Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

Geographic Range

Painted quail and their subspecies are found in India, Sri Lanka, southeast China, Taiwan, Hainan Island, southeast Asia (including Thailand, Myanmar, and Viet Nam), the Phillipines, Nicobar Islands, Sumatra (Butler, 1897; Delacour, 1947; Harper, 1986; Hayes, 1992), Borneo and Sarawak (Smythies, 1981), Java, the Celebes, Lombok, Sumba, Flores, Timor Islands, New Guinea, north to southeastern Australia (Butler, 1897; Delacour, 1947; Harper, 1986; Hayes, 1992), and as far east as Madagascar. They have been introduced into Mauritius and Reunion (Rutgers and Norris, 1970) as well as Guam (Mayr, 1945).

Biogeographic Regions: palearctic (Native ); oriental (Introduced , Native ); ethiopian (Introduced , Native ); australian (Native )

  • Rutgers, A., K. Norris. 1970. Encyclopedia of Aviculture, Vol. 1. London: Blandford Press.
  • Butler, A. 1897. The Chinese Quail (Excalfactoria chinensis). Avicultural Magazine, 4(37): 1-3.
  • Delacour, J. 1947. Birds of Malasia. New York: The Macmillan Co.
  • Harper, D. 1986. Pet Birds for Home and Garden. London: Salamander Books Ltd.
  • Hayes, L. 1992. The Chinese Painted Quail (The Button Quail): Their Breeding and Care. Valley Center, CA: Hayes.
  • Mayr, E. 1945. Birds of the Southwest Pacific. New York: The Macmillan Company.
  • Smythies, B. 1981. The Birds of Borneo. Kuala Lumpur: The Malayan Nature Society.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Physical Description

Morphology

Physical Description

These quail are 12.5 cm (Harper, 1986) to 14 cm long (Alderton, 1992) and they weigh 28 to 40 g. The female is larger than the male (Harper, 1986). Wing length is 65 to 78 mm for males and 66 to 67 mm for females. For males, tail length is approximately 25 mm (Johnsgard, 1988). Tail length for females is slightly longer (Pappas, pers. obs.).

The natural color of the male is dark brown with a slate blue-gray breast, dark rust-colored to chestnut-red belly, black throat patch surrounded by a white band and bordered by a black stripe, and black eye stripe (Finn, 1911; Harrison, 1973b). There may be lighter shades of brown evident throughout or within the wing feathers in a mottled pattern. The female does not retain the blue-gray breast, dark rust to chestnut-red belly, or the black markings of the male. She has an overall brown color with rust-brown abdomen and breast. Both males and females have black beaks, yellow to orange-colored legs and feet, and a short, dark brown tail (Finn, 1911; Hachisuka, 1931; Delacour and Mayr, 1946; Harrison, 1965; Dewar, 1979).

In captivity, many color variations have been bred. The most widely known is the silver phase. Other colors include, white (non-albino), varying brown tones, and mottled silver-gray (Hayes, 1992).

Range mass: 28 to 40 g.

Range length: 12.5 to 14 cm.

Sexual Dimorphism: female larger; sexes colored or patterned differently

  • Alderton, D. 1992. The Atlas of Quails. Neptune City, NJ: T.F.H. Publications.
  • Dewar, D. 1979. Common Birds of India. New Delhi: N. B. D. Publishers.
  • Hachisuka, M. 1931. The Birds of the Philippine Islands. London: H.F. & G. Witherby.
  • Harrison, C. 1965. Plumage pattern and behaviour in the Painted Quail. Avicultural Magazine, 71(6): 176-184.
  • Harrison, C. 1973b. Further notes on the behaviour of Painted Quail (Excalfactoria chinensis). Avicultural Magazine, 79(4): 136-139.
  • Johnsgard, P. 1988. The Quail, Partridges, and Francolins of the World. Oxford: Oxford University Press.
  • Pappas, J. 1996. Some observations on the behaviour and care of the Chinese Painted Quail. Avicultural Magazine, 102(3): 103-105.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Painted quail are found in moist regions such as those in wetlands of rank grass (Finn, 1911; Delacour and Mayr, 1946) and rice paddy fields in Lower Myanmar and the Bengal region of India (Finn, 1911) and Borneo (Smythies, 1981). In addition, they have been found up to 1220 m in the highlands of Borneo (Smythies, 1981). They nest on the ground in grasslands that may be bordered by marshes or other wetlands (Finn, 1911).

