Overview

Brief Summary

Meleagris gallopavo

An extremely large (36-48 inches) game bird, the Wild Turkey is most easily identified by its large size, bald bluish head, and iridescent black or brown body feathers. Male Wild Turkeys have large fan-like tails and red wattles on the neck, whereas females are much smaller and plainer. This species is nearly unmistakable among North America birds, although certain varieties of Domestic Turkey resemble their wild ancestors. The Wild Turkey is native to much of the eastern United States, southern Canada, and Mexico. However, its range has been in constant flux over the past 500 years as populations have locally been hunted to extinction or, conversely, introduced into new areas for sport shooting. Due to both factors, Wild Turkeys are absent from portions of the Atlantic Seaboard and upper Midwest but may be found locally in parts of the western U.S. where they did not occur before Europeans arrived in the New World. The Wild Turkey is the only native North American bird to be domesticated, and Domestic Turkeys are farmed around the world. Wild Turkeys inhabit a wide array of habitats, including deciduous woodland, dry scrub, and grassland. While this species is rarely found in urban or suburban areas, Wild Turkeys will visit agricultural fields and pastures. In fact, the ancestors of the Domestic Turkey likely became associated with humans through visiting maize fields in Mexico. This species primarily eats seeds, nuts, leaves, and insects. In forests, clearings, and more open habitats, it may be possible to observe Wild Turkeys standing or walking, singly or in small groups, while foraging for food. The male’s call, a series of “gobble” sounds, is familiar and identifying. Wild Turkeys are primarily active during the day.

Threat Status: Least Concern

  • Eaton, Stephen W. 1992. Wild Turkey (Meleagris gallopavo), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/022
  • Meleagris gallopavo. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Wild Turkey (Meleagris gallopavo). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • eBird Range Map - Wild Turkey. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Wild turkeys (Meleagris gallopavo) are one of the most widely distributed game bird species in North America. They are found throughout most of the eastern United States, and in pockets throughout the western United States. They are also found in parts of northern Mexico, particularly in the Sierra Nevada mountains. Wild turkeys have been introduced to Germany and New Zealand.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); australian (Introduced )

  • Eaton, S. 1992. Wild Turkey (Meleagris gallopavo). Pp. 1-28 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 22. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: Native to the eastern and southwestern U.S., Mexico; southern Ontario. Extirpated or reduced in much of former range but introduced widely within, and outside of, former range. Established in Hawaiian Islands (Niihau, Lanai, Maui, Hawaii).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Wild turkeys (Meleagris_gallopavo) are native to the Nearctic region. They are found throughout most of the eastern United States, and in patches throughout the western United States. They are also found in parts of northern Mexico, including in the Sierra Nevada mountains. Wild turkeys have been introduced to Germany and New Zealand.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); australian (Introduced )

  • Eaton, S. 1992. Wild Turkey (Meleagris gallopavo). Pp. 1-28 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 22. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The wild turkey has been successfully introduced in most states outside
of its native range and has also been introduced in southern
Saskatchewan, southwestern Manitoba, and southern Ontario [1,8]. It is
resident locally from central Arizona and central Colorado to northern
Iowa, central Michigan, southern New Hampshire, and southwestern Maine
south to southern Texas, the Gulf Coast, and Florida; and since being
introduced into the western states, ranges throughout the continental
United States and Hawaii [8,18]. The original ranges of subspecies of
wild turkey in North America are listed below [18]:

M. g. ssp. silvestris - most of the eastern and midwestern United States,
from southern Ontario south through northern
Florida and from the Atlantic Coast to Kansas
and Nebraska
M. g. ssp. osceola - Florida Peninsula
M. g. ssp. mexicana - north-central Mexico
M. g. ssp. merriami - Texas, Arizona, New Mexico, Oklahoma, Colorado
M. g. ssp. intermedia - Texas, northern Mexico, Oklahoma, Kansas
M. g. ssp. gallopavo - east-central Mexico

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America


AL AK AZ AR CA CO CT DE FL GA
HI ID IL IN IA KS KY LA ME MD
MA MI MN MS MO MT NE NV NH NJ
NM NY NC ND OH OK OR PA RI SC
SD TN TX UT VT VA WA WV WI WY


MB ON SK



MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Wild turkeys are large, ground-dwelling birds with long legs, long necks and large fan-shaped tails. They have short, rounded wings. Male wild turkeys have dark, iridescent plumage. Their flight feathers are black with brown stripes and are barred with white. They have a red wattle (a fleshy lobe that hangs down from the chin or throat), a caruncle (a wart-like projection of skin attached to the upper part of the forehead), and a blackish breast tuft. Their pink, pinkish-gray, or silver-gray legs have spurs which can grow as long as 3.2 cm. The heads of adult males (called gobblers) are red, blue, or white depending on the season.

Female wild turkeys (called hens) are smaller and duller than males. Most females do not have a breast tuft. Females have a grayish head and a feathered neck.

Male turkeys weigh 6.8 to 11 kg. Hens usually weigh 3.6 to 5.4 kg. Weight varies considerably with time of year and resource availability.

There are six subspecies of Meleagris gallopavo. These subspecies differ in size, plumage and distribution.

Range mass: 3.6 to 11 kg.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Wild turkeys are large birds with long legs, long necks and large fan-shaped tails. They have short, rounded wings. Male wild turkeys have dark, metallic feathers. Their wing feathers are black with brown and white stripes. Males have a red wattle (a piece of skin that hangs down under the chin), a knob on their forehead (called a caruncle) and a blackish tuft of feathers on the front of their breast. Their legs are pink, pinkish-gray, or silver-gray. They have spurs on the back of their legs that can grow as long as 3.2 cm. Their heads are red, blue, or white, depending on the season. Male wild turkeys are called gobblers.

Female wild turkeys (called hens) are smaller and lighter-colored than males. Most females do not have a breast tuft. They have a grayish head and feathers on their necks.

Male gobblers weigh 6.8 to 11 kg. Hens usually weigh 3.6 to 5.4 kg. Turkeys' weights change throughout the year depending on how much food is available.

Range mass: 3.6 to 11 kg.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 117 cm

Weight: 7400 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wild turkeys prefer hardwood and mixed conifer-hardwood forests with scattered openings such as pastures, fields, orchards and seasonal marshes.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Wetlands: marsh

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Forest and open woodland, scrub oak, deciduous or mixed deciduous-coniferous areas, especially in mountainous regions (Subtropical and Temperate zones) (AOU 1983). Also agricultural areas in some regions, which may provide important food resources in winter (e.g., in Massachusetts, Vander Haegen et al. 1989). Roosts in trees at night. Severe winters and/or lack of winter habitat are important limiting factors in many northern areas. In a South Dakota ponderosa pine ecosystem, females with young selected mainly large meadows (Rumble and Anderson 1993).

Nests normally on the ground, usually in open areas at the edge of woods; rarely nests in trees (Fletcher, 1994, Wilson Bull. 106:562-563). In South Dakota, almost all nests initiated in April were in woodland communities whereas nests started after the first week of May were primarily in grassland communities; selected nest sites with concealing vegetation immediately above the nest; nests were placed in habitats associated with high interspersion; shrubs were strongly selected for as nesting cover in grassland; grassland nest sites had a high degree of visual obstruction immediately around the nest site (Day et al. 1991). Sites with good concealment also were selected in Arkansas (Badyaev 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wild turkeys prefer hardwood and mixed conifer-hardwood forests with scattered openings such as pastures, fields, orchards and seasonal marshes.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Wetlands: marsh

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, forb

Wild turkeys need mature, open forests (for traveling and seeing
predators) interspersed with grassy openings. The amount of openings
required by wild turkeys varies from 10 to 25 percent of the total
range. Clearings should be spaced so that hens with broods do not have
to travel more than 1 to 2 miles (1.6-3.2 km) [22]. Areas considered
unsuitable include large tracts of even-aged pine on short rotations,
intensely farmed fields, and areas with a lot of human activity. Healy
(in Shroeder [22]) estimated that the best cover for poults in the
Southeast is a grass and forb mixture 15.7 to 27.6 inches (40-70 cm)
tall and with a biomass of 600 to 3,000 kilograms per hectare dry
weight. This should be mixed with trees and a 60 to 100 percent cover
in the understory. For more detailed habitat suitability index models,
see Schroeder [22].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the term: cover

