings, farms, and plantations with preferred habitat along principal rivers and in cypress (Taxodium disticum) and tupelo (Nyssa sylvatica) swamps. Appalachian and Cumberland plateaus, birds occupy mixed forest of oaks and pines on southern and western slopes, also hickory with diverse understories. Bald cypress and sweet gum (Liquidambar styraciflua) swamps of s. Florida; also hardwood of Cliftonia (a heath) and oak in north-central Florida. Lykes Fisheating Creek area of s. Florida has up to 51% cypress, 12% hardwood hammocks, 17% glades of short grasses with isolated live oak (Quercus virginiana); nesting in neighboring prairies. Original habitat here was mainly longleaf pine (Pinus palustris) with turkey oak (Quercus laevis) and slash pine (Pinus caribaea) “flatwoods,” now mainly replaced by slash pine plantations.

Behavior[edit]

Flight[edit]

In flight

Despite their weight, wild turkeys, unlike their domestic counterparts, are agile fliers. In ideal habitat of open woodland or wooded grasslands,[14] they may fly beneath the canopy top and find perches. They usually fly close to the ground for no more than 400 m (a quarter mile).

Vocalizations[edit]

Turkeys have many vocalizations: "gobbles," "clucks," "putts," "purrs," "yelps," "cutts," "whines," "cackles," and "kee-kees." In early spring, male turkeys, also called gobblers or toms, gobble to announce their presence to females and competing males. The gobble can carry for up to a mile. Males also emit a low-pitched "drumming" sound; produced by the movement of air in the air sack in the chest, similar to the booming of a prairie chicken. In addition they produce a sound known as the "spit" which is a sharp expulsion of air from this air sack. Hens "yelp" to let gobblers know their location. Gobblers often yelp in the manner of females, and hens can gobble, though they rarely do so. Immature males, called jakes, often yelp.

Foraging[edit]

Hen with poults

Wild turkeys are omnivorous, foraging on the ground or climbing shrubs and small trees to feed. They prefer eating hard mast such as acorns, nuts, and various trees, including hazel, chestnut, hickory, and pinyon pine as well as various seeds, berries such as juniper and bearberry, roots and insects. Turkeys also occasionally consume amphibians and small reptiles such as lizards and snakes. Poults have been observed eating insects, berries, and seeds. Wild turkeys often feed in cow pastures, sometimes visit back yard bird feeders, and favor croplands after harvest to scavenge seed on the ground. Turkeys are also known to eat a wide variety of grasses.

Turkey populations can reach large numbers in small areas because of their ability to forage for different types of food. Early morning and late afternoon are the desired times for eating.

Social structure and mating[edit]

Nest with 10 eggs

Males are polygamous, mating with as many hens as they can. Male wild turkeys display for females by puffing out their feathers, spreading out their tails and dragging their wings. This behavior is most commonly referred to as strutting. Their heads and necks are colored brilliantly with red, blue and white. The color can change with the turkey's mood, with a solid white head and neck being the most excited. They use gobbling, drumming/booming and spitting as signs of social dominance, and to attract females. Courtship begins during the months of March and April, which is when turkeys are still flocked together in winter areas.

Males may be seen courting in groups, often with the dominant male gobbling, spreading their tail feathers (strutting), drumming/booming and spitting. In a study, the average dominant male that courted as part of a pair of males fathered six more eggs than males that courted alone. Genetic analysis of pairs of males courting together shows that they are close relatives, with half of their genetic material being identical. The theory behind the team-courtship is that the less dominant male would have a greater chance of passing along shared genetic material than if it were courting alone.[15]

When mating is finished, females search for nest sites. Nests are shallow dirt depressions engulfed with woody vegetation. Hens lay a clutch of 10–14 eggs, usually one per day. The eggs are incubated for at least 28 days. The poults are precocial and nidifugous, leaving the nest in about 12–24 hours.

Predators[edit]

Predators of eggs and nestlings include raccoons (Procyon lotor), Virginia opossums (Didelphis virginiana), striped skunks (Mephitis mephitis), gray foxes (Urocyon cinereoargenteus), groundhogs (Marmota monax), other rodents and spotted skunks (Spilogale ssp.).[16][17][18][19] Predators of poults in addition to nestlings and eggs also include several snakes, namely rat snakes (Elaphe ssp.), gopher snakes (Pituophis catenifer) and pinesnakes (Pituophis ssp.), and predators mainly on poults include raptors such as bald eagles (Haliaeetus leucocephalus), barred owl (Strix varia), red-tailed (Buteo jamaicensis), white-tailed (Geranoaetus albicaudatus) and harris's hawks (Parabuteo unicinctus) and even the smallish Cooper's hawk (Accipiter cooperii) and broad-winged hawk (Buteo platypterus) (both likely of very small poults).[20][21][22][23][24][25] Mortality of poults is greatest in the first 14 days of life, especially of those roosting on the ground, decreasing most notably after half a year, when they attain near adult sizes.[26]

Hen with juveniles, Jocelyn, Ontario

Predators of both adults and poults include coyotes (Canis latrans),[27] gray wolf (Canis lupus),[28] bobcats (Lynx rufus),[29] cougars (Puma concolor),[30] golden eagles (Aquila chrysaetos)[31] and possibly American black bears (Ursus americanus).[32] In addition to poults, hens and adult-sized fledglings (but not, as far as is known, adult male toms) are vulnerable to predation by great horned owls (Bubo virginianus),[33] northern goshawk (Accipiter gentilis),[34] domestic dogs (Canis lupus domesticus), and red foxes (Vulpes vulpes).[35] Humans are now the leading predator of adult turkeys.[36][37] When approached by potential predators, turkeys and their poults usually run away rather than fly away from potential predators, though they may also fly short distances if pressed.

