Overview

Distribution

Range Description

Coturnix japonica breeds in eastern Asia, including northern Mongolia, Sakhalin Island and the Baikal and Vitim regions of Russia, north-eastern China, Japan, North Korea and South Korea. Some populations in Japan are resident, but most birds migrate south, wintering in southern China, Laos, Vietnam, Cambodia, Myanmar, Bhutan and north-eastern India (del Hoyo et al. 1994). There are also introduced populations in Italy and Hawaii (USA). No reliable population estimate exists, and although the species was previously considered to be fairly common in China (del Hoyo et al. 1994), declines appear to have occurred in Laos (Duckworth 2009) and Japan (Okuyama 2004, H. Nagata in litt. 2009), and there are fears that the species has undergone a significant decline overall (del Hoyo et al. 1994, Duckworth 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In general, this quail inhabits parts of Russia (Johnsgard 1988) and eastern Asia, including Japan, Korea and China (Hoffmann 1988) as well as India (Finn 1911). It winters in China, southeast Asia, the extreme northwestern coast of Africa, and a subsaharan band north of Congo and including the Nile River valley from Egypt to Kenya. A small population has been found in Angola. Races of this quail are found in Kenya, Tanzania, Malawi south to South Africa, Mozambique, and Namibia as well as parts of Madagascar. This quail may breed in parts of Europe, Turkey, and central Asia to parts of China (Alderton 1992).

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to eastern Asia. Introduced and established in Hawaii (apparently established on all main islands except Oahu) (Pratt et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

E Palearctic; winters to SE Asia and e China.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The Japanese Quail is similar in appearance to the European Common Quail, Coturnix coturnix. Overall, they are dark brown with buff mottling above and lighter brown underneath. They have a whitish stripe above the eye on the side of the head. Legs are orangish-gray to pinkish-gray as is the beak (Hoffmann 1988). In contrast to the males, females usually (but not always) lack the rufous coloring on the breast and black flecking or markings on the throat (Johnsgard 1988).

There are variations in plumage color. Some birds are whitish to buff with rufous to chestnut mottling above. Others have a very dark brown appearance with little to no mottling. In addition, there have been golden-brown varieties bred in captivity (Hoffmann 1988).

Wing sizes in males and females is similar ranging from 92 to 101 mm. Both male and female have similar sized tails ranging from 35-49 mm in length (Johnsgard 1988).

Average mass: 90 g.

Other Physical Features: endothermic ; bilateral symmetry

Average mass: 115 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 19 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is an annual migrant, although some populations in Japan are resident (del Hoyo et al. 1994). Egg-laying occurs from late April to early August in Russia, and late May to August in Japan. Clutch size is varied, with larger clutches in Russia (nine to ten) than in Japan (five to eight). The female is the sole incubator of the eggs (del Hoyo et al. 1994). Habitat Little is known about the preferred habitat of this species, although it is thought to prefer open habitats such as meadows, steppes, and dry mountain slopes near water. It has also been recorded in grassland and cultivated land (del Hoyo et al. 1994). Diet Its diet is thought to include a wide variety of plant matter, and it will also take terrestrial invertebrates in summer (del Hoyo et al. 1994).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These quail are seen in grassy fields, on river banks, or in rice fields (Takatsukasa 1941).

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Often seen in drier parts of Hawaii, in fallow fields along north shore of Kauai, and in pasturelands on northwestern slope of Haleakala, Maui; prefers short (about 40 cm) ground cover (Pratt et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

These quail eat many kinds of grass seeds, including pannicum and white millet. Their diet consists of a higher degree of protein than Painted Quail as these quail will eat more small worms and insect larvae. In the summer, they will especially seek and eat a variety of insects and small invertebrates (Johnsgard 1988). In addition, they eat grit, especially egg-laying females (Lambert 1970).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 6 years Observations: The Japanese quail displays a well-defined ageing process. Signs of ageing are visible at little over one year of age. In the wild, these animals generally live 2-3 years (Ottinger 2001).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

As with other quail, eggs were laid at a rate of one per day (Lambert 1970), with 7-14 eggs per clutch (Hoffmann 1988). An egg averages 29.8 by 21.5 mm is size and weighs 7.6 g (Johnsgard 1988). Incubation time is 19-20 days (Lambert 1970), although clutch sizes have been associated with latitude and length of photoperiod. In Japan, clutch size is 5-8 eggs, while in Russia, clutch size is 5-9 eggs (Johnsgard 1988). The chicks are considered to be mature and able to mate after four weeks old (Hoffmann 1988).

