Overview

Distribution

In general, this quail inhabits parts of Russia (Johnsgard 1988) and eastern Asia, including Japan, Korea and China (Hoffmann 1988) as well as India (Finn 1911). It winters in China, southeast Asia, the extreme northwestern coast of Africa, and a subsaharan band north of Congo and including the Nile River valley from Egypt to Kenya. A small population has been found in Angola. Races of this quail are found in Kenya, Tanzania, Malawi south to South Africa, Mozambique, and Namibia as well as parts of Madagascar. This quail may breed in parts of Europe, Turkey, and central Asia to parts of China (Alderton 1992).

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Coturnix japonica breeds in eastern Asia, including northern Mongolia, Sakhalin Island and the Baikal and Vitim regions of Russia, north-eastern China, Japan, North Korea and South Korea. Some populations in Japan are resident, but most birds migrate south, wintering in southern China, Laos, Vietnam, Cambodia, Myanmar, Bhutan and north-eastern India (del Hoyo et al. 1994). There are also introduced populations in Italy and Hawaii (USA). No reliable population estimate exists, and although the species was previously considered to be fairly common in China (del Hoyo et al. 1994), declines appear to have occurred in Laos (Duckworth 2009) and Japan (Okuyama 2004, H. Nagata in litt. 2009), and there are fears that the species has undergone a significant decline overall (del Hoyo et al. 1994, Duckworth 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to eastern Asia. Introduced and established in Hawaii (apparently established on all main islands except Oahu) (Pratt et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

E Palearctic; winters to SE Asia and e China.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The Japanese Quail is similar in appearance to the European Common Quail, Coturnix coturnix. Overall, they are dark brown with buff mottling above and lighter brown underneath. They have a whitish stripe above the eye on the side of the head. Legs are orangish-gray to pinkish-gray as is the beak (Hoffmann 1988). In contrast to the males, females usually (but not always) lack the rufous coloring on the breast and black flecking or markings on the throat (Johnsgard 1988).

There are variations in plumage color. Some birds are whitish to buff with rufous to chestnut mottling above. Others have a very dark brown appearance with little to no mottling. In addition, there have been golden-brown varieties bred in captivity (Hoffmann 1988).

Wing sizes in males and females is similar ranging from 92 to 101 mm. Both male and female have similar sized tails ranging from 35-49 mm in length (Johnsgard 1988).

Average mass: 90 g.

Other Physical Features: endothermic ; bilateral symmetry

Average mass: 115 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 19 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

These quail are seen in grassy fields, on river banks, or in rice fields (Takatsukasa 1941).

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour This species is an annual migrant, although some populations in Japan are resident (del Hoyo et al. 1994). Egg-laying occurs from late April to early August in Russia, and late May to August in Japan. Clutch size is varied, with larger clutches in Russia (nine to ten) than in Japan (five to eight). The female is the sole incubator of the eggs (del Hoyo et al. 1994). Habitat Little is known about the preferred habitat of this species, although it is thought to prefer open habitats such as meadows, steppes, and dry mountain slopes near water. It has also been recorded in grassland and cultivated land (del Hoyo et al. 1994). Diet Its diet is thought to include a wide variety of plant matter, and it will also take terrestrial invertebrates in summer (del Hoyo et al. 1994).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Often seen in drier parts of Hawaii, in fallow fields along north shore of Kauai, and in pasturelands on northwestern slope of Haleakala, Maui; prefers short (about 40 cm) ground cover (Pratt et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

These quail eat many kinds of grass seeds, including pannicum and white millet. Their diet consists of a higher degree of protein than Painted Quail as these quail will eat more small worms and insect larvae. In the summer, they will especially seek and eat a variety of insects and small invertebrates (Johnsgard 1988). In addition, they eat grit, especially egg-laying females (Lambert 1970).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 6 years Observations: The Japanese quail displays a well-defined ageing process. Signs of ageing are visible at little over one year of age. In the wild, these animals generally live 2-3 years (Ottinger 2001).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

As with other quail, eggs were laid at a rate of one per day (Lambert 1970), with 7-14 eggs per clutch (Hoffmann 1988). An egg averages 29.8 by 21.5 mm is size and weighs 7.6 g (Johnsgard 1988). Incubation time is 19-20 days (Lambert 1970), although clutch sizes have been associated with latitude and length of photoperiod. In Japan, clutch size is 5-8 eggs, while in Russia, clutch size is 5-9 eggs (Johnsgard 1988). The chicks are considered to be mature and able to mate after four weeks old (Hoffmann 1988).