Range elevation: 1200 (high) m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland

Wetlands: marsh

  • Delacour, J., E. Mayr. 1946. Birds of the Philippines. New York: The Macmillan Co.
  • Finn, F. 1911. Game Birds of India and Asia. Calcutta: Thacker, Spink & Co.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Painted quail mostly eat a variety of grass seeds, including red, white and yellow millet, maw, niger, and rape seeds. They will also eat fresh greens and other vegetation. In limited amounts, they will also consume small worms and insects, including termites, (Yealland, 1962; Smythies, 1981; Harper, 1986). When living in captivity, females require additional calcium in the form of ground up oyster shell or cuttlefish mantle (Pappas, 1996).

Animal Foods: insects; terrestrial worms

Plant Foods: leaves; seeds, grains, and nuts; fruit

Primary Diet: omnivore

  • Yealland, J. 1962. The Painted Quail. Avicultural Magazine, 68(1): 24-26.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Painted quail have an impact on the vegetation and prey they eay.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

We do not have information on predation for this species at this time.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Coturnix chinensis preys on:
Annelida
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

These quail communicate with many calls between the sexes. One of the most interesting is the tidbitting call whereby the male picks up, for example, a small worm, then offers it to the female, and simultaneously utters short, monotone "peeps." The female will graciously take this tidbit from his beak to eat (Harrison, 1965). On rare occasions, females will perform this tidbitting call for the male (Pappas, 1996).

The mating call occurs when the male displays to the female. He will puff his chest, lower his wings, and dart about in front of a female he wishes to court. His chestnut-red breast feathers are visible (Harrision, 1965). He may make low, soft, clucking sounds (Pappas, pers. obs.).

Both males and females produce loud single-note crowing calls when not in view of each other. They both utter a three-note or four-note crow. The quail will stand upright, beak stretching upward, with a descending-tone sounding like "quee-kee-kee" (Harrison, 1965), "pip-it-kan" or "pip, pit-it-kan" with the last note short in duration and descending in pitch (Smythies, 1981). Only males will produce low, bellowing calls as a prelude to a full-fledged three-note or four-note crow. The quail will crouch, fluff his feathers, lift his wings slightly, and utter a low, hoarse "koraah" while his neck and throat are distended (Harrison, 1965). This call occurs when the female is incubating eggs and the male is frequenting sites at the extent of his territory (Pappas, pers. obs.). The hen and chicks utter faint peeping sounds to each other to keep in contact at all times.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

We do not have information on the lifespan of this species at this time.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

We do not have information on the mating system of this species at this time.

The rainy season dictates the breeding season with respect to geographic location for these quail and their subspecies (Johnsgard, 1988).

They nest on the ground in hollows that are lined with grass. Females are prolific egg-layers. Usually, they lay between 6 and 14 (to as many as 21) eggs per clutch. The eggs are approximately 24.5 mm by 19 mm (Harrison, 1973a; Johnsgard, 1988) and weigh around 5 g (Johnsgard, 1988). They are olive green to brown in color with dark brown spots/blotches all over. They are rather large considering the size of the female. Females have a hard time trying to keep the eggs warm. Males do not aid in brooding or rearing the chicks (Harrison, 1973a). Incubation period is from 16 (Alderton, 1992) to 19 days (Robbins, 1973).

Newly hatched chicks are the size of bumble bees, and they are usually brown in color. In captivity, adults of other color phases, such as white, produce yellow-colored chicks. These quail are precocial in nature. After one month, young are mature and will begin mating and laying. At only a couple of weeks old, the chicks begin to crow.

Breeding season: Breeding season is dictated by the rainy season.

Range eggs per season: 6 to 21.

Average eggs per season: 6 to 14.

Range time to hatching: 16 to 19 days.

Average age at sexual or reproductive maturity (female): 1 months.

Average age at sexual or reproductive maturity (male): 1 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal )

Males do not aid in brooding or rearing the precocial chicks (Harrison, 1973a). The incubation period is from 16 (Alderton, 1992) to 19 days (Robbins, 1973).

Painted quail engage in egg-rolling. They use their beaks to roll eggs while walking backward. They collect eggs for the nest that have been laid in other places, or move eggs to a safe place if the nest-site becomes unsuitable (Harrison et al., 1965).

Parental Investment: no parental involvement; precocial ; pre-fertilization; pre-hatching/birth (Protecting); pre-weaning/fledging (Provisioning: Female)

  • Alderton, D. 1992. The Atlas of Quails. Neptune City, NJ: T.F.H. Publications.
  • Harrison, C., R. Restall, J. Trollope. 1965. The egg-rolling behaviour of the Painted Quail. Avicultural Magazine, 71(4): 127-130.
  • Harrison, C. 1973a. Plumage pattern in the buff varieties of the House Sparrow and the Painted Quail. Avicultural Magazine, 79(3): 73-74.
  • Johnsgard, P. 1988. The Quail, Partridges, and Francolins of the World. Oxford: Oxford University Press.
  • Robbins, G. 1979. Quail in captivity. Avicultural Magazine, 85(4): 216-223.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coturnix chinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTCTCAACTAACCACAAAGACATTGGCACTCTTTACTTAATTTTCGGCACATGAGCAGGCATAGCCGGCACAGCCCTCAGCCTATTAATCCGTGCAGAACTAGGTCAGCCAGGTACCCTCCTTGGAGAT---GACCAGATTTACAACGTAATTGTCACAGCCCATGCCTTCGTTATAATCTTCTTCATAGTCATACCCATCATAATCGGAGGCTTCGGAAATTGACTCGTCCCACTTATAATCGGGGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTCCTCCCACCCTCGTTCCTTCTTCTACTAGCATCTTCCACTGTAGAAGCTGGCGCCGGCACAGGGTGAACTGTCTACCCCCCTTTAGCTGGTAACCTAGCCCATGCCGGAGCATCAGTAGATCTAGCCATCTTTTCCCTTCACTTGGCAGGTGTCTCATCAATCCTAGGAGCTATCAACTTTATCACCACCATTATCAACATAAAACCCCCCGCACTATCACAATATCAAACTCCCCTATTCGTATGATCAGTCCTCATTACTGCCATTCTATTATTACTCTCCCTCCCCGTCCTAGCCGCCGGCATTACAATACTGCTCACCGACCGAAATCTTAACACCACATTCTTCGACCCTGCAGGAGGAGGAGACCCTGTCCTATACCAACACCTGTTCTGATTCTTCGGTCACCCAGAAGTCTACATCCTCATCCTCCCAGGCTTCGGAATTATCTCCCACGTAGTAGCCTACTACGCAGGAAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCAATACTATCAATTGGGTTCCTAGGGTTTATTGTATGAGCCCATCACATATTCACAGTAGGCATGGACGTAGATACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Coturnix chinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species of quail is not listed by either CITES or the IUCN.

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the two formally split races have been described as uncommon to local (del Hoyo et al. 2009).


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of painted quail on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

In aviculture, these quail are available for study as well as companionship to the many bird enthusiasts around the world. Documentation on these quail in their natural habitat is scarce, since few people have seen them in the wild. Studies on captive-bred birds have provided information on their food habits, behavior, reproduction, and other aspects of their life history (Hayes, 1992).