The breeding season varies with location. In Russia, the season starts in late April and continues to early August. In Japan, nesting occurs from late in May and usually ends in August. On the rare occasion, eggs may be found in nests in September (Johnsgard 1988).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 17 days.

Average age at sexual or reproductive maturity (male)

Sex: male:
52 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
63 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coturnix japonica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAACCGATGACTATTTTCAACTAACCACAAAGACATTGGCACTCTTTATCTTATTTTTGGTACATGAGCAGGCATAGCCGGTACAGCACTTAGCTTGTTAATCCGCGCAGAACTAGGACAACCAGGCACCCTCCTAGGAGATGACCAAATTTACAATGTAATTGTCACAGCACATGCCTTCGTCATAATCTTCTTTATAGTCATACCAATTATAATTGGAGGCTTCGGAAATTGACTCGTCCCACTTATAATCGGAGCCCCAGACATAGCATTCCCACGTATGAATAACATAAGCTTCTGACTCCTCCCACCCTCCTTCCTGCTGCTACTAGCTTCTTCCACCGTTGAAGCTGGTGCCGGTACAGGATGAACTGTCTACCCGCCCCTAGCCGGCAACCTCGCCCACGCCGGAGCATCAGTAGATCTAGCCATCTTCTCCCTACATTTAGCAGGTGTATCATCAATCCTAGGAGCCATCAACTTTATCACCACTATTATCAATATAAAACCCCCTGCACTGTCACAATACCAAACACCCCTATTTGTTTGATCAGTCCTCATCACCGCTATCTTACTCCTACTCTCCCTCCCAGTCCTAGCTGCTGGCATTACTATACTTCTAACTGATCGAAACCTCAACACTACATTCTTTGACCCTGCAGGAGGAGGAGACCCCATCCTGTATCAACACTTATTTTGATTCTTTGGACACCCAGAAGTCTACATCCTCATCCTCCCAGGCTTCGGAATCATCTCCCACGTAGTAGCCTACTACGCAGGGAAAAAAGAACCATTCGGCTATATAGGAATAGTGTGAGCAATATTATCAATCGGATTCCTAGGATTCATCGTATGAGCCCACCATATATTCACAGTAGGAATAGACGTAGATACACGAGCCTACTTTACATCAGCTACAATAATCATTGCCATCCCAACCGGTATCAAAGTTTTCAGCTGACTAGCAACCCTACACGGAGGAACAATCAAATGAGATCCGCCCATACTATGAGCCCTCGGATTCATCTTCCTATTCACCATCGGAGGACTAACAGGGATCGTTCTTGCCAATTCATCACTTGACATCGCCCTCCATGACACCTATTACGTAGTCGCCCACTTCCACTACGTCCTATCCATAGGAGCAGTCTTTGCTATTTTAGCAGGATTCACCCACTGATTCCCACTATTCACAGGCTTCACCCTTCATCCTACATGAACTAAGGCACACTTTGGAGTAATGTTCACAGGAGTCAACCTAACCTTCTTCCCACAGCACTTCCTAGGCCTAGCTGGTATACCCCGACGATACTCAGACTACCCAGATGCCTACACACTTTGAAACACACTATCCTCAATCGGCTCCTTAATCTCAATAACAGCCGTAATCATACTAATGTTTATTGTATGAGAAGCCTTCTCAGCAAAACGTAAAGTTCTTCAGCCAGAATTAACTGCTACCAACATCGAATGAATCCACGGCTGCCCACCCCCATACCACACCTTCGAAGAACCTGCCTTCGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Coturnix japonica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Okuyama, M.

Justification
This species is listed as Near Threatened because it is suspected to be undergoing a moderately rapid population decline, potentially owing to hunting and shifts in agriculture. Research is urgently required to establish population numbers, trends, and to assess and mitigate the threats to the species.


History
  • Near Threatened (NT)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)