The breeding season varies with location. In Russia, the season starts in late April and continues to early August. In Japan, nesting occurs from late in May and usually ends in August. On the rare occasion, eggs may be found in nests in September (Johnsgard 1988).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 17 days.

Average age at sexual or reproductive maturity (male)

Sex: male:
52 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
63 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coturnix japonica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAACCGATGACTATTTTCAACTAACCACAAAGACATTGGCACTCTTTATCTTATTTTTGGTACATGAGCAGGCATAGCCGGTACAGCACTTAGCTTGTTAATCCGCGCAGAACTAGGACAACCAGGCACCCTCCTAGGAGATGACCAAATTTACAATGTAATTGTCACAGCACATGCCTTCGTCATAATCTTCTTTATAGTCATACCAATTATAATTGGAGGCTTCGGAAATTGACTCGTCCCACTTATAATCGGAGCCCCAGACATAGCATTCCCACGTATGAATAACATAAGCTTCTGACTCCTCCCACCCTCCTTCCTGCTGCTACTAGCTTCTTCCACCGTTGAAGCTGGTGCCGGTACAGGATGAACTGTCTACCCGCCCCTAGCCGGCAACCTCGCCCACGCCGGAGCATCAGTAGATCTAGCCATCTTCTCCCTACATTTAGCAGGTGTATCATCAATCCTAGGAGCCATCAACTTTATCACCACTATTATCAATATAAAACCCCCTGCACTGTCACAATACCAAACACCCCTATTTGTTTGATCAGTCCTCATCACCGCTATCTTACTCCTACTCTCCCTCCCAGTCCTAGCTGCTGGCATTACTATACTTCTAACTGATCGAAACCTCAACACTACATTCTTTGACCCTGCAGGAGGAGGAGACCCCATCCTGTATCAACACTTATTTTGATTCTTTGGACACCCAGAAGTCTACATCCTCATCCTCCCAGGCTTCGGAATCATCTCCCACGTAGTAGCCTACTACGCAGGGAAAAAAGAACCATTCGGCTATATAGGAATAGTGTGAGCAATATTATCAATCGGATTCCTAGGATTCATCGTATGAGCCCACCATATATTCACAGTAGGAATAGACGTAGATACACGAGCCTACTTTACATCAGCTACAATAATCATTGCCATCCCAACCGGTATCAAAGTTTTCAGCTGACTAGCAACCCTACACGGAGGAACAATCAAATGAGATCCGCCCATACTATGAGCCCTCGGATTCATCTTCCTATTCACCATCGGAGGACTAACAGGGATCGTTCTTGCCAATTCATCACTTGACATCGCCCTCCATGACACCTATTACGTAGTCGCCCACTTCCACTACGTCCTATCCATAGGAGCAGTCTTTGCTATTTTAGCAGGATTCACCCACTGATTCCCACTATTCACAGGCTTCACCCTTCATCCTACATGAACTAAGGCACACTTTGGAGTAATGTTCACAGGAGTCAACCTAACCTTCTTCCCACAGCACTTCCTAGGCCTAGCTGGTATACCCCGACGATACTCAGACTACCCAGATGCCTACACACTTTGAAACACACTATCCTCAATCGGCTCCTTAATCTCAATAACAGCCGTAATCATACTAATGTTTATTGTATGAGAAGCCTTCTCAGCAAAACGTAAAGTTCTTCAGCCAGAATTAACTGCTACCAACATCGAATGAATCCACGGCTGCCCACCCCCATACCACACCTTCGAAGAACCTGCCTTCGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Coturnix japonica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

With its broad breeding range, this quail is considered to be relatively secure in maintaining its populations in natural habitats (Johnsgard 1988).