Occasionally, if cornered, adult turkeys may try to fight off predators and large male toms can be especially aggressive in self-defense. When fighting off predators, turkeys may kick with their legs, using the spurs on their back of the legs as a weapon, bite with their beak and ram with their relatively large bodies and may be able to deter predators up to the size of mid-sized mammals.[38][39] Hen turkeys have been seen to chase off at least two species of hawks in flight when their poults are threatened.[40] Occasionally, turkeys may behave aggressively towards humans, especially in areas where natural habitats are scarce, though attacks can usually be deterred and minor injuries can be avoided by giving turkeys a respectful amount of space and keeping outdoor spaces clean and undisturbed.[41]

Range and population[edit]

The range and numbers of the wild turkey had decreased at the beginning of the 20th century due to hunting and loss of habitat. Game managers estimate that the entire population of wild turkeys in the United States was as low as 30,000 in the early 20th century. By the 1940s, it was almost totally extirpated from Canada and becoming localized in pockets in the United States, in the north-east effectively restricted to the Appalachians, only as far north as central Pennsylvania. Game officials made efforts to protect and encourage the breeding of the surviving wild population, and some trapped birds were relocated to new areas, including some in the western states where it was not native. There is evidence that the bird does well when near farmland, which provides grain and also berry-bearing shrubs at its edges.[42] As wild turkey numbers rebounded, hunting was legalized in 49 U.S. states (excluding Alaska). In 1973, the total U.S. population was estimated to be 1.3 million, and current estimates place the entire wild turkey population at 7 million individuals. In recent years, "trap and transfer" projects have reintroduced wild turkeys to several provinces of Canada as well, sometimes from across the border in the United States.

Attempts to introduce the wild turkey to Britain as a game bird in the 18th century were not successful. George II is said to have had a flock of a few thousand in Richmond Park near London, but they were too easy for local poachers to catch, and the fights with poachers became too dangerous for the gamekeepers. They were hunted with dogs and then shot out of trees where they took refuge. Several other populations, introduced or escaped, have survived for periods elsewhere in Britain and Ireland, but seem to have eventually died out, perhaps from a combination of lack of winter feed and poaching.[43] Small populations, probably descended from farm as well as wild stock, in the Czech Republic and Germany have been more successful, and there are wild populations of some size following introductions in Hawaii and New Zealand.[44]

Subspecies[edit]

There are subtle differences in the coloration, habitat, and behavior of the different subspecies of wild turkeys. The six subspecies are:

M. g. silvestris in northern Florida

Eastern wild turkey (Meleagris gallopavo silvestris) (Viellot, 1817)[edit]

This was the turkey species first encountered in the wild by the Puritans, the founders of Jamestown, and the Acadians; its range is one of the largest of all subspecies. The natural range covers the entire eastern half of the United States from Maine in the north to northern Florida and extending as far west as Michigan, Illinois, and into Missouri. In Canada, its range extends into Southeastern Manitoba, Ontario, Southwestern Quebec (including Pontiac, Quebec and the lower half of the Western Quebec Seismic Zone), and the Maritime Provinces. They number from 5.1 to 5.3 million birds. They were first named 'forest turkey' in 1817, and can grow up to 4 ft (1.2 m) tall. The upper tail coverts are tipped with chestnut brown. Males can reach 30 lb (14 kg) in weight. The eastern wild turkey is heavily hunted in the Eastern USA and is the most hunted wild turkey subspecies.

Osceola wild turkey or Florida wild turkey (M. g. osceola) (Scott, 1890)[edit]

Most common in the Florida peninsula, they number from 80,000 to 100,000 birds. This bird is named for the famous Seminole leader Osceola, and was first described in 1890. It is smaller and darker than the eastern wild turkey. The wing feathers are very dark with smaller amounts of the white barring seen on other subspecies. Their overall body feathers are an iridescent green-purple color. They are often found in scrub patches of palmetto and occasionally near swamps, where amphibian prey is abundant.

M. g. intermedia has relatively long legs

Rio Grande wild turkey (M. g. intermedia) (Sennett, 1879)[edit]

The Rio Grande wild turkey ranges through Texas to Oklahoma, Kansas, New Mexico, Colorado, Oregon, and was introduced to central and western California, as well as parts of a few northeastern states. It was also introduced to Hawaiʻi in the late 1950s. Population estimates for this subspecies range from 1,022,700 to 1,025,700.[45] This subspecies, native to the central plain states, was first described in 1879, and has relatively long legs, better adapted to a prairie habitat. Its body feathers often have a green-coppery sheen. The tips of the tail and lower back feathers are a buff-to-very light tan color. Its habitats are brush areas next to streams, rivers or mesquite, pine and scrub oak forests. The Rio Grande turkey is gregarious.

Merriam's wild turkey (M. g. merriami) (Nelson, 1900)[edit]

The Merriam's wild turkey ranges through the Rocky Mountains and the neighboring prairies of Wyoming, Montana and South Dakota, as well as much of the high mesa country of New Mexico, with number from 334,460 to 344,460 birds.[citation needed] The subspecies has also been introduced into Oregon. The initial releases of Merriam’s turkeys in 1961 resulted in establishing a remnant population of Merriam’s turkeys along the east-slope of Mt. Hood and natural immigration of turkeys from Idaho has established Merriam’s flocks along the eastern border of Oregon.[46] Merriam's Wild Turkeys live in Ponderosa Pine and mountainous regions. The subspecies was named in 1900 in honor of Clinton Hart Merriam, the first chief of the U.S. Biological Survey. The tail and lower back feathers have white tips and purple and bronze reflections.

