Overview

Brief Summary

Biology

The Amur falcon feeds mainly on insects, including locusts, grasshoppers, beetles, and flying termites and ants. Small birds and some amphibians may also be taken. Most hunting takes place in the early morning or late evening, with prey usually caught and eaten in flight, or taken from the ground. The Amur falcon may sometimes hover while searching for prey (2) (5). A social bird, the Amur falcon is usually found in flocks, sometimes numbering into the hundreds or even thousands, and often associates with other small falcon species such as the red-footed falcon (Falco vespertinus) and the lesser kestrel (Falco naumanni) (2) (3) (8). The congregation of thousands of falcons at their communal roosting sites in southern Africa is said to be one of the most spectacular bird of prey phenomena in the world (9). Most nesting, however, is solitary, or in small colonies (2) (3). The nest may be built in a tree hole, or the breeding pair may take over an old nest of a corvid. Three to four eggs are laid (sometimes up to six), usually between May and June, and hatch after an incubation period of around 28 to 30 days. Both the male and female help incubate and feed the chicks, which fledge after about a month. The Amur falcon may reach sexual maturity in its first year (2). As well as being one of the longest, the Amur falcon's annual round-trip of 22,000 kilometres is also the most oceanic migrations of any bird of prey, with over 3,000 kilometres of the outbound journey to Africa taking place over the Indian Ocean (6). The entire population of Amur falcons leaves the breeding area in Asia from late August to September, generally travelling in huge flocks, which may also include other small falcon species. The birds stop off in India and Bangladesh for several weeks to fatten up before attempting the Indian Ocean crossing (2) (3) (6) (10). Interestingly, the return journey from Africa to Asia, which takes place between February and March, is less well understood, and is thought to take place overland via the Arabian Peninsula (6) (10), with the birds arriving back in the breeding grounds in April and early May (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

A small, slender bird of prey, with long, pointed wings (5) (6), the Amur falcon is noteworthy for undertaking one of the most arduous annual migrations of any bird of prey (6). The male is a largely dark grey bird, with a chestnut lower belly and thighs, and a white underwing, visible in flight. The dark plumage contrasts with the bright orange-red legs and facial skin, and the orange base to the beak (3) (5). The female is similar in size to the male (3) (5), but differs markedly in plumage, having cream or orange underparts, with dark streaks and bars, grey upperparts with a slaty-coloured head and cream forehead, and bars and spots on the wings and tail, which have broad, dark tips. The cheeks and throat are plain white, and the face bears a dark eye patch and 'moustache'. The juvenile resembles the female, but may be paler, with reddish-brown or buff edges to the feathers. Once considered a subspecies of the red-footed falcon, Falco vespertinus, differences in the plumage, body shape and range of the Amur falcon have led to its classification as a separate species (2) (3) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Steppes of ne Asia; winters from Malawi to South Africa.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The Amur falcon has a wide distribution, breeding across Asia, from eastern Siberia, east through Amurland to Ussuriland, and south through northeast Mongolia and Manchuria, to North Korea and northern and eastern China. The species may also breed in northeast India. The Amur falcon spends the northern winter in the southern Hemisphere, in sub-Saharan Africa, mainly from Malawi to South Africa. During migration, the Amur falcon may pass through parts of India, East Africa and the Arabian Peninsula (2) (3) (5) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Amur falcon typically inhabits open woodland, including marshy and riverine woodland, as well as wooded steppe. In winter, it may be found in savanna and grassland, roosting communally in clumps of trees, and may even roost in towns (2) (3) (5) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Falco amurensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACCTACTCTTCGGATCATGAGCAGGTATAGCTGGCACCGCCCTCAGCCTCCTCATTCGAGCAGAACTTGGCCAACCAGGAACTCTCCTGGGAGACGACCAAATCTACAATGTCATCGTCACCGCCCATGCCTTCGTAATAATCTTTTTCATAGTCATACCCATCATAATCGGAGGATTTGGAAACTGACTAGTCCCCCTTATAATTGGAGCCCCAGACATAGCATTCCCCCGCATAAACAATATAAGCTTCTGACTACTCCCCCCATCCTTCCTATTACTCCTAGCATCCTCAACAGTAGAGGCCGGGGTTGGAACAGGATGAACCGTATACCCTCCCTTAGCAGGCAACCTAGCCCATGCTGGCGCCTCAGTAGACCTAGCCATCTTCTCTTTACACCTCGCAGGTGTATCTTCCATCTTAGGGGCAATCAACTTