Overview

Distribution

Sub-Saharan Africa: all S of Sahara except forest area and parts of NE and SW; NW Morocco (sabyi); introduced Cape Verde Is.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lack 2010

Source: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

All open habitats

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lack 2010

Source: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Movements and dispersal

Resident

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lack 2010

Source: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Numida meleagris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAACCGATGATTATTCTCAACCAATCACAAAGACATTGGCACTCTTTACCTAATCTTTGGCACATGAGCAGGCATAGTCGGCACAGCACTCAGCCTGTTAATCCGCGCAGAACTAGGACAACCAGGGACCCTTTTAGGGGACGACCAAATTTATAATGTAATCGTCACAGCCCATGCCTTCGTCATAATTTTCTTCATAGTTATACCAATCATGATCGGCGGCTTCGGAAACTGACTAGTACCACTAATAATCGGTGCCCCGGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCCTCCTTCCTCCTTCTACTAGCATCCTCTACTGTAGAAGCTGGAGCTGGCACAGGATGAACTGTCTACCCACCCCTAGCCAGCAACCTTGCCCATGCTGGCGCCTCCGTAGACTTAGCTATCTTCTCCCTCCACCTAGCAGGTGTCTCATCCATCTTAGGTGCTATCAACTTCATTACCACCATCATCAACATAAAACCCCCTGCATTAACACAATACCAAACACCCTTATTCGTATGATCAGTCCTCATCACCGCCGTCCTTCTCCTCCTATCCCTACCGGTCCTCGCCGCTGGCATTACAATACTCCTCACTGATCGAAACCTCAACACCACATTCTTCGACCCAGCTGGAGGCGGAGACCCAGTACTATACCAGCACCTATTCTGATTCTTCGGCCACCCTGAAGTCTACATCCTCATCCTCCCAGGATTCGGAATTATCTCACACGTAGTAGCATACTACGCAGGGAAAAAAGAACCATTCGGCTACATAGGAATAGTCTGAGCCATGATATCCATCGGATTCCTAGGCTTCATCGTATGAGCCCACCACATATTCACAGTCGGGATGGACGTAGACACCCGAGCTTACTTCACATCTGCCACCATAATCATCGCCATCCCAACCGGCATCAAAGTCTTCAGCTGACTAGCCACCCTGCACGGAGGAACAATCAAATGAGACCCTCCCATTCTATGAGCCCTGGGATTCATCTTCCTATTCACTATCGGAGGCCTAACAGGAATCGTCCTTGCTAACTCATCCCTAGACATTGCCCTCCACGATACCTACTATGTTGTTGCCCACTTCCACTATGTCCTCTCAATGGGGGCAGTTTTTGCTATTCTAGCAGGATTTACCCACTGATTCCCCCTATTCACAGGTTTCACCCTTCACCCCTCATGAACCAAAGCACACTTTGGAGTTATATTCACAGGAGTTAACCTAACCTTCTTCCCACAGCACTTTTTAGGCCTAGCTGGCATGCCCCGACGATACTCCGACTACCCAGACGCCTACACACTATGAAACACCCTATCTTCAATCGGCTCATTAATCTCAATAACAGCCGTAATTATGCTAATATTCATCGTCTGAGAAGCATTCTCAGCTAAGCGAAAAGTCCTCCAACCAGAACTAACCGCCACCAACATTGAATGAATCCACGGCTGCCCGCCCCCATATCACACCTTTGAAGAACCAGCCTTTGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Numida meleagris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Helmeted Guineafowl

The Helmeted Guineafowl (Numida meleagris) is the best known of the guineafowl bird family, Numididae, and the only member of the genus Numida. It breeds in Africa, mainly south of the Sahara, and has been widely introduced into the West Indies, Brazil, Australia and southern France.

Contents

Taxonomy [edit]

The extinct subspecies N. m. sabyi

In the early days of the European colonisation of North America, the native Wild Turkey (Meleagris gallopavo) was confused with this species. This led to the English name of the American bird, since Turkey and Guinea were equally far-off and exotic places. The word meleagris, Greek for guineafowl, is also shared in the scientific names of the two species, although for the guineafowl it is the species name, whereas for the turkey, it is the name of the genus and (in an altered state) the family.

Subspecies [edit]

There are nine recognized subspecies:

Description [edit]

Helmeted Guineafowl, Drakensberg, KZN, South Africa

The Helmeted Guineafowl is a large (53–58 cm) bird with a round body and small head. They weigh about 1.3 kg. The body plumage is gray-black spangled with white. Like other guineafowl, this species has an unfeathered head, in this case decorated with a dull yellow or reddish bony knob, and red and blue patches of skin. The wings are short and rounded, and the tail is also short. Various sub-species are proposed, differences in appearance being mostly a large variation in shape, size and colour of the casque and facial wattles.

Behaviour and ecology [edit]

Young keets with an adult, Drakensberg, KZN, South Africa

This is a gregarious species, forming flocks outside the breeding season typically of about 25 birds that also roost communally. Guineafowl are particularly well-suited to consuming massive quantities of ticks, which might otherwise spread lyme disease.[2] These birds are terrestrial, and prone to run rather than fly when alarmed. Like most gallinaceous birds, they have a short-lived explosive flight and rely on gliding to cover extended distances. Helmeted Guineafowl are great runners, and can walk 10 km and more in a day. They make loud harsh calls when disturbed. Their diet consists of a variety of animal and plant food; seeds, fruits, greens, snails, spiders, worms and insects, frogs, lizards, small snakes and small mammals. Guineafowl are equipped with strong claws and scratch in loose soil for food much like domestic chickens, although they seldom uproot growing plants in so doing. As with all of the numididae, they have no spurs.

Males often show aggression towards each other, and will partake in ravenous fighting which will leave other males bloodied and otherwise injured. Attempts at making themselves look fearsome is when their wings raise upwards from their sides and feathers bristle across the length of the body, or they may also rush forwards with a gaping beak. The nest is a well-hidden, generally unlined scrape and a clutch is normally 6-12 eggs which the female incubates for 26–28 days. Nests containing larger numbers of eggs are generally believed to be the result of more than one hen using the nest; eggs are large and an incubating bird could not realistically cover significantly more than a normal clutch. Domestic birds at least, are notable for producing extremely thick-shelled eggs that are reduced to fragments as the keets hatch, rather than leaving two large sections and small chips from where any keet has removed the end of the egg. It has been noted that domesticated Guinea hens are not the best of mothers, and will often abandon their nests. The keets are cryptically coloured and rapid wing growth enables them to flutter onto low branches barely a week after hatching. These guineafowl live as long as 12 years in the wild.

Habitat [edit]

Upper body

It breeds in warm, fairly dry and open habitats with scattered shrubs and trees such as savanna or farmland. Flocks of guineafowl have flourished in recent years in the Southern Suburbs of Cape Town, where they seem to have adapted remarkably well. The flocks move slowly along the quieter suburban roads, looking for food on the grassy 'pavements' and in gardens where the fence is low enough for some to enter without feeling separated from the flock. They often roost at night on the roofs of bungalows. While residents generally appreciate the local wildlife, it can be a nuisance, obstructing traffic and making a lot of noise in the early morning. Their success is probably due to the large but cautious flock - they can fend off cats, do not enter gardens with dogs, and are visible enough in the quiet roads in which they live to avoid being run over. Although many young guineafowl manage to fall down drains (and are left behind by the flock), it is not enough to restrain their numbers. Adult birds are sometimes caught and eaten by the homeless.

Domestication [edit]

Helmeted Guineafowl are often domesticated, and it is this species that is sold in Western supermarkets.

References [edit]

  1. ^ BirdLife International (2008). Numida meleagris. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 22 April 2009.
  2. ^ Duffy, David Cameron; Downer, Randall; Brinkley, Christie (June 1992). "The effectiveness of Helmeted Guineafowl in the control of the deer tick, the vector of Lyme disease". The Wilson Bulletin 104 (2): 342–345. 

Further reading [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Domesticated guineafowl

Guineafowl, sometimes called Pintade, are a family of birds originating from Africa, related to other game birds such as the pheasants, turkeys and partridges; they have a long history of domestication, mainly involving the Helmeted Guineafowl.

They lay 25–30 eggs in a deep, tapering nest. Their eggs are small, dark and extremely thick-shelled. The hens have a habit of hiding their nests, and sharing it with other hens until large numbers of eggs have accumulated. The incubation period is 26–28 days, and the chicks are called "keets". As keets, they are highly susceptible to dampness (they are indigenous to the drier/arid regions of Africa) and can die from following the mother through dewy grass. After their first two to six weeks of growth, though, they can be some of the hardiest domestic land fowl.

Sexing the birds is not as simple as telling a rooster from a hen chicken. When they are adults, the helmet and wattles of the male are larger than those of the female, and only the female makes the two-note cry imitated as "Buck-wheat!" or "Pot-Rack!" Aside from that, though, the two sexes are mostly identical in appearance.

As domestics, guineafowl are valuable pest controllers, eating many insects. They are especially beneficial in controlling the Lyme disease-carrying deer tick, as well as wasp nests. While they are rarely kept in large numbers, a few are sometimes kept with other fowl to be used as a security system against birds of prey. They will call with their loud, high shrieking voices if concerned about intruders. They are highly social birds and tend to languish when alone.

Within the domesticated species, many color variations have been bred forth aside from the "pearl" or natural color of the Helmeted Guinea. These include White, Purple, Slate, Chocolate, Lavender, and Coral Blue, Bronze, Pewter, Buff Dundotte, Blonde, and various Pieds.

It can be cooked using any recipe that calls for chicken, but is considered to be more flavorful and, because of its higher cost, is generally served at special occasions. It is particularly common in French and Italian recipes.

A three-day-old keet
An adolescent Lavender
A cooked guinea hen
Domestic Guinea Fowl in India

References

  • Madge and McGowan,Pheasants, Partridges and Grouse ISBN 0-7136-3966-0
  • J.S. Ferguson, Gardening with Guineas ISBN 0-7392-0250-2 Comprehensive discussion of all aspects of raising domesticated guineafowl.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!