The wild turkey occurs in a variety of habitats from bottomland hardwood
forests to upland woods and pine forests. These forests must be
interspersed with pastures, grasslands, or agricultural land and other
openings that can provide feeding, dusting, and brooding habitat [22].
In Oregon, wild turkeys prefer to roost in large ponderosa pines on
easterly slopes. They also may roost in logging slash on north slopes
between 2,000 and 3,000 feet (610-914 m). In this same part of Oregon,
wild turkeys prefer ponderosa pine-Douglas-fir-oak stands in spring and
summer, mixed conifer stands in spring and winter, and oak stands in
winter [6]. Eastern Texas brooding hens selected low stocked stands
with abundant herbaceous cover [5]. In the Black Hills of South Dakota
wild turkeys nest in slash and on rock outcrops [20]. In Arizona they
will roost in valleys and in ponderosa pines on northerly slopes [23].
In Massachusetts, wild turkeys select agricultural land during winter,
where they have a better chance of surviving severe winters than if they
remained in the forests [27]. In the fields, wild turkeys can feed on
manure.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the term: hardwood

Wild turkeys predominantly inhabit oak (Quercus spp.) and pine (Pinus
spp.)-oak forests across North America [18,21]. They also frequent
bottomland hardwood sites such as those dominated by cottonwood and
aspen (Populus spp.). In the West wild turkeys use ponderosa pine
(Pinus ponderosa)-Douglas-fir (Pseudotsuga menziesii)-oak forests and
mature mixed conifer forests [6]. In the Southwest they use pinyon
(Pinus spp.)-juniper (Juniperus spp.) types mixed with oak [23]. In the
Southeast wild turkeys inhabit loblolly pine (Pinus taeda), slash pine
(P. elliottii), and pond pine (P. serotina) forests mixed with
hardwoods. They also use baldcypress (Taxodium distichum)-water tupelo
(Nyssa aquatica) types [24].

REFERENCES :
NO-ENTRY

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the terms: hardwood, swamp

24 Hemlock - yellow birch
25 Sugar maple - beech - yellow birch
28 Black cherry - maple
39 Black ash - American elm - red maple
40 Post oak - blackjack oak
42 Bur oak
43 Bear oak
44 Chestnut oak
52 White oak - black oak - northern red oak
53 White oak
55 Northern red oak
60 Beech - sugar maple
63 Cottonwood
70 Longleaf pine
71 Longleaf pine - scrub oak
76 Shortleaf pine - oak
78 Virginia pine - oak
81 Loblolly pine
82 Loblolly pine - hardwood
84 Slash pine
85 Slash pine - hardwood
89 Live oak
98 Pond pine
102 Baldcypress - tupelo
103 Water tupelo - swamp tupelo
105 Tropical hardwoods
109 Hawthorn
210 Interior Douglas-fir
217 Aspen
220 Rocky Mountain juniper

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: shrub

K005 Mixed conifer forest
K010 Ponderosa shrub forest
K011 Western ponderosa forest
K012 Douglas-fir forest
K016 Eastern ponderosa forest
K017 Black Hills pine forest
K018 Pine - Douglas-fir forest
K019 Arizona pine forest
K022 Great Basin pine forest
K023 Juniper - pinyon woodland
K024 Juniper steppe woodland
K026 Oregon oakwoods
K029 California mixed evergreen forest
K030 California oakwoods
K031 Oak - juniper woodlands
K032 Transition between K031 and K037
K037 Mountain-mahogany - oak scrub
K051 Wheatgrass - bluegrass
K059 Trans-Pecos shrub savanna
K061 Mesquite - acacia savanna
K062 Mesquite - live oak savanna
K066 Wheatgrass - needlegrass
K067 Wheatgrass - bluestem - needlegrass
K079 Palmetto prairie
K080 Marl - Everglades
K081 Oak savanna
K083 Cedar glades
K084 Cross Timbers
K086 Juniper - oak savanna
K087 Mesquite - oak savanna
K090 Live oak - sea oats
K091 Cypress savanna
K092 Everglades
K098 Northern floodplain forest
K099 Maple - basswood forest
K100 Oak - hickory forest
K101 Elm - ash forest
K102 Beech - maple forest
K103 Mixed mesophytic forest
K104 Appalachian oak forest
K106 Northern hardwoods
K109 Transition between K104 and K106
K110 Northeastern oak - pine forest
K111 Oak - hickory - pine forest
K112 Southern mixed forest
K113 Southern floodplain forest
K115 Sand pine scrub

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES26 Lodgepole pine
dFRES28 Western hardwoods
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Wild turkeys are omnivorous. They primarily eat vegetable matter such as acorns, nuts, seeds, buds, leaves and fern fronds. They also eat ground-dwelling insects and salamanders, which account for about 10% of their diet. Wild turkeys forage primarily on the ground, though they occasionally mount shrubs and low trees to reach fruits and buds. Most foraging occurs during the 2 to 3 hours after dawn and before dusk.

Animal Foods: amphibians; insects

Plant Foods: leaves; roots and tubers; seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds on seeds, nuts, acorns, fruits, and grains, buds, and young grass blades. During summer eats many insects; may also eat some small vertebrates (frogs, toads, snakes, etc). Principal winter foods in the northeastern part of the range include acorns, fruits of multiflora rose and barberry, apples, field corn, fertile fronds of sensitive fern and various other ferns, mosses, and hardwood seeds and buds. In Massachusetts, manure spread on fields was an important source of food in winter (Vander Haegen et al. 1989). Usually forages on the ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Wild turkeys are omnivorous. They mostly eat plant material, including acorns, nuts, seeds, buds, leaves and fern fronds. They also eat insects and salamanders. Wild turkeys search for food on the ground, but they occasionally fly to the top of a shrub or a small tree to feed on fruit or buds. They usually feed for 2 to 3 hours after dawn and before dusk.

Animal Foods: amphibians; insects

Plant Foods: leaves; roots and tubers; seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

More info for the term: mast

Wild turkeys eat fruits, seeds, tubers, bulbs, and greens of locally
common plants. They also eat animals such as snails, spiders,
grasshoppers, millipedes, and salamanders [22]. Grasses are usually
important spring foods, while mast and fruits are important during the
fall and winter. Poults rely on insects for protein. Some plant food
species of the wild turkey include flowering dogwood (Cornus florida),
wild cherry (Prunus serotina), black gum (Nyssa sylvatica), hackberry
(Celtis occidentalis), hickory (Carya spp.), hawthorn (Crateagus spp.),
oak, cottonwood and aspen (Populus spp.), pinyon, juniper, prickly pear
(Opuntia spp.), sumac (Rhus spp.), wheat (Triticum aestivum), alfalfa
(Medicago sativa), rye (Secale cereale), soybean (Glycine max), paspalum
(Paspalum spp.), and panic grass (Panicum spp.) [18,22,23]. Wild
turkeys must be near drinking water on a daily basis [26].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Wild turkeys provide food for their predators and impact populations of the plants whose seeds and nuts they eat.

Wild turkeys also host at least 60 different species of parasites. These include 9 protozoans, 11 trematodes, 10 cestodes, 1 acanthocephalan, 17 nematodes and 12 arthropods.

Commensal/Parasitic Species:

  • protozoans
  • trematodes
  • cestodes
  • acanthocephalan
  • nematodes
  • arthropods

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators of wild turkey eggs and nestlings include raccoons, opossums, striped skunks, grey foxes, birds, woodchucks, rodents, spotted skunks, bobcats, rat snakes and bull snakes.

Humans are the primary predator of adult wild turkeys. Other predators include coyotes, bobcats, raccoons, mountain lions, golden eagles, and great horned owls.

Known Predators:

  • raccoons
  • opossums
  • striped skunks
  • grey foxes
  • birds
  • woodchucks
  • rodents
  • spotted skunks
  • bobcats
  • rat snakes
  • bull snakes
  • coyotes
  • mountain lions
  • golden eagles
  • great horned owls
  • humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Wild turkeys provide food for their predators and impact populations of the plants whose seeds and nuts they eat.

Wild turkeys also host at least 60 different species of parasites. These include 9 Myxozoa, 11 trematodes, 10 Cestoda, 1 Acanthocephala, 17 Nematoda and 12 Arthropoda.

Commensal/Parasitic Species:

  • Myxozoa
  • trematodes
  • Cestoda
  • Acanthocephala
  • Nematoda
  • Arthropoda

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Predators of wild turkey eggs and nestlings include Procyon lotor, Didelphis virginana, Mephitis mephitis, Urocyon cinereoargenteus, Aves, Marmota monax, Rodentia, Spilogale putorius, Felis rufus, Elaphe obsoleta and Pituophis melanoleucus.

Humans are the primary predator of adult wild turkeys. Other predators include Canis latrans, Felis rufus, Procyon lotor, Felis concolor, Aquila chrysaetos, and Bubo virginianus.

Known Predators:

  • Procyon lotor
  • Didelphis virginana
  • Mephitis mephitis
  • Urocyon cinereoargenteus
  • Aves
  • Marmota monax
  • Rodentia
  • Spilogale putorius
  • Felis rufus
  • Elaphe obsoleta
  • Pituophis melanoleucus
  • Canis latrans
  • Felis concolor
  • Aquila chrysaetos
  • Bubo virginianus
  • homo sapiens

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Predators of the turkey include humans, coyote (Canis latrans), skunks,
weasels, mink (Mustelidae), raccoon (Procyon lotor), opossum (Didephis
virginiana), feral dog (Canis commonis), bobcat (Felis rufus), foxes
(Vulpes spp., Urocyon spp.), squirrels, chipmunks (Sciuridae), hawks
(Buteo spp., Accipiter spp.), raven, crow, magpie (Corvidae), and
various snake species [18,21,22].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Sexes usually form separate flocks in winter. In Massachusetts, predation exerted greatest influence on productivity; in Minnesota, winter conditions and resulting pre-breeding female condition were important factor in productivity (Vander Haegen et al. 1988). In southeastern Oklahoma, mean seasonal home range sizes for adult females were 225 ha (winter), 865 ha (spring), 780 ha (summer), and 459 ha (fall) (Bidwell et al. 1989). Home range in Montana was 260 to 520 hectares (Jonas 1966). In Colorado, adult males moved an average distance of 5.3 km from winter ranges to spring breeding areas; subadult males moved an average distance of 8.7 km; in spring males moved about 1000 m between morning and evening roosts used on the same day (Hoffman 1991). In north, deep snow restrict movements.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the term: mast

Annual prescribed burns in longleaf-wiregrass (Aristida spp.)-bracken
fern (Pteridium aquilegia) types of Georgia stimulated the growth of
important wild turkey food plants like legumes and panic grass [4].
Following prescribed fires in the Georgia Piedmont, total seed
production of desirable food plants increased during postburn year 1
from 6.4 kilograms per hectare to 26.4 kilograms per hectare [7].
Spring, late summer, and winter fires in Texas slash pine plantations
seriously reduced mast production but increased fruiting of flowering
dogwood [19]. Loblolly pine stands in South Carolina were burned to
determine the effects of fire on wild turkeys [8]. One plot, burned
every winter for 20 years showed an increase in desired food plants like
winged sumac (Rhus copallina), beggartick (Desmodium spp.), and
partridge pea (Cassia nictitans). An adjacent plot burned every summer
for 20 years and one unburned plot showed little to no value for
wildlife.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

Mating Season - February through April
Incubation - 28 days; 10 to 13 eggs; preccocial young
Age of Maturity - 1 year, but may not mate until 2 to 3 years of age;
polygamous
Longevity - can live to 10 or 12 years, but 5 years is considered "old";
annual mortality of 50% in a population is common
[13,18,21,26]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Wild turkeys use vocalizations and physical displays to communicate. For example, during the spring, males will fan out their tails, strut and "gobble" in an attempt to attract and retain a harem of females. Biologists recognize at least 15 different wild turkey vocalizations, including the widely recognized "gobble". The "gobble" is give primarily by males with the purpose of attracting females and repelling competing males. Other vocalizations are used by both sexes to communicate a variety of messages.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Wild turkeys use calls and body signals to communicate. For example, during the spring, males will fan out their tails, strut around and "gobble" to try to attract females. Wild turkeys give at least 15 different calls. The most easily recognized call is the "gobble". Males use the "gobble" call to attract female mates and to tell other males to stay away.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Most active in early morning and late afternoon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The average life expectancy for wild turkeys is estimated at 1.3 to 1.6 years. The oldest known wild turkey lived at least 13 years.

Range lifespan

Status: wild:
13 (high) years.

Typical lifespan

Status: wild:
1.3 to 1.6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The oldest known wild turkey lived at least 13 years. Most wild turkeys probably live less than two years.

Range lifespan

Status: wild:
13 (high) years.

Typical lifespan

Status: wild:
1.3 to 1.6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13 years (wild) Observations: Mortality in wild populations of 50% per year is common. Generally do not live over 5 years in the wild (http://www.fs.fed.us/database/feis/), though record longevity in the wild is 13 years (http://www.demogr.mpg.de/longevityrecords).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Wild turkeys are polygynous. Males attempt to attract females by "gobbling" and "strutting" with their tail fanned out, their wings lowered and dragging on the ground, their back feathers erect, their head thrown back and their crop inflated. The gobbles of male wild turkeys can be heard more than 1.5 kilometers away (or approximately 1 mile).

Mating System: polygynous

Wild turkeys breed in early spring; southern populations begin courtship in late January and northern populations begin in late February. They raise one brood per season. The nest is a shallow depression in the ground, usually surrounded by dense brush, vines, tangles, deep grass, or fallen tree tops. The female scratches out the nest and lays 4 to 17 (usually 8 to 15) eggs. She incubates the eggs for 25 to 31 days. The chicks are precocial, and are able walk and feed themselves within 24 hours of hatching. The female broods the chicks at night for the first 2 weeks after hatching. She also defends them from predators, sometimes pursuing hawks or other predators. The young turkeys (called poults) stay with the female parent through the fall (males) or the early spring (females). Turkeys are capable of breeding at about 10 months old, though young males are typically not successful in competing with older males for mates during their first spring.

Egg dumping (laying eggs in another female's nest) is common in this species. This species is also known to lay eggs in the nests of ruffed grouse. Ring-necked pheasants are known nest parasites of wild turkeys.

Breeding interval: Wild turkeys breed once per year.

Breeding season: Courtship begins in early spring (January to February).

Range eggs per season: 4 to 17.

Range time to hatching: 25 to 31 days.

Range fledging age: 24 (high) hours.

Range time to independence: 4 to 10 months.

Average age at sexual or reproductive maturity (female): 10 months.

Average age at sexual or reproductive maturity (male): 10 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 11.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Male wild turkeys do not provide any parental care. Female wild turkeys prepare the nest, incubate the eggs, and care for the young until the next spring (fall for male poults). The chicks are precocial, and are able to walk and feed themselves within 24 hours of hatching.

Parental Investment: no parental involvement; precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Protecting: Female); pre-independence (Protecting: Female)

  • Eaton, S. 1992. Wild Turkey (Meleagris gallopavo). Pp. 1-28 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 22. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Female incubates average of 10-12 eggs for 27-28 days, beginning ning late April-early May in Alabama, Florida, New York, early May in Minnesota; most nests initiated mid-April to mid-May in northeastern Colorado. Hatching begins in May in south, usually early June in north. Young are tended by female; brood stays together until winter. Females first breed as yearlings.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wild turkeys are polygynous (one male mates with many females). Males try to attract females by calling (called "gobbling"). The gobbles of male wild turkeys can be heard more than 1.5 kilometers away (or about a mile). Males also try to attract females by "strutting". They do this by walking around with their tail fanned out, their wings dragging on the ground, their feathers puffed up and their throat puffed out.

Mating System: polygynous

Wild turkeys breed in early spring. Southern populations usually begin courtship activities in late January and northern populations begin in late February. Turkeys raise one brood of chicks per year.

Turkey nests are just shallow bowl-shaped holes scratched in the dirt. They are usually under dense brush or vines, or in deep grass. The female scratches out the nest and lays 4 to 17 eggs. She incubates the eggs for 25 to 31 days. The chicks are well-developed when they hatch. They are able to walk and feed themselves the day after they hatch. For the first two weeks after hatching, the female covers the chicks at night (called brooding) to protect them and keep them warm. She also protects them from predators. The young turkeys are called poults. Male poults stay with their mother through the fall. Female poults stay with their mother until spring.