Gould's wild turkey (M. g. mexicana) (Gould, 1856)[edit]

Gould's wild turkey

Native from the central valleys to the northern mountains of Mexico and the southernmost parts of Arizona and New Mexico. Gould's wild turkeys are heavily protected and regulated. The subspecies was first described in 1856. They exist in small numbers in the U.S. but are abundant in northwestern portions of Mexico. A small population has been established in southern Arizona. Gould's are the largest of the five subspecies. They have longer legs, larger feet, and longer tail feathers. The main colors of the body feathers are copper and greenish-gold. This subspecies is heavily protected owing to its skittish nature and threatened status.

South Mexican wild turkey (M. g. gallopavo) (Linnaeus, 1758)[edit]

The south Mexican wild turkey is considered the nominate subspecies, and the only one that is not found in the United States or Canada. Preclassic peoples in Mesoamerica domesticated the southern Mexican subspecies, M. g. gallopavo, giving rise to the domestic turkey. The Spaniards brought this tamed subspecies back to Europe with them in the mid-16th century; from Spain it spread to France and later Britain as a farmyard animal, usually becoming the centerpiece of a feast for the well-to-do. By 1620 it was common enough so that Pilgrim settlers of Massachusetts could bring turkeys with them from England, unaware that it had a larger close relative already occupying the forests of Massachusetts. It is one of the smallest subspecies and is best known in Spanish from its Aztec-derived name, guajolote. This wild turkey subspecies is thought to be critically endangered, as of 2010.

Benjamin Franklin and the National Bird Suggestion[edit]

Female wild turkey with young, from Birds of America by John James Audubon

The idea that Benjamin Franklin preferred the turkey as the national bird of the United States comes from a letter he wrote to his daughter Sarah Bache on January 26, 1784.[47] The main subject of the letter is a criticism of the Society of the Cincinnati, which he likened to a chivalric order, which contradicted the ideals of the newly founded American republic.[48] In one section of the letter, Franklin remarked on the appearance of the bald eagle on the Society's crest:

Others object to the Bald Eagle, as looking too much like a Dindon, or Turkey. For my own part I wish the Bald Eagle had not been chosen the Representative of our Country. He is a Bird of bad moral Character. He does not get his Living honestly. You may have seen him perched on some dead Tree near the River, where, too lazy to fish for himself, he watches the Labour of the Fishing Hawk [osprey]; and when that diligent Bird has at length taken a Fish, and is bearing it to his Nest for the Support of his Mate and young Ones, the Bald Eagle pursues him and takes it from him.

With all this Injustice, he is never in good Case but like those among Men who live by Sharping & Robbing he is generally poor and often very lousy. Besides he is a rank Coward: The little King Bird not bigger than a Sparrow attacks him boldly and drives him out of the District. He is therefore by no means a proper Emblem for the brave and honest Cincinnati of America who have driven all the King birds from our Country...

I am on this account not displeased that the Figure is not known as a Bald Eagle, but looks more like a Turkey. For in Truth the Turkey is in Comparison a much more respectable Bird, and withal a true original Native of America... He is besides, though a little vain & silly, a Bird of Courage, and would not hesitate to attack a Grenadier of the British Guards who should presume to invade his Farm Yard with a red Coat on.

Franklin never publicly voiced opposition to the Bald Eagle as a national symbol.[48]

Significance to Native Americans[edit]

Eastern wild turkeys (M. g. silvestris), females (hens)

The wild turkey, throughout its range, plays a significant role in the cultures of many Native American tribes all over North America. Outside of the Thanksgiving feast, it is a favorite meal in Eastern tribes. Eastern Native American tribes consumed both the eggs and meat, sometimes turning the latter into a type of jerky to preserve it and make it last through cold weather. They provided habitat by burning down portions of forests to create artificial meadows which would attract mating birds, and thus give a clear shot to hunters. The feathers of turkeys also often made their way into the rituals and headgear of many tribes. Many leaders, such as Catawba chiefs, traditionally wore turkey feather headdresses.[49] Significant peoples of several tribes, including Muscogee Creek and Wampanoag, wore turkey feather cloaks.[50] The turkey clan is one of the three Lenape clans.[51] Movements of wild turkeys inspired the Caddo tribe's turkey dance.[52]

See also[edit]

Notes[edit]

  1. ^ BirdLife International (2012). "Meleagris gallopavo". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Dickson, 362; "Why a Turkey Is Called a Turkey". Npr.org. Retrieved on 2012-12-19.
  3. ^ Wild Turkey Identification and Anatomy. NWTF. Retrieved on 2012-12-19.
  4. ^ "Turkey Habitat". Habitat Tracker - Florida State University. Retrieved 2013-03-12. 
  5. ^ Hill, G; Doucet SM; Buchholz R (2005). "The Effect of Coccidial Infection on Iridescent Plumage Coloration in Wild Turkeys". Animal Behaviour 69 (2): 387–94. doi:10.1016/j.anbehav.2004.03.013. 
  6. ^ National wild turkey Federation: wild turkey Facts. Nwtf.org. Retrieved on 2012-08-21.
  7. ^ Wild Turkey Meleagris gallopavo. animals.nationalgeographic.com
  8. ^ Meleagris gallopavo wild turkey. Animal Diversity Web
  9. ^ Birds Master Database Search. flmnh.ufl.edu
  10. ^ Pheasants, Partridges, and Grouse : A Guide to the Pheasants, Partridges, Quails, Grouse, Guineafowl, Buttonquails, and Sandgrouse of the World (Princeton Field Guides) by Tami Davis Biddle. Princeton University Press (2002). ISBN 978-0691089089.
  11. ^ Welcome to the National Wild Turkey Federation | Conserve. Hunt. Share. Nwtf.org. Retrieved on 2012-08-21.
  12. ^ Wood, Gerald (1983). The Guinness Book of Animal Facts and Feats. ISBN 978-0-85112-235-9. 
  13. ^ CRC Handbook of Avian Body Masses, John B. Dunning Jr. (ed.). CRC Press (1992), ISBN 978-0-8493-4258-5.
  14. ^ Hogan, C. Michael (2008). Wild turkey: Meleagris gallopavo, GlobalTwitcher.com, ed. N. Stromberg
  15. ^ Krakauer, AH (March 3, 2005). "Kin selection and cooperative courtship in wild turkeys". Nature 434 (7029): 69–72. doi:10.1038/nature03325. PMID 15744300. 
  16. ^ Baker, B. W. (1978). Ecological factors affecting wild turkey nest predation on south Texas rangelands. In Proceedings of the Annual Conference of the Southeastern Association of Fish and Wildlife Agencies (Vol. 32, pp. 126-136).
  17. ^ Holdstock, D. P., Wallace, M. C., Ballard, W. B., Brunjes, J. H., Phillips, R. S., Spears, B. L., & Gipson, P. S. (2006). Male Rio Grande turkey survival and movements in the Texas Panhandle and southwestern Kansas. Journal of Wildlife Management, 70(4), 904-913.
  18. ^ Pharris, L. D., and R. C. Goetz. 1980. An evaluation of artificial wild turkey nests monitored by automatic cameras. Proceedings of the National Wild Turkey Symposium 4:108–116.
  19. ^ Williams, L. E., Jr., D. H. Austin, and N. F. Eichholz. 1976. The breeding potential of the wild turkey hen. Proc. Annu. Conf. Southeast. Assoc. Fish and Wildl. Agencies 30:371-376.
  20. ^ Reagan. J. M.. and K.D. Morgan. 1980. Reproductive potential of Rio Grande turkey hens in the Edwards Plateau of Texas. Proc. Natl. Wild Turkey Symp. 4:136-144.
  21. ^ Peoples, J. C., Sisson, D. C., & Speake, D. W. (1995). Mortality of wild turkey poults in coastal plain pine forests. In Proceedings of the Annual Conference of the Southeastern Association of Fish and Wildlife Agencies (Vol. 49, pp. 448-453).
  22. ^ Beasom, S.L. and Pattee, O.H. An Encounter Between a Turkey and a Bullsnake. Wilson Bulletin, 87(2):281-282, 1975.
  23. ^ Dreibelbis, J. Z., Melton, K. B., Aguirre, R., Collier, B. A., Hardin, J., Silvy, N. J., & Peterson, M. J. (2008). Predation of Rio Grande wild turkey nests on the Edwards Plateau, Texas. The Wilson Journal of Ornithology, 120(4), 906-910.
  24. ^ McEwan, L. C., & Hirth, D. H. (1980). Food habits of the bald eagle in north-central Florida. Condor, 229-231.
  25. ^ Haucke, H.H. Predation by a White-Tailed Hawk and a Harris Hawk on a Wild Turkey Poult. Condor, 73(4):475, 1971.
  26. ^ Glidden, J. W. and D. E. Austin. 1975. Natality and mortality of wild turkey poults in southwestern New York. Proc. Natl. Wild Turkey Symp. 3:48-54.
  27. ^ MacCracken, J. G., & Uresh, D. W. (1984). Coyote foods in the Black Hills, South Dakota. The Journal of wildlife management, 1420-1423
  28. ^ Reed, J. E., Ballard, W. B., Gipson, P. S., Kelly, B. T., Krausman, P. R., Wallace, M. C., & Wester, D. B. (2006). Diets of free-ranging Mexican gray wolves in Arizona and New Mexico. Wildlife Society Bulletin, 34(4), 1127-1133.
  29. ^ Beasom, S. L., & Moore, R. A. (1977). Bobcat food habit response to a change in prey abundance. The Southwestern Naturalist, 451-457
  30. ^ Maehr, D. S., Belden, R. C., Land, E. D., & Wilkins, L. (1990). Food habits of panthers in southwest Florida. The Journal of Wildlife Management, 420-423.
  31. ^ Lehman, C. P., & Thompson, D. J. (2004). Golden Eagle (Aquila chrysaetos) predation attempts on Merriam's turkeys (Meleagris gallopavo merriami) in the southern Black Hills, South Dakota. Journal of Raptor Research, 38(2), 192-192.
  32. ^ Stratman, M. R., & Pelton, M. R. (1999). Feeding ecology of black bears in northwest Florida. Florida Field Naturalist, 27(3), 95-102.
  33. ^ Schemnitz, S. D., D. L. Goerndt & . H. Jones. 1985. Habitat needs and management of Merriam’s turkeys in southcentral New Mexico. Proc. Natl. Wild Turkey Symp., 5:199-232
  34. ^ Golet, G.H., Golet, H.T. and Colton, A. Immature Northern Goshawk Captures, Kills, and Feeds on Adult-Sized Wild Turkey. Journal of Raptor Research, 37(4):337-340, 2003
  35. ^ Goldyn, B., Hromada, M., Surmacki, A., & Tryjanowski, P. (2003). Habitat use and diet of the red fox Vulpes vulpes in an agricultural landscape in Poland. Zeitschrift für Jagdwissenschaft, 49(3), 191-200.
  36. ^ ADW: Meleagris gallopavo: INFORMATION. Animaldiversity.ummz.umich.edu (2006-03-12). Retrieved on 2012-08-21.
  37. ^ Kennamer, James Earl. Predators and Wild Turkeys. NWTF Wildelife Bulletin NO.16
  38. ^ Wild Turkey Predators, Wild Turkey Predation: National Wild Turkey Federation. Nwtf.org. Retrieved on 2012-12-19.
  39. ^ Wild Turkey Predators. Waterandwoods.net (2008-09-20). Retrieved on 2012-12-19.
  40. ^ Johnson, R.R. Aerial Pursuit of Hawks by Turkeys. The Auk, 78(4):646, 1961.
  41. ^ Living with wildlife: Turkey: Minnesota DNR. Dnr.state.mn.us. Retrieved on 2012-12-19.
  42. ^ Dickson, pp. 368-379
  43. ^ Dickson, p. 363; Maxwell, William Hamilton, The field book; or, Sports and pastimes of the British islands, by the author of 'Wild sports of the West, p. 540, London, 1833, google books
  44. ^ Dickson, pp. 363-368
  45. ^ Kennamer, Mary C. "NWTF Wildlife Bulletin No. 3: Rio Grande Wild Turkey". NWTF. 
  46. ^ “Oregon State Dept. of Fish and Wildlife, Wildlife Division, Wild Turkey Management Plan“.
  47. ^ "Benjamin Franklin to Sarah Bache, January 26, 1784".Library of Congress, Manuscript Division.
  48. ^ a b "American Heraldry Society | MMM / The Arms of the United States: Benjamin Franklin and the Turkey". Americanheraldry.org. 2007-05-18. Retrieved 2012-05-30. 
  49. ^ Pritzker 367
  50. ^ Pritzker 381, 474
  51. ^ Pritzker 423
  52. ^ "Caddo Nation Today." Texas Beyond History. (retrieved 28 Dec 2010)