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Okuyama, M.

Justification
This species is listed as Near Threatened because it is suspected to be undergoing a moderately rapid population decline, potentially owing to hunting and shifts in agriculture. Research is urgently required to establish population numbers, trends, and to assess and mitigate the threats to the species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species was has been reported to be fairly common (del Hoyo et al. 1994; Fuller et al. 2000). However, owing to recent suspected declines, the species is likely to be less common than previously thought. National population estimates include: c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in China; c.100-10,000 breeding pairs, c.50-1,000 individuals on migration and
Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Specific threats to the species are unknown, although it may be threatened by agricultural change in Asia (Duckworth 2009). Hunting is a threat in Japan (Okuyama 2004), and is likely to be a threat elsewhere in its range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
There are plans to introduce a ban on the hunting of the species in Japan (M. Okuyama in litt. 2010).

Conservation Actions Proposed
Obtain an up-to-date population estimate. Develop a monitoring scheme to establish population trends. Identify and assess the impacts of known and potential threats throughout its range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects on humans by this bird.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These quail and their eggs provide food for humans (Hoffmann 1988). Japanese Quail are also frequently seen in aviaries.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Japanese quail

The Japanese quail, also known as Coturnix quail (Coturnix japonica) is a species of Old World quail found in East Asia. First considered a subspecies of the Common quail, it was distinguished as its own species in 1983.[2] The Japanese quail has played an active role in the lives of humanity since the 12th century, and continues to play major roles in industry and scientific research. Where it is found, the species is abundant across most of its range. Currently there are a few true breeding mutations of the Japanese quail, the breeds from the United States are: Texas A&M, English White, Golden Range, Red Range, Italian, Manchurian, Tibetan, Rosetta, Scarlett, Roux Dilute and Golden Tuxedo.

Distribution and habitat[edit]

Populations of the Japanese quail are known to mainly inhabit East Asia and Russia. This includes India, Korea, Japan, and China.[3][4][5] Though several resident populations of this quail have been shown to winter in Japan, most migrate south to areas such as Vietnam, Cambodia, Laos, and southern China.[6] This quail has also been found to reside in many parts of Africa, including Tanzania, Malawi, Kenya, Namibia, Madagascar, and the area of the Nile River Valley extending from Kenya to Egypt.[5]

Breeding sites of the Japanese quail are largely localized to East and Central Asia,[3][4] in such areas as Manchuria, southeastern Siberia, northern Japan, and the Korean Peninsula. However, it has also been observed to breed in some regions of Europe, as well as Turkey.[5]

The Japanese quail is primarily a ground-living species that tends to stay within areas of dense vegetation in order to take cover and evade predation.[7] Thus, its natural habitats include grassy fields, bushes along the banks of rivers, and agricultural fields that have been planted with crops such as oats, rice, and barley.[5][7] It has also been reported to prefer open habitats such as steppes, meadows, and mountain slopes near a water source.[8]

Morphology[edit]

Drawing of the head of a Japanese Quail

The morphology of the Japanese quail differs depending on its stage in life. As chicks, both male and female individuals exhibit the same kind of plumage and coloring.[2] Their heads are tawny in color, with small black patches littering the area above the beak.[2] The wings and the back of the chick are a pale brown, the back also having four brown stripes running along its length. A pale yellow-brown stripe surrounded by smaller black stripes runs down the top of the head.[2]

The plumage of the Japanese quail is sexually dimorphic, allowing for differing sexes to be distinguished from one another.[2][9] Both male and female adults exhibit predominantly brown plumage. However, markings on the throat and breast, as well as the particular shade of brown of the plumage, can vary quite a bit.[2][9] The breast feathers of females are littered with dark spots among generally pale feathers. Contrastingly, male breast feathers show off a uniform dark reddish-brown color that is devoid of any dark spots.[2] This reddish brown coloration also appears in the male cheek, while female cheek feathers are more cream colored. Some males also exhibit the formation of a white collar, whereas this does not occur in any female members of the species. It is important to note that while this coloration is very typical of wild populations of Coturnix japonica, domestication and selective breeding of this species has resulted in numerous different strains exhibiting a variety of plumage colors and patterns.[2]