Turkeys can breed when they are about 10 months old. However, male turkeys usually do not breed this young because females prefer to mate with older males.

Breeding interval: Wild turkeys breed once per year.

Breeding season: Courtship begins in early spring (January to February).

Range eggs per season: 4 to 17.

Range time to hatching: 25 to 31 days.

Range fledging age: 24 (high) hours.

Range time to independence: 4 to 10 months.

Average age at sexual or reproductive maturity (female): 10 months.

Average age at sexual or reproductive maturity (male): 10 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 11.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Male wild turkeys do not care for their chicks. The female parent does all of the parental care. The female makes the nest, incubates the eggs, and cares for the chicks.

Parental Investment: no parental involvement; precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Protecting: Female); pre-independence (Protecting: Female)

  • Eaton, S. 1992. Wild Turkey (Meleagris gallopavo). Pp. 1-28 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 22. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Meleagris gallopavo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTTTCATCAACCGATGATTATTTTCAACCAACCATAAAGATATTGGCACTCTTTACCTAATTTTTGGCACATGAGCAGGTATAGTCGGCACAGCACTTAGCCTGCTAATCCGTGCAGAACTGGGACAACCTGGGACACTCCTAGGAGACGACCAAATCTATAACGTAATCGTCACAGCCCATGCCTTCGTTATAATCTTCTTTATAGTTATACCTATCATGATCGGAGGCTTCGGTAACTGACTTGTACCACTTATAATTGGTGCCCCAGACATGGCATTCCCACGTATAAATAATATAAGCTTCTGACTCCTTCCACCTTCCTTTCTTCTTCTGCTAGCCTCTTCTACCGTAGAAGCTGGAGCTGGCACTGGATGAACTGTCTACCCACCTTTAGCTAGCAACCTTGCCCACGCTGGTGCATCAGTAGACCTAACTATTTTTTCCCTCCACCTAGCAGGTGTATCCTCCATCCTAGGAGCAATCAACTTTATTACTACTATTATTAACATAAAACCCCCAGCACTGTCACAATACCAAACACCCCTATTTGTTTGATCCGTTCTCATTACCGCTATCCTCCTATTACTCTCTCTACCAGTCCTTGCCGCCGGAATTACAATACTTCTTACTGACCGCAACCTTAACACTACATTCTTTGACCCCGCAGGAGGAGGAGACCCAATCCTATATCAACACCTATTTTGATTTTTTGGCCACCCCGAAGTTTATATCCTCATTCTTCCAGGTTTCGGAATAATCTCCCACGTGGTAGCATATTATGCAGGAAAGAAAGAGCCCTTCGGATATATAGGAATAGTCTGAGCAATACTATCAATTGGATTCTTAGGCTTCATCGTATGAGCCCACCACATATTCACAGTCGGAATGGATGTGGACACCCGAGCTTACTTCACATCAGCCACCATAATTATTGCTATCCCAACTGGCATTAAAGTCTTCAGCTGATTGGCAACCTTGCACGGAGGAACAATTAAATGAGACCCACCTATGCTATGGGCCTTAGGATTTATCTTCCTATTCACTATTGGAGGTCTTACGGGAATTGTCCTCGCCAATTCATCCCTCGACATTGCCCTCCACGACACCTACTACGTAGTTGCCCACTTCCACTATGTCCTCTCAATAGGAGCAGTTTTCGCCATTTTAGCAGGCTTCACCCACTGATTCCCTCTTTTCACAGGCTTCACCCTCCATCCTTCATGAACTAAAGCCCACTTCGGAGTGATATTTACAGGAGTAAACTTAACCTTCTTCCCACAACACTTCTTAGGTTTAGCTGGTATACCCCGACGATACTCGGACTATCCAGATGCCTATACCCTATGAAATACATTATCCTCAATCGGCTCTTTAATCTCAATAACAGCCGTAATCATACTCATGTTCATCGTCTGAGAAGCCTTCTCAGCAAAACGAAAAGTACTACACCCTGAACTAACCTCTACCAACATTGAATGAATCCACGGATGTCCACCCCCATACCACACTTTCGAAGAACCGGCCTTCGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Meleagris gallopavo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5