References[edit]

  • Dickson, James G., The Wild Turkey: Biology and Management (A National Wild Turkey Federation and USDA Forest Service book), 1992, Stackpole Books, ISBN 081171859X, 9780811718592, google books
  • Pritzker, Barry M. A Native American Encyclopedia: History, Culture, and Peoples. Oxford: Oxford University Press, 2000. ISBN 978-0-19-513877-1.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Domesticated turkey

The domesticated turkey is a large poultry bird descended from the wild turkey (Meleagris gallopavo), one of the two species in the genus Meleagris. It was domesticated by the indigenous peoples of Mesoamerica at least 2,000 years ago, with the evidence pointing to what are today the central regions of Mexico.[1]

Turkey meat is a popular form of poultry, and turkeys are raised throughout temperate parts of the world, partially because industrialized farming has made it very cheap for the amount of meat it produces. Female domesticated turkeys are referred to as hens and the chicks may be called poults or turkeylings. In the United States, the males are referred to as toms, while in Europe, males are stags. The average lifespan for a domesticated turkey is ten years.[citation needed]

The great majority of domesticated turkeys are bred to have white feathers because their pin feathers are less visible when the carcass is dressed, although brown or bronze-feathered varieties are also raised. The fleshy protuberance atop the beak is the snood, and the one attached to the underside of the beak is known as a wattle.

The English language name for this species is the result of an early misidentification of the bird with an unrelated species which was imported to Europe through the country of Turkey.

History[edit]

Black Spanish turkeys
A young turkey is called a poult.

The modern domesticated turkey is descended from one of six subspecies of wild turkey: Meleagris gallopavo, found in the area bounded by the present Mexican states of Jalisco, Guerrero, and Veracruz[2] Ancient Mesoamericans domesticated this subspecies, using its meat and eggs as major sources of protein and employing its feathers extensively for decorative purposes. The Aztecs associated the turkey with their trickster god Tezcatlipoca,[3] perhaps because of its perceived humorous behavior.

Domestic turkeys were taken to Europe by the Spanish. Many distinct breeds were developed in Europe (e.g. Spanish Black, Royal Palm). In the early 20th century, many advances were made in the breeding of turkeys, resulting in breeds such as the Beltsville Small White.

The 16th-century English navigator William Strickland is generally credited with introducing the turkey into England.[4][5] His family coat of arms — showing a turkey cock as the family crest — is among the earliest known European depictions of a turkey.[4][6] English farmer Thomas Tusser notes the turkey being among farmer's fare at Christmas in 1573.[7] The domestic turkey was sent from England to Jamestown, Virginia in 1608. A document written in 1584 lists supplies to be furnished to future colonies in the New World; "turkies, male and female".[8]

Prior to the late 19th century, turkey was something of a luxury in the UK, with goose or beef a more common Christmas dinner among the working classes.[9] In Charles Dickens' A Christmas Carol (1843), Bob Cratchit had a goose before Scrooge bought him a turkey.[10]

Turkey production in the UK was centered in East Anglia, using two breeds, the Norfolk Black and the Norfolk Bronze (also known as Cambridge Bronze). These would be driven as flocks, after shoeing, down to markets in London from the 17th century onwards - the breeds having arrived in the early 16th century via Spain.[11]

Intensive farming of turkeys from the late 1940s dramatically cut the price, making it more affordable for the working classes. With the availability of refrigeration, whole turkeys could be shipped frozen to distant markets. Later advances in disease control increased production even more. Advances in shipping, changing consumer preferences and the proliferation of commercial poultry plants has made fresh turkey inexpensive as well as readily available.

Behaviour[edit]

Anatomical structures on the head and throat of a domestic turkey. 1. Caruncles, 2. Snood, 3. Wattle (Dewlap), 4. Major caruncle, 5. Beard

Young domestic turkeys readily fly short distances, perch and roost. These behaviours become less frequent as the birds mature, but adults will readily climb on objects such as bales of straw. Young birds perform spontaneous, frivolous running ('frolicking') which has all the appearance of play. Commercial turkeys show a wide diversity of behaviours including 'comfort' behaviours such as wing-flapping, feather ruffling, leg stretching and dust-bathing. Turkeys are highly social and become very distressed when isolated. Many of their behaviours are socially facilitated i.e. expression of a behaviour by one animal increases the tendency for this behaviour to be performed by others. Adults can recognise 'strangers' and placing any alien turkey into an established group will almost certainly result in that individual being attacked, sometimes fatally. Turkeys are highly vocal, and 'social tension' within the group can be monitored by the birds’ vocalisations. A high-pitched trill indicates the birds are becoming aggressive which can develop into intense sparring where opponents leap at each other with the large, sharp talons, and try to peck or grasp the head of each other. Aggression increases in frequency and severity as the birds mature.

