Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Distribution

Geographic Range

Laughing falcons are found in the neotropical region. They are most common in Central America and tropical South America.

Biogeographic Regions: neotropical (Native )

  • Ferguson-Lees, J., D. Christie. 2001. Raptors of the World. London: Christopher Helm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Herpetotheres cachinnans typically has a large creamy yellow or whitish head with black coloring around its large owl-sized eyes creating what looks like a mask. It has a thick yellow bill. Its wings are short and only reach to the base of its tail. The cream colored tail is striped with black. Adults weigh between 400 and 800 g, are 40 to 47 cm in length and have wingspans of 25 to 31 cm. There is little size difference between the sexes, however, the female has a slightly longer tail and is slightly heavier.

Range mass: 400 to 800 g.

Average length: 40-47 cm.

Range wingspan: 25 to 31 cm.

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Laughing falcon habitat includes open parts of tall forests as well as deforested country with scattered trees. Laughing falcons can also be found around forest clearings and edges. They can be found from sea level to elevations of 2500 m.

Range elevation: sea level to 2500 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

Other Habitat Features: agricultural

  • Brown, L., D. Amadon. 1968. Eagles, Hawks, and Falcons of the World. New York, NY: McGraw-Hill Book Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The primary diet of laughing falcons consists of small snakes. The birds hunt from an open perch and then pounce on the snake. It is possible hear a thud as the bird kills its prey. Laughing falcons grip the snake behind the head, sometimes breaking it off. They have been known to occasionally eat lizards, bats, rodents and fish.

Animal Foods: mammals; reptiles; fish

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Because of their feeding habits, laughing falcons have an impact on the populations of the prey they eat.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

We do not have information on predation for this species at this time.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Herpetotheres cachinnans preys on:
Actinopterygii
Reptilia
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Laughing falcons communicate with a "laughing" call. They call in duets with the opposite sex for several minutes producing loud sounds that resemble laughter.

Communication Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There was no information available regarding the lifespan of laughing falcons in the wild. The longest recorded lifespan in captivty is 14 years.

Range lifespan

Status: captivity:
14 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

There is little information about mating systems for laughing falcons. Most falcons (family Falconidae) are monogamous and they usually nest as solitary pairs. Laughing falcons use vocal performances to attract mates. Often pairs will sing in duets for minutes at a time near dusk and dawn.

The breeding season for laughing falcons varies with latitude. They usually lay one to two eggs per clutch. No information was available about the time to hatching for laughing falcons, however, for falcons in general hatching occurs after 45 to 50 days and the chicks fledge in about 57 days.

Breeding season: Varies with latitude

Range eggs per season: 2 (high) .

Average eggs per season: 1.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

The parents share the incubation duties, although toward the time of hatching the female is reluctant to move from the nest. After the egg has hatched (45 to 50 days) the male assumes the role of hunter and the female tends to the young. It is extremely rare for a male laughing falcon to feed the young. No information was available regarding when parents stop feeding the young. However, in general, birds of prey decrease feeding slowly over time until the young are forced to fly from the nest and find food.

Parental Investment: no parental involvement; altricial ; pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

  • Brown, L., D. Amadon. 1968. Eagles, Hawks, and Falcons of the World. New York, NY: McGraw-Hill Book Company.
  • Ferguson-Lees, J., D. Christie. 2001. Raptors of the World. London: Christopher Helm.
  • del Hoyo, J., A. Elliott, J. Sargatal. 1994. Handbook of Birds of the World. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Herpetotheres cachinnans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACCTAATCTTCGGGGCATGAGCTGGCATAGTTGGTACTGCCCTCAGCTTACTCATCCGCGCAGAGCTCGGACAACCCGGAACCCTCCTGGGAGACGACCAAATCTACAACGTCATCGTCACCGCCCACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATCATAATCGGCGGCTTTGGAAACTGACTAGTCCCACTCATAATTGGCGCCCCCGACATAGCATTTCCCCGTATAAACAATATAAGCTTCTGACTCCTCCCCCCATCATTCCTCCTTCTACTAGCTTCCTCTACAGTAGAAGCAGGAGCTGGCACTGGGTGAACCGTATATCCTCCCCTAGCTGGCAACCTAGCCCATGCAGGCGCCTCAGTAGACCTGGCCATCTTCTCCCTACATCTAGCAGGTGTATCCTCCATCCTCGGAGCAATCAACTTCATTACAACTGCCATCAACATAAAACCACCAACCCTCTCACAATACCAAACCCCTCTCTTCGTATGGTCCGTCCTCATTACCGCTGTCCTATTACTACTTTCACTCCCCGTCCTCGCTGCCGGCATTACCATGCTACTAACCGACCGAAACCTAAATACCACATTCTTCGACCCCGCCGGAGGAGGAGATCCCGTCCTATATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Herpetotheres cachinnans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Laughing falcons are listed as Appendix II by CITES.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 500,000-4,999,999 individuals (A. Panjabi in litt. 2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The negative impact that laughing falcons have on humans has been greatly exaggerated. Many farmers dislike birds of prey in general because they claim that the birds kill their livestock. For this reason they have been persecuted for years, sometimes to the point of extinction.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There is a rare practice called falconry in which a bird is trained to seek and kill prey for humans. Although there is no information stating that this particular species of falcon is used in falconry, it is a possibility that they were used in the past.