These quail provide food for many peoples, including those from the Far East.

Positive Impacts: food ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

King quail

Samsonvale, SE Queensland
Captive king quail

The king quail (Coturnix chinensis), also known as the button quail, Chinese painted quail, chun-chi, Asian blue quail or blue-breasted quail, is in the same family as the pheasants Phasianidae of the order Galliformes, gallinaceous birds. These birds all have a distinctly larger breast-bone than other birds with more muscle surrounding the area. This is why they are hunted for their meat.

This species is the smallest "true quail" and is quite common in aviculture worldwide. In the wild they range from southeastern Asia to Oceania with 10 different subspecies.

A failed attempt was made to introduce this species to New Zealand by the Otago Acclimatisation Society in the late 1890s.

Description[edit]

The male king quail comes in many colors, including blue, brown, silver, maroon, dark brown & almost black. They have orange feet which are hard and able to withstand a continuous life on the ground like many other game birds.The female is similar to the male but cannot come in shades of blue. They can live up to 13 years in captivity but in the wild only 3-6. The eggs of king quail are a light, creamy-brown colour and slightly pointed at the 'top'; roughly ovular in shape.

Taxonomy[edit]

There are nine recognized subspecies:

Reproduction[edit]

Clutch size varies anywhere from 5 to 13 eggs. Before incubation starts all the eggs composing the clutch will be laid. In captivity, if the female lays too many eggs, they should be taken, as after about 10 days they go cold and die. In captivity, the ideal number of eggs in a clutch is 6 to 8. The baby quails hatch after about 19 days and look a lot like chicken chicks but smaller.

Conservation status[edit]

Australia[edit]

King quail are not listed as threatened on the Australian Environment Protection and Biodiversity Conservation Act 1999.

State of Victoria, Australia[edit]

This species is listed as threatened on the Victorian Flora and Fauna Guarantee Act (1988).[2] Under this Act, an Action Statement for the recovery and future management of this species has not been prepared.[3]

On the 2007 advisory list of threatened vertebrate fauna in Victoria, this species is listed as endangered.[4]

Aviculture[edit]

This quail has been very popular to keep and breed for many, many years; numerous mutations have been developed. They are quite hardy once they have adjusted to their surroundings and will keep the bottom of an aviary spotless. Yet these small quails are more than just effective scavengers. They provide colour, & charm to a part of the aviary that otherwise may not be used, & their breeding behavior is fascinating, especially the development of their chicks. A great advantage of these quails is that they will live exclusively on the ground, & will not interfere with other birds.[5] The cost of purchasing and maintaining them is very little. These quails take only a small amount of time to feed and water and, in some cases, they have been known to become hand-tame.

Housing[edit]

Best housed in pairs, trios, or quatour in a planted aviary, but can be kept singly in bird cages, or indeed in colonies in large flights. Some fighting among males will happen. It will be important to watch for over-bullying in the female pecking order, as well as being cautious that other dynamics in social groups exist, & these may result in injury. Suspension cages do not work well for this species of quail as they do for the slightly larger species such as bobwhite quail, California quail, or Japanese quail because of their smaller sized feet; a much finer size floor wire would need to be employed. King quail also are not generally required to be farmed in such a manner as the aforementioned quail species; as they are not bred for consumption or for game release.[6]

Diet[edit]

Poultry Layers Mash should be a staple part of the diet of captive quails. It is high in the right kinds of protein, vitamins, & minerals which they generally do not receive from grains alone. It also contains grits which are necessary for the birds to grind down food in their gizzard. A complement of grains in the form of a finch seed mix is ideal. King quail happily consume seed up to the size of hulled wheat or oats. Green food in the form of silver beet, spinach, dandelion flowers, chickweed & et cetera should be offered frequently. Fresh water must be supplied at all times. Although livefood is taken, it is not overly important for breeding birds. They will catch their own insects in a planted aviary.