Male domesticated turkey sexually displaying by showing the snood hanging over the beak, the caruncles hanging from the throat, and the 'beard' of small, black, stiff feathers on the chest

Maturing males spend a considerable proportion of their time sexually displaying. This is very similar to that of the wild turkey and involves fanning the tail feathers, drooping the wings and erecting all body feathers, including the 'beard' (a tuft of black, modified hair-like feathers on the centre of the breast). The skin of the head, neck and caruncles (fleshy nodules) becomes bright blue and red, and the snood (an erectile appendage on the forehead) elongates, the birds 'sneeze' at regular intervals, followed by a rapid vibration of their tail feathers. Throughout, the birds strut slowly about, with the neck arched backward, their breasts thrust forward and emitting their characteristic 'gobbling' call.

Turkey breeds[edit]

Main article: List of turkey breeds
See also: Heritage turkey
  • The Broad Breasted White is the commercial turkey of choice for large scale industrial turkey farms, and consequently is the most consumed variety of the bird. Usually the turkey to receive a "presidential pardon", a U.S. custom, is a Broad Breasted White.
  • The Broad Breasted Bronze is another commercially developed strain of table bird.
  • The Standard Bronze looks much like the Broad Breasted Bronze, except that it is single breasted, and can naturally breed.
  • The Bourbon Red turkey is a smaller, non-commercial breed with dark reddish feathers with white markings.
  • Slate, or Blue Slate, turkeys are a very rare breed with beautiful gray-blue feathers.
  • The Black ("Spanish Black", "Norfolk Black") has very dark plumage with a green sheen.
  • The Narragansett Turkey is a popular heritage breed named after Narraganset Bay in New England.
  • The Chocolate is a rarer heritage breed with markings similar to a Black Spanish, but light brown instead of black in color. Common in the Southern U.S. and France before the Civil War.
  • The Beltsville Small White is a small heritage breed, whose development started in 1934. The breed was introduced in 1941 and was admitted to the APA Standard in 1951. Although slightly bigger and broader than the Midget White, both are often mislabeled.
  • The Midget White is a smaller heritage breed.

Commercial production[edit]

In commercial production, breeder farms supply eggs to hatcheries. After 28 days of incubation, the hatched poults are sexed and delivered to the grow-out farms; hens are raised separately from toms because of different growth rates.

Turkey in Pakistan

In the UK, it is common to rear chicks in the following way. Between one and seven days of age, chicks are placed into small (2.5 m) circular brooding pens to ensure they encounter food and water. To encourage feeding, they may be kept under constant light for the first 48 hours. To assist thermoregulation, air temperature is maintained at 35 °C for the first three days, then lowered by approximately 3 °C every two days to 18 °C at 37 days of age, and infra-red heaters are usually provided for the first few days. Whilst in the pens, feed is made widely accessible by scattering it on sheets of paper in addition to being available in feeders. After several days, the pens are removed, allowing the birds access to the entire rearing shed, which may contain tens of thousands of birds. The birds remain there for several weeks, after which they are transported to another unit.[12]

The vast majority of turkeys are reared indoors in purpose-built or modified buildings of which there are many types. Some types have slatted walls to allow ventilation, but many have solid walls and no windows to allow artificial lighting manipulations to optimise production. The buildings can be very large (converted aircraft hangars are sometimes used) and may contain tens of thousands of birds as a single flock. The floor substrate is usually deep-litter, e.g. wood shavings, which relies upon the controlled build-up of a microbial flora requiring skilful management. Ambient temperatures for adult domestic turkeys are usually maintained between 18 and 21 °C. High temperatures should be avoided because the high metabolic rate of turkeys (up to 69 W/bird) makes them susceptible to heat stress, exacerbated by high stocking densities.[12] Commercial turkeys are kept under a variety of lighting schedules, e.g. continuous light, long photoperiods (23 h), or intermittent lighting, to encourage feeding and accelerate growth.[13] Light intensity is usually low (e.g. less than one lux) to reduce feather pecking.

Rations generally include corn and soybean meal, with added vitamins and minerals, and is adjusted for protein, carbohydrate and fat based on the age and nutrient requirements. Hens are slaughtered at about 14–16 weeks and toms at about 18–20 weeks of age when they can weigh over 20 kg compared to a mature male wild turkey which weighs approximately 10.8 kg.[14][citation needed]

Welfare concerns[edit]

Modern domesticated turkeys under commercial conditions

Space allowance for commercially reared turkeys is often severely limited. For example, recommendations by the Farm Animal Welfare Council[15] equate to providing adult birds each weighing 20 kg with 891 cm2, despite turkeys of this weight each requiring 1700 cm2 simply to stand without touching another bird.[16]

The problems of small space allowance are exacerbated by the major influence of social facilitation on the behaviour of turkeys. If turkeys are to feed, drink, dust-bathe, etc., simultaneously, then to avoid causing frustration, resources and space must be available in large quantities.

Lighting manipulations used to optimise production can compromise welfare. Long photoperiods combined with low light intensity can result in blindness from buphthalmia (distortions of the eye morphology) or retinal detachment.

Feather pecking occurs frequently amongst commercially reared turkeys and can begin at 1 day of age. This behaviour is considered to be re-directed foraging behaviour, caused by providing poultry with an impoverished foraging environment. To reduce feather pecking, turkeys are often beak-trimmed, which has its own ethical concerns. Ultraviolet-reflective markings appear on young birds at the same time as feather pecking becomes targeted toward these areas, indicating a possible link.[17] Commercially reared turkeys also perform head-pecking, which becomes more frequent as they sexually mature. When this occurs in small enclosures or environments with few opportunities to escape, the outcome is often fatal and rapid. Frequent monitoring is therefore essential, particularly of males approaching maturity. Injuries to the head receive considerable attention from other birds, and head-pecking often occurs after a relatively minor injury has been received during a fight or when a lying bird has been trodden upon and scratched by another. Individuals being re-introduced after separation are often immediately attacked again - it may be impossible to re-introduce head-pecked individuals. Fatal head-pecking can occur even in small (10 birds), stable groups. Commercial turkeys are normally reared in single-sex flocks. If a male is inadvertently placed in a female flock, he may be aggressively victimised (hence the term 'henpecked'). Females in male groups will be repeatedly mated, during which it is highly likely she will be injured from being trampled upon.

