Articles on this page are available in 1 other language: Spanish (7) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Milvago chimachima

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCCTTATCAACCGATGACTATTCTCAACAAACCACAAAGACATTGGCACTCTATACCTTCTCTTCGGAGCATGAGCCGGCATAGTTGGCACCGCCCTTAGCCTACTCATTCGCGCAGAACTAGGCCAACCAGGAACCCTCCTAGGGGATGACCAAATTTACAACGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGCTTTGGAAACTGACTAGTCCCACTCATAATCGGCGCCCCAGACATAGCATTTCCCCGAATAAACAACATAAGCTTCTGACTCTTACCCCCATCATTCCTCCTATTACTAGCCTCCTCCACAGTAGAAGCCGGAGCCGGTACTGGATGAACCGTATACCCTCCCTTAGCAGGCAACCTAGCCCATGCCGGCGCCTCAGTAGACTTAGCCATCTTCTCCCTCCACTTAGCAGGAGTATCCTCCATTCTAGGTGCAATCAACTTCATCACAACAGCTATTAACATAAAACCGCCTGCCCTTTCACAATACCAAACCCCCCTTTTCGTCTGATCCGTCCTTATTACTGCCGTCCTCCTTCTACTCTCATTACCAGTCCTTGCCGCAGGCATTACCATACTACTAACCGACCGAAACCTAAATACCACATTCTTCGACCCAGCCGGAGGCGGAGACCCTATCCTATACCAACACCTGTTCTGATTTTTCGGCCACCCTGAAGTCTACATCCTGATCCTGCCAGGC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Milvago chimachima

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Yellow-headed caracara

The yellow-headed caracara (Milvago chimachima) is a bird of prey in the family Falconidae. It is found in tropical and subtropical South America and the southern portion of Central America. Unlike the falcons in the same family, the caracara is not a fast-flying aerial hunter, but is rather sluggish and often obtains food by scavenging.

Systematics[edit]

When Louis Jean Pierre Vieillot first described the yellow-headed caracara in 1816, he gave it the scientific name Polyborus chimachima, putting it in the same genus as the rest of the caracaras.[2] In 1824, German naturalist Johann Baptist von Spix created the genus Milvago for this species and the closely related chimango caracara.[3]

Description[edit]

the Yellow-headed Caracara in flight

The yellow-headed caracara is 41–46 cm (16–18 in) in length and weighs 325 g (11.5 oz) on average. Like many other birds of prey,[4] the female is larger than the male, weighing 310–360 g (11–13 oz) against the male's 280–330 g (9.9–11.6 oz). Apart from the difference in size, there is no significant sexual dimorphism in this species. It is broad-winged and long-tailed, somewhat resembling a small Buteo. The adult has a buff head, with a black streak behind the eye, and buff underparts. The upper plumage is brown with distinctive pale patches on the flight feathers of the wings, and the tail is barred cream and brown. The head and underparts of immature birds have dense brown mottling.

The voice is a characteristic screamed schreee.

Distribution and habitat[edit]

This is a bird of savanna, swamps and forest edges. Resident from Costa Rica south through Trinidad and Tobago to northern Argentina (the provinces of Misiones, Chaco, Formosa, Corrientes and Santa Fe), it is typically found from sea level to 1,800 m (5,900 ft), and occasionally to 2,600 m (8,500 ft) above mean sea level. In southern South America, it is replaced by a close relative, the chimango caracara, whose range overlaps with that of the yellow-headed caracara in southern Brazil, northern Argentina, Paraguay and Uruguay. A larger and stouter paleosubspecies, Milvago chimachima readei, occurred in Florida and possibly elsewhere some tens of thousand years ago, during the Late Pleistocene.[5] According to the Peregrine Fund database, the yellow-headed caracara is expanding its range into Nicaragua.[6]

Behavior and ecology[edit]

the yellow-headed caracara is among the most commonly seen birds of prey in Latin American cities