Breeding[edit]

They are hyperactive breeders: a female will lay an egg a day if kept on the proper diet. She will make a soft "crowing" noise to attract a mate. Nesting sites can be as spartan as a quiet corner or a depression in the ground against a wall. Preferably, a clump of grass. tea tree branches, or pile of loose herbage should be provided. Often a hen will lay eggs on the aviary floor without the use of a nest. This is a sign that the birds are not content with the existing facilities and the provision of a sheltered nest site may result in a nest being built. The cock usually selects the nest site.[7]

The nest is a simple scrape in the ground, lined with grasses and is built by the hen with some assistance for the cock. The eggs measuring 25 x 19mm are variable in colour form the palest of browns to dark olive and peppered with fine black spots. Clutch size varies from 4-13, but occasionally a hen will be found incubating upwards of 20 eggs. It is usually a combined clutch from a number of hens and due to the difficulties of turning and covering a clutch of that size, hatchabliity is often poor. It may be better to remove some of the eggs and artificially incubate them or foster them.[7]

They usually breed year round; incubation times are from 18–23 days before chicks hatch. The hen bird will care for the chicks until around 4 weeks of age where they should be separated from parent birds into a separate aviary. It is recommended that you have at least 20² cm per bird.

Chicks are often referred to as "Bumblebees" because of their size, & fuzziness. Raising chicks by hand requires patience. They are easily drowned, so a water container as small as possible needs to be offered: You will need to remember that it will dry out very quickly. A beer cap (or several) is a good water reciprocal for the first week or two. Chick starter crumbs (medicated) will need to be ground down to an almost dust consistency using a mortar and pestle. A rough substrate or medium has to be used to prevent spraddle leg (also known as Splayed Leg). Paper towels are usually too smooth, a tea towel or some type of chip is best employed in the brooder. A heat source in the form of a low watt, older type household light bulb is great, but they do burn out frequently To avoid this, your brooder should have two bulbs going at any one time. The bulb should be able to be raised or lowered depending on ambient temperature: The chicks need to be kept warm but not cook.

Hybrids and mutations[edit]

Hybrids of king quail x brown quail are known.

Silvers & cinnamon are the most common colour varieties. Pied, albino, charcoals, Dilutes are becoming more common. Mutations can be combined.

Occasional cock-feathered hens appear: This is not a mutation as such, but one of a few conditions which has affected normal hormonal balances. It is most often seen when a hen has an ovarian cyst, or growth. They usually stop laying eggs, but can live for a number of years happily just looking like a male. In one case silver hen was kept for many years by herself, moulted into cock plumage, & laid only extremely pale green shelled eggs for a few seasons before passing old age.[6]

Diet[edit]

In aviculture, all birds should be fed a variety of seeds as well as a healthy range of fruit and vegetables. During breeding, hens should be fed calcium-rich food sources such as shell grit to prevent egg-bounding. Newly hatched chicks should be fed high protein chick crumb mixed in with a little water. Other sources of protein include mealworms and various bugs.

In the wild, the diet of king quails consists of small bugs, seed and various grasses that are available at the time.

References[edit]

  1. ^ BirdLife International (2013). "Coturnix chinensis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Department of Sustainability and Environment, Victoria
  3. ^ Department of Sustainability and Environment, Victoria
  4. ^ Victorian Department of Sustainability and Environment (2007). Advisory List of Threatened Vertebrate Fauna in Victoria - 2007. East Melbourne, Victoria: Department of Sustainability and Environment. p. 15. ISBN 978-1-74208-039-0. 
  5. ^ Don Harper, Pet Birds for the Home & Garden; Salamander Press
  6. ^ a b JJ Holland, Observations of Quail, 2013
  7. ^ a b A Guide to Pigeons, Doves & Quail, 1995. Danny Brown B.Sc. (Hons)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!