Positive Impacts: pet trade

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Laughing Falcon

The Laughing Falcon (Herpetotheres cachinnans), also called the Snake Hawk (erroneously, since it is not a hawk), is a medium-sized bird of prey in the falcon family (Falconidae), the only member of the genus Herpetotheres. This Neotropical species is a specialist snake-eater. Its common and scientific names both refer to its distinctive voice.

Taxonomy[edit]

Its English name comes from its loud voice, as does the specific name cachinnans, Latin for "laughing aloud" or "laughing immoderately".[2] The generic name Herpetotheres refers to its preferred food; it is Latinized Ancient Greek, derived from [h]erpeton (ἑρπετόν, "reptile") + therizein (θερίζειν, "to mow down").[3]

Its relationships with other members of the Falconidae are unclear. Traditionally it has been placed in the subfamily Polyborinae with the caracaras and forest falcons, but the American Ornithologists' Union's North American Check-list Committee now places it in the same subfamily as the true falcons, while the South American Check-list Committee places it with the forest falcons but not the caracaras,[4] and it has also been considered a subfamily of its own.[5]

Description[edit]

The Laughing Falcon is 46 to 56 cm (18 to 22 in) long[6] and has a wingspan of 79 to 94 cm (31 to 37 in).[7] As usual among birds of prey, the females are bigger, weighing 600 to 800 g (1.3 to 1.8 lb) compared to the males' 410 to 680 g (0.90 to 1.5 lb).[6]

Adults have a pale buff head, changeable between a more brownish and an almost white hue according to feather wear and individual variation. The broad black face mask stretches across the neck as a narrow collar, bordered with white. On the crown, the feather shafts are dark, producing a somewhat streaked effect. The upper wings and back are blackish brown. The uppertail coverts are whitish buff again, and the rectrices are barred black and whitish, ending in white. The underside is uniformly pale buff; there may be a bit of dark speckling on the thighs, however. The underside of the wing is pale rufous-buff, sometimes with some dark spotting on the underwing coverts. The tips of the primary remiges are barred with pale grey below, their bases are quite rufous. The iris is dark brown, the bill is black with a pale yellow cere; the feet are also pale yellow.[5]

Immature birds differ little from adults; they have lighter margins to the back feathers, producing a scalloped effect. The light parts of the plumage are almost white, paler than in adults; the unfeathered parts are also paler. Nestlings are covered in peculiarly dense down, reminiscent of a duckling's; they are generally brownish buff, darker above, and already show the blackish facial marks of the adults.[5]

With its big white (immature) or pale buff (adult) head having a dark brown mask from the eyes around to the nape, it is unmistakable.[5] In flight it shows a rufous patch near each wingtip (formed by the basal parts of the primaries) and a shape more like an Accipiter hawk than most of its falcon relatives, with short, rounded wings and a long tail.

Voice[edit]

The namesake call is a long series of separate, rather human-like cries, each one often rising sharply in pitch in the middle and sometimes falling sharply at the very end, changing from a "joyful" to a "sad" sound, and rendered as ha-ha-ha har-her-her or haww harr herrer. The series may be introduced by faster hahahahahaha calls suggestive of maniacal laughter, particularly when the bird is startled. Sometimes two birds call together at different pitches and tempos, producing a striking off-beat effect.[5]

The Laughing Falcon has another call, typically given at dusk. This two-note call is preceded by a series of gwa notes given every half-second or so. They become more emphatic and after some time change to a sequence of the gwa co call proper, with the first syllable higher in pitch than the second, but not differing in emphasis or volume. The gwa co call may be repeated 50 times or more. Sometimes, the initial calls are a oo oo-oo cow-cow-cow, sometimes a descending gwaaaaaaa..... On occasion, the two-syllable call is not given, and instead the simple gwa is repeated as often as the full call.[5]

The familiarity of these sounds in the American tropics is attested to by such common names as acauã (Portuguese), halcón macagua, guaco, halcón guaco, and guaicurú (Spanish), and guaycurú (Guaraní).