The yellow-headed caracara is omnivorous, and will eat reptiles, amphibians and other small animals as well as carrion. Birds are rarely if ever taken, and this species will not elicit warning calls from mixed-species feeding flocks that cross its path even in open cerrado habitat.[7] It will also take ticks from cattle, and is locally called "tickbird". It has been observed also to forage for small invertebrates in the fur of brown-throated three-toed sloths.[8] In addition, at least younger birds are fond of certain fruits, such as those of the oil palm (Elaeis guineensis) and pequi (Caryocar brasiliense).[9] It lays from five to seven brown-marked buff eggs in a stick nest in a tree.[10]

The yellow-headed caracara has benefited from forest clearing for cattle ranching. Its status in Trinidad has changed from rare to fairly common, and it was first seen on Tobago in 1987.[11] It adapts readily to urban areas and, together with species such as the American black vulture (Coragyps atratus), it is among the most commonly seen bird of prey in Latin American cities. Consequently, this wide-ranging species has been assigned a risk level of Least Concern category on the IUCN Red List.[1] In Panama City for example, as a result of the increased urban sprawl, yellow-headed caracara pairs are frequently seen along the rooftops in suburban neighborhoods.

Gallery[edit]

References[edit]

  1. ^ a b BirdLife International (2012). "Milvago chimachima". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Drapiez, Auguste (1838). Dictionnaire classique des sciences naturelles, présentant la définition, l'analyse et l'histoire de tous les êtres qui composent les trois règnes (in French) 4. Brussels, Belgium: Meline et Cans. p. 350. 
  3. ^ Godwin, Frederick Ducane; Salvin, Osbert (1904). Biologia centrali-americana 3. R.H. Porter. p. 127. 
  4. ^ Andersson, MB (1994). Sexual selection. Princeton, New Jersey: Princeton University Press. p. 269. ISBN 978-0-691-00057-2. 
  5. ^ Emslie, S.D. (1998). "Avian Community, Climate, and Sea-Level Changes in the Plio-Pleistocene of the Florida Peninsula". Ornithological Monographs 50: 44–45. doi:10.2307/40166707. 
  6. ^ "Milvago chimachima". Global Raptor Information Network. The Peregrine Fund. Retrieved 2011-07-15. 
  7. ^ Ragusa-Netto, J. (2000). "Raptors and "campo-cerrado" bird mixed flock led by Cypsnagra hirundinacea (Emberizidae: Thraupinae)". Revista Brasileira de Biologia (in English with Portuguese abstract) 60 (3): 461–467. doi:10.1590/S0034-71082000000300011. PMID 11188872. Retrieved 2011-07-15. 
  8. ^ Krakauer, A.H.; Krakauer, T.H. (1999). "Foraging of Yellow-headed Caracaras in the Fur of a Three-toed Sloth". Journal of Raptor Research 33 (3): 270. 
  9. ^ Olmos, Fábio; Pacheco, José Fernando; Silveira, Luís Fábio (2006). "Notas sobre aves de rapina (Cathartidae, Acciptridae e Falconidae) brasileiras" [Notes on Brazilian birds of prey]. Revista Brasileira de Ornitologia (in Portuguese with English abstract) 14 (4): 401–404. 
  10. ^ Pereira, José Felipe Monteiro (2008). Aves e Pássaros Comuns do Rio de Janeiro [Common birds of Rio de Janeiro]. Rio de Janeiro: Technical Books. p. 45. ISBN 978-85-61368-00-5. 
  11. ^ ffrench, Richard; O'Neill, John Patton; Eckelberry, Don R. (1991). A Guide to the Birds of Trinidad and Tobago (2nd ed.). Ithaca, N.Y.: Comstock Publishing. ISBN 0-8014-9792-2. 

Further reading[edit]

  • Hilty, Steven L. (2003). Birds of Venezuela. Princeton University Press. ISBN 0-7136-6418-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!