Males tend to be smaller than females.[9] Wild adults weigh between 90 and 100 grams while their domesticated counterparts typically weigh between 100 and 120 grams.[2] However, weight among domesticated lines varies considerably, as commercial strains bred for meat production can weigh up to 300 grams.[2]

Diet[edit]

The diet of the Japanese quail includes many different types of grass seed such as white millet and panicum. They also feed upon a variety of insects, their larvae, and other small invertebrates.[5]

The Japanese quail mainly eats and drinks at the beginning and end of the day, this behavior shown to closely follow the photoperiod. However, they will still perform these actions throughout the day as well.[9]

Reproduction[edit]

The type of relationship exhibited between male and female members of Coturnix japonica has returned mixed reports, as they have been seen to exhibit both monogamous and polygamous relationships. Study of domesticated specimens reveals that females tend to bond with one to two males, though extra-pair copulations are also frequently observed.[10]

The Japanese quail exhibits a quite distinct and specific mating ritual. First, the male will grab the neck of the female and mount her. After mounting the female, the male will extend his cloaca by curving his back in an attempt to initiate cloacal contact between him and the female. If cloacal contact is achieved, insemination of the female will be exhibited by distinguishable foam present in the female's cloaca. After successfully mating with a female, it is characteristic of the male to perform a distinctive strut. Females can either facilitate the mating attempts of the male by remaining still and squatting in order to ease the access of the male to her cloaca. Or, she can impede the attempts of the male by standing tall and running away from the mounting male.[11] Females can also induce the initial sexual interactions by walking in front of a male and crouching.[10] Males acting aggressively toward a female during the mating ritual has been shown to reduce successful matings.[11]

Eggs tend to be laid in the few hours preceding dusk.[9] Incubation of the egg starts as soon as the last egg in the clutch is laid and lasts an average of 16.5 days.[9][12] Japanese quail females carry out most of the incubation of the eggs, becoming increasingly intolerant of the male throughout the incubation process. Eventually, the female will drive away the male before the eggs hatch.[9] Thus, the females also provide all of the parental care to the newly hatched young.[11]

Egg weight, color, shape, and size can vary greatly among different females of the Japanese quail population; however, these characteristics are quite specific and consistent for any one given female. Eggs are generally mottled with a background color ranging from white to blue to pale brown.[2] Depending on which strain of the Japanese quail one examines, eggs can weight anywhere from 8 to 13 grams, though the accepted average weight is 10 grams.[2][13] Age seems to play a role on the size of eggs produced as older females tend to lay larger eggs than their younger counterparts.[13]

Sensation and perception[edit]

Though there is still much to understood about the sensation and perception of Coturnix japonica, some has been revealed through various scientific experiments.

Taste[edit]

Normally, the Japanese quail has been considered to possess an underdeveloped sense of taste, this being evidenced by their inability to distinguish different kinds of carbohydrates presented to them. However, more recent studies have shown that a limited ability to taste is indeed present. Evidence for this includes quail individuals exhibiting preferential choice of sucrose containing solutions over simple distilled water and the avoidance of salty solutions.[9]

Smell[edit]

Though the Japanese quail possesses an olfactory epithelium, little is known about their ability to sense smell. Despite this, certain studies have revealed that these birds are able to detect certain substances using only their sense of smell. For example, they have been reported to be able to detect the presence of certain pesticides, as well as avoid food containing a toxic chemical called lectin, using only the sense of smell.[9]

Sight[edit]

Through nasolateral conversion of the eyes, the Japanese quail is able to achieve frontal overlap of the eye fields. Long distance perception occurs via binocular field accommodation. In order to maintain focus on a certain object while walking, the quail will exhibit corresponding head movements. The Japanese quail has also been shown to possess color vision, its perception of color being greater than that of form or shape.[9]

Hearing[edit]

Not much is known about Coturnix japonica hearing. However, they have been shown to be able to distinguish between various human phonetic categories.[9]

Vocalizations[edit]

Some 28 different call types have been distinguished based on the circumstances in which they are used and the various behaviors that are exhibited during the call. The call types of the Japanese quail differ in between male and female, the same stimulus resulting in differing vocalizations. Most of the calls used by this quail are present after five weeks of development; however, they remain relatively changeable until sexual maturity is reached.[9] The typical crow of the Japanese quail is characterized by two short parts that precede a final, major trill.[3]

Crowing of males has been observed to expedite the development of the female's gonads as those exposed to such crowing reach maturity much earlier that those who are not exposed to male vocalizations.[9] Differences in crow patterns have been observed between males with mates and un-mated males.[14]

In India, Krishi Vigyan Kendra Kannur under Kerala Agricultural University has produced video album containing songs and visuals on Japanese quail production under Creative Extension series.

Hygiene[edit]

This quail species is also an avid dust bather, individuals undergoing numerous bouts of dust bathing each day. When dust bathing, this bird will rake its bill and legs across the ground in order to loosen up the ground, and then use its wings to toss the dust into the air. As the dust falls back down to the ground around the bird, it will shake its body and ruffle its feathers to ensure they receive a thorough coating. This behavior is believed to function in such things as simple feather maintenance and parasite removal.[9]

Domestication[edit]

The earliest records of domesticated Japanese quail populations are from 12th century Japan; however, there is evidence that the species was actually domesticated as early as the 11th century.[2][13] These birds were originally bred as songbirds, and it is thought that they were regularly used in song contests.[2][9]

In the early 1900s, Japanese breeders began to selectively breed for increased egg production. By 1940, the industry surrounding quail eggs was flourishing. Unfortunately, the events of World War II led to the complete loss of quail lines bred for their song type, as well as almost all of those bred for egg production. After the war, the few enduring quail left were used to rebuild the industry, and all current commercial and laboratory lines today are considered to have originated from this population of quail.[2][9]

Uses[edit]

Restocking wild game[edit]

The Japanese quail is considered to be a closely related allopatric species to the Common quail, though both are still recognized as distinct species.[3] Due to their close relationship and phenotypic similarities, as well as the recent decline in wild Common quail populations throughout Europe, the Japanese quail is often crossed with the Common quail in order to create hybrids that are used to restock the declining wild quail populations.[3][4] Countries such as Greece, France, Spain, Portugal, Cornwall, Scotland, Canada, China, Brazil, Australia, and Italy all release thousands of such hybrids each year in order to supplement their dwindling wild quail populations, often releasing these birds right before the start of the hunting season.[3][4] These hybrids are practically indistinguishable from the native Common quail in these areas, though there are worries that such hybridizations could be detrimental to the native quail populations.[4]

Egg and meat production[edit]

As the Japanese quail is easily managed, fast growing, small in size, and can produce eggs at a high rate, the Japanese quail has been farmed in large quantities across the globe.[2][9] Countries such as Japan, India, China, Italy, Russia, and the United States all have established commercial Japanese quail farming industries.[2] This animal provides developing countries with a stable source of animal proteins and developed countries with a suitable alternative to chicken. However, this animal finds its true economic and commercial value in its egg production, as domesticated lines of the Japanese quail can lay up to 300 eggs a year at an incredibly efficient feed to egg conversion ratio.[2]

Research[edit]

The interest in the Japanese quail as a research animal was greatly increased after 1957 due to groups at the University of California and Auburn University who proposed its value in biomedical research. It is now widely used for research purposes in state, federal, university, and private laboratories. Fields in which Coturnix japonica is widely utilized include: genetics, nutrition, physiology, pathology, embryology, cancer, behavior, and the toxicity of pesticides.[12][13]

Japanese quail eggs have orbited the Earth in several Soviet and Russian spacecraft, including the Bion 5 satellite and the Salyut 6 and Mir space stations.[15] In March 1990, eggs on Mir were successfully incubated and hatched.[16]

See also[edit]

References[edit]

  1. ^ BirdLife International (2012). "Coturnix japonica". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g h i j k l m n o p q r Hubrecht R, Kirkwood J (2010). The UFAW Handbook on the Care and Management of Laboratory and Other Research Animals. John Wiley & Sons. pp. 655–674. 
  3. ^ a b c d e f Barilani, M; Deregnaucourt S, Gellego S, Galli L, Mucci N, Piomobo R, Puigcerver M, Rimondi S, Rodriguez-Teijeiro JD, Spano S, Randi E (2005). "Detecting hybridization in wild (Coturnix c. coturnix) and domesticated (Coturnix c. japonica) quail populations". Biological Conservation 126: 445–455. doi:10.1016/j.biocon.2005.06.027. 
  4. ^ a b c d e Puigcerver, Manel; Vinyoles, Dolors; Rodríguez-Teijeiro, José Domingo (2007). "Does restocking with Japanese quail or hybrids affect native populations of common quail Coturnix coturnix?". Biological Conservation 136 (4): 628–635. doi:10.1016/j.biocon.2007.01.007. 
  5. ^ a b c d e Pappas, J. "Coturnix japonica". Animal Diversity Web. Retrieved 20 October 2013. 
  6. ^ "Species Factsheet: Coturnix japonica". Birdlife International. Retrieved 20 October 2013. 
  7. ^ a b Buchwalder, T; Wechsler B (1997). "The effect of cover on the behavior of Japanese quail (Coturnix japonica)". Applied Animal Behaviour Science 54: 335–343. doi:10.1016/s0168-1591(97)00031-2. 
  8. ^ "Coturnix japonica". The IUCN Red List of Threatened Species. Retrieved 18 November 2013. 
  9. ^ a b c d e f g h i j k l m n o p q Mills, AD; Crawford LL; Domjan M; Faure JM (1997). "The Behavior of the Japanese or Domestic Quail Coturnix japonica". Neuroscience and Biobehavioral Reviews 21 (3): 261–281. doi:10.1016/S0149-7634(96)00028-0. 
  10. ^ a b Galef, BG; White DJ (March 1998). "Mate-choice copying in Japanese quail Coturnix coturnix japonica". Animal Behaviour 55 (3): 545–552. doi:10.1006/anbe.1997.0616. 
  11. ^ a b c Correa, SM; Haran CM; Johnson PA; Adkins-Regan E (2011). "Copulatory behaviors and body condition predict post-mating female hormone concentrations, fertilization success, and primary sex rations in Japanese quail". Hormones and Behavior 20: 556–564. 
  12. ^ a b Ainsworth, SJ; Stanley RL; Evan DJR (2010). "Developmental stages of the Japanese quail". Journal of Anatomy 216: 3–15. doi:10.1111/j.1469-7580.2009.01173.x. 
  13. ^ a b c d Coturnix (Coturnix coturnix japonica): standards and guidelines for the breeding, care, and management of laboratory animals. Washington, D.C.: National Academy of Sciences. 1969. pp. 1–47. 
  14. ^ Chang, GB; Liu XP; Chang H; Chen GH; Zhao WM; Ji DJ; Chen R; Qin YR; Shi XK; Hu GS (June 2009). "Behavioral differentiation between wild Japanese quail, domestic quail, and their first filial generation". Poultry Science 88 (6): 1137–1142. doi:10.3382/ps.2008-00320. 
  15. ^ Muneo Takaoki, “Model Animals for Space Experiments — Species Flown in the Past and Candidate Animals for the Future Experiments”, Biological Sciences in Space, Vol. 21, pp. 76-83 (2007).
  16. ^ T.S. Guryeva et al., "The quail embryonic development under the conditions of weightlessness", Acta Vet. Brno, Suppl. 6, 62, 1993: S 25-S 30.

Additional references[edit]

  • Lee, Woo-Shin; Tae-Hoe Koo, Jin-Young Park; translated by Desmond Allen (2000). A field guide to the birds of Korea. Seoul: LG Evergreen Foundation. ISBN 89-951415-0-6. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Sometimes has been regarded as conspecific with C. COTURNIX, but apparently JAPONICA and COTURNIX are sympatric in Mongolia (Sibley and Monroe 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!