Distribution and habitat[edit]

It is found from both coastal slopes of Mexico through Central and South America south to Amazonian Peru and Bolivia, practically all of Brazil, and northern Argentina and Paraguay,[5] at altitudes up to 1,500 m (4,900 feet) (rarely to 2,400 m (7,900 feet) in Colombia), though it is often absent from mountainous regions.[8] It occupies varied habitats, usually including at least scattered trees; it prefers humid regions to arid ones and tends to avoid closed forest.[5] It is generally not migratory, though in some areas it may make seasonal movements.

Perched in a tree, looking for prey

Behaviour[edit]

The flight is slow, with quick, shallow wingbeats interspersed with glides; the bird rarely if ever soars.[9] When it lands, it will jerk the tail forcefully just like a wagtail. A Laughing Falcon frequently and often conspicuously stays on a perch for hours, sitting upright and observing the ground alertly, sometimes flicking its tail or nodding, or moving around a bit on its perch with slow, cautious little steps. It is generally peaceful and unlike other falcons will not harm smaller birds.[5]

Feeding[edit]

It catches mainly snakes, including venomous ones such as coral snakes, and also lizards, and, to a lesser extent, small rodents, bats[6] and centipedes. The Laughing Falcon pounces on its prey from flight, often with an audible thud, and then biting it just behind the head, sometimes removing the head in the process. It carries the food to a perch to eat. It may carry small snakes in its bill and swallow them tail-first; big snakes may be carried head-forward in its claws, as an Osprey carries a fish, and then torn to pieces.[5]

Breeding[edit]

The Laughing Falcon breeds in rock crevices, tree cavities, or occasionally in abandoned nests of a Buteo hawk or caracara; in general however it does not even gather nesting material in significant quantities. It lays one or two eggs according to some sources, but according to others[10] always just one. The eggs have heavy dark brown markings on a brown or whitish or pale buff background. The young are thought to leave the nest eight weeks after hatching.The breeding season has been given as April and May, though it may well vary across the large range of this species.[11]

Footnotes[edit]

  1. ^ BirdLife International (2012). "Herpetotheres cachinnans". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Lewis & Short (1879)
  3. ^ Woodhouse (1910)
  4. ^ Remsen et al. (2008)
  5. ^ a b c d e f g h i j Channing & HCT (1996)
  6. ^ a b c Jiménez & Jiménez (2003)
  7. ^ Howell & Webb (1995)
  8. ^ Cuervo et al. (2007)
  9. ^ Howell & Webb (1995), Channing & HCT (1996)
  10. ^ E.g. Stiles & Skutch (1989)
  11. ^ Howell & Webb (1995), Channing & HCT (1996), Jiménez & Jiménez (2003)

References[edit]

  • Channing, Keith & Hawk Conservancy Trust (HCT) (1996).
  • Cuervo, Andrés M.; Hernández-Jaramillo, Alejandro; Cortés-Herrera, José Oswaldo & Laverde, Oscar (2007): Nuevos registros de aves en la parte alta de la Serranía de las Quinchas, Magdalena medio, Colombia [New bird records from the highlands of Serranía de las Quinchas, middle Magdalena valley, Colombia]. Ornitología Colombiana 5: 94-98 [Spanish with English abstract]. PDF fulltext
  • Howell, Steven N.G. & Webb, Sophie (1995): A Guide to the Birds of Mexico and Northern Central America. Oxford University Press, Oxford & New York. ISBN 0-19-854012-4
  • Jiménez, Mariano II & Jiménez, Mariano G. (2003): El Zoológico Electrónico – El Halcón Guaicurú Herpetotheres cachinnans. Version of 2003-AUG-01. Retrieved 2007-FEB-22.
  • Lewis, Charlton T. & Short, Charles (1879): căchinno. In: A Latin Dictionary. Clarendon Press, Oxford. ISBN 0-19-864201-6 HTML fulltext
  • Stiles, F. Gary & Skutch, Alexander Frank (1989): A guide to the birds of Costa Rica. Comistock, Ithaca. ISBN 0-8014-9600-4
  • Remsen, J. V., Jr.; Cadena, C. D.; Jaramillo, A.; Nores, M.; Pacheco, J. F.; Robbins, M. B.; Schulenberg, T. S.; Stiles, F. G.; Stotz, D. F.; and Zimmer, K. J. Version (2008-12-22). A classification of the bird species of South America. American Ornithologists' Union. HTML fulltext
  • Woodhouse, S.C. (1910): English-Greek Dictionary – A Vocabulary of the Attic Language. George Routledge & Sons Ltd., Broadway House, Ludgate Hill, E.C. Searchable JPEG fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!