Breeding and companies[edit]

The dominant commercial breed is the Broad-breasted Whites (similar to "White Holland", but a separate breed), which have been selected for size and amount of meat. Mature toms are too large to achieve natural fertilization without injuring the hens, so their semen is collected, and hens are inseminated artificially. Several hens can be inseminated from each collection, so fewer toms are needed. The eggs of some turkey breeds are able to develop without fertilization, in a process called parthenogenesis.[18][19] Breeders' meat is too tough for roasting, and is mostly used to make processed meats.

In the UK Bernard Matthews Farms is a large producer of turkeys. Cargill, Butterball and Jennie-O (Hormel) are large producers in the U.S.

Waste products[edit]

Approximately two to four billion pounds of poultry feathers are produced every year by the poultry industry. Most are ground into a protein source for ruminant animal feed, which are able to digest the protein keratin of which feathers are composed. Researchers at the United States Department of Agriculture (USDA) have patented a method of removing the stiff quill from the fibers which make up the feather.[citation needed] As this is a potential supply of natural fibers, research has been conducted at Philadelphia University's School of Engineering and Textiles to determine textile applications for feather fibers. Turkey feather fibers have been blended with nylon and spun into yarn, and then used for knitting. The yarns were tested for strength while the fabrics were evaluated as insulation materials. In the case of the yarns, as the percentage of turkey feather fibers increased, the strength decreased. In fabric form, as the percentage of turkey feather fibers increased, the heat retention capability of the fabric increased.[citation needed]

Turkeys as food[edit]

Main article: Turkey meat
A roast turkey prepared for a traditional U.S. Thanksgiving meal.
Turkey, breast, meat only, raw
Nutritional value per 100 g (3.5 oz)
Energy465 kJ (111 kcal)
0 g
Sugars0 g
Dietary fiber0 g
0.7 g
24.6 g
Vitamins
Thiamine (B1)
(0%)
0 mg
Riboflavin (B2)
(8%)
0.1 mg
Niacin (B3)
(44%)
6.6 mg
(14%)
0.7 mg
Vitamin B6
(46%)
0.6 mg
Folate (B9)
(2%)
8 μg
Vitamin C
(0%)
0 mg
Trace metals
Calcium
(1%)
10 mg
Iron
(9%)
1.2 mg
Magnesium
(8%)
28 mg
Phosphorus
(29%)
206 mg
Potassium
(6%)
293 mg
Sodium
(3%)
49 mg
Zinc
(13%)
1.2 mg
Percentages are roughly approximated using US recommendations for adults.

Turkeys are traditionally eaten as the main course of Christmas feasts in much of the world (stuffed turkey) since appearing in England in the 16th century,[21] as well as for Thanksgiving in the United States and Canada. While eating turkey was once mainly restricted to special occasions such as these, turkey is now eaten year-round and forms a regular part of many diets.

Turkeys are sold sliced and ground, as well as "whole" in a manner similar to chicken with the head, feet, and feathers removed. Frozen whole turkeys remain popular. Sliced turkey is frequently used as a sandwich meat or served as cold cuts; in some cases where recipes call for chicken it can be used as a substitute. Ground turkey is sold just as ground beef, and is frequently marketed as a healthy beef substitute. Without careful preparation, cooked turkey is usually considered to end up less moist than other poultry meats such as chicken or duck.

Wild turkeys, while technically the same species as domesticated turkeys, have a very different taste from farm-raised turkeys. Almost all of the meat is "dark" (even the breast) with a more intense flavor. The flavor can also vary seasonally with changes in available forage, often leaving wild turkey meat with a gamier flavor in late summer due to the greater number of insects in its diet over the preceding months. Wild turkey that has fed predominantly on grass and grain has a milder flavor. Older heritage breeds also differ in flavor.[citation needed]

Unlike chicken, duck, and quail eggs, turkey eggs are not commonly sold as food due to the high demand for whole turkeys and lower output of eggs as compared with other fowl. The value of a single turkey egg is estimated to be about US $3.50 on the open market, substantially more than a carton of one dozen chicken eggs.[22][23]

Cooking[edit]

Roast turkey

Both fresh and frozen turkeys are used for cooking; as with most foods, fresh turkeys are generally preferred, although they cost more. Around holiday seasons, high demand for fresh turkeys often makes them difficult to purchase without ordering in advance. For the frozen variety, the large size of the turkeys typically used for consumption makes defrosting them a major endeavor: a typically sized turkey will take several days to properly defrost.

Turkeys are usually baked or roasted in an oven for several hours, often while the cook prepares the remainder of the meal. Sometimes, a turkey is brined before roasting to enhance flavor and moisture content. This is necessary because the dark meat requires a higher temperature to denature all of the myoglobin pigment than the white meat (very low in myoglobin), so that fully cooking the dark meat tends to dry out the breast. Brining makes it possible to fully cook the dark meat without drying the breast meat. Turkeys are sometimes decorated with turkey frills prior to serving.

In some areas, particularly the American South, they may also be deep fried in hot oil (often peanut oil) for 30 to 45 minutes by using a turkey fryer. Deep frying turkey has become something of a fad, with hazardous consequences for those unprepared to safely handle the large quantities of hot oil required.[24]

Nutritional value[edit]

The white meat of turkey is generally considered healthier than dark meat because of its lower fat content, but the nutritional differences are small. And although turkey is reputed to cause sleepiness, holiday dinners are commonly large meals served with carbohydrates, fats, and alcohol in a relaxed atmosphere, all of which are bigger contributors to post-meal sleepiness than the tryptophan in turkey.[25][26]

Turkey litter for fuel[edit]

Although most commonly used as fertilizer, turkey litter (droppings mixed with bedding material, usually wood chips) is being used as a fuel source in electric power plants. One such plant in western Minnesota provides 55 megawatts of power using 500,000 tons of litter per year. The plant began operating in 2007.[27]

See also[edit]

Footnotes[edit]

  1. ^ "UF researchers discover earliest use of Mexican turkeys by ancient Maya", at Eurekalert August 8, 2012
  2. ^ C. Michael Hogan. 2008. Wild turkey: Meleagris gallopavo, GlobalTwitcher.com, ed. N. Stromberg
  3. ^ "Ancient North & Central American History of the Wild Turkey". Wildturkeyzone.com. Retrieved December 21, 2007. 
  4. ^ a b Emett, Charlie (2003) Walking the Wolds Cicerone Press Limited, 1993 ISBN 1-85284-136-2
  5. ^ M. F. Fuller (2004) The encyclopedia of farm animal nutrition ISBN 0-85199-369-9
  6. ^ Peach, Howard (2001) Curious Tales of Old East Yorkshire, p. 53. Sigma Leisure.
  7. ^ John Harland The house and farm accounts of the Shuttleworths of Gawthorpe Hall in the county of Lancaster at Smithils and Gawthorpe: from September 1582 to October 1621 Chetham society, 1858
  8. ^ James G. Dickson, National Wild Turkey Federation (U.S.), United States. Forest Service The Wild turkey: biology and management Stackpole Books, 1992 ISBN 0-8117-1859-X
  9. ^ A Victorian Christmas Historic UK.com Retrieved December 26, 2010
  10. ^ Charles Dickens (1843) A Christmas carol in prose, being a ghost story of Christmas p.156. Bradbury & Evans
  11. ^ "The Turkey Club UK". March 19, 2007. Retrieved December 21, 2007. 
  12. ^ a b Sherwin, C.M., (2010). Turkeys: Behavior, Management and Well-Being. In “The Encyclopaedia of Animal Science”. Wilson G. Pond and Alan W. Bell (Eds). Marcel Dekker. pp. 847-849
  13. ^ Nixey, C., (1994). Lighting for the production and welfare of turkeys. World's Poultry Science Journal, 50: 292-294
  14. ^ Wild Turkey National Geographic.
  15. ^ Farm Animal Welfare Council. Report on the Welfare of Turkeys. Tolworth, U.K. 1995; 13-15
  16. ^ Ellerbrock, S. and Knierim, U., (2002). Static space requirements of male meat turkeys. Veterinary Record, 151: 54-57
  17. ^ Sherwin, C.M. and Devereux, C.L. (1999). A preliminary investigation of ultraviolet-visible markings on domestic turkey chicks and a possible role in injurious pecking. British Poultry Science, 40: 429-433
  18. ^ "Discovered in Turkey Eggs: Parthenogenesis", World's Poultry Science Journal (1953), 9: 276-278 Cambridge University Press
  19. ^ McDaniel, C D, "Parthenogenesis: Embryonic development in unfertilized eggs may impact normal fertilization and embryonic mortality", MSU Poultry Dept. Spring Newsletter, 1:1. (reproduced on The Poultry Site)
  20. ^ "Turkey, fryer-roasters, breast, meat only, raw". USDA Nutrient Database. 
  21. ^ Davis, Karen (2001) More than a meal: the turkey in history, myth, ritual, and reality Lantern Books, 2001
  22. ^ Cecil Adams. "Why can't you buy turkey eggs in stores?". The Straight Dope. Retrieved November 25, 2010. 
  23. ^ Kasey-Dee Gardner (November 18, 2008). "Why? Tell Me Why!: Turkey Eggs". DiscoveryNews. Retrieved November 25, 2010. 
  24. ^ "Product Safety Tips: Turkey Fryers". Underwriters Laboratories. Retrieved December 21, 2007. 
  25. ^ "Does eating turkey make you sleepy?". About.com. Retrieved May 11, 2005. 
  26. ^ "Researcher talks turkey on Thanksgiving dinner droop". Massachusetts Institute of Technology News Office. Retrieved November 21, 2006. 
  27. ^ "Turkey-Manure Power Plant Raises Stink with Environmentalists". International Herald Tribune iht.com. Retrieved November 15, 2007. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Fragmented distributions and population bottlenecks due to human activities appear to have increased genetic differentiation among populations (Leberg 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

wild turkey
turkey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The currently accepted scientific name for wild turkey is Meleagris
gallopavo Linnaeus [1]. The six subspecies are distinguished by
coloration, size, and distribution [1,18]:

Meleagris gallopavo ssp. silvestris Vieillot (eastern wild turkey)
M. gallopavo ssp. osceola Scott (Florida wild turkey)
M. gallopavo ssp. mexicana (Gould's wild turkey)
M. gallopavo ssp. merriami Nelson (Merriam's wild turkey)
M. gallopavo ssp. intermedia Sennett (Rio Grande turkey)
M. gallopavo ssp. gallopavo (Mexican wild turkey)
  • 18. Latham, Roger M. 1976. Complete book of the wild turkey. Harrisburg, PA: Stackpole Books. 118 p. [17688]
  • 1. American Ornithologists' Union. 2004. The A.O.U. check-list of North American birds, 7th edition, [Online]. American Ornithologists' Union (Producer). Available: http://www.aou.org/checklist/index.php3 [2005, January 10]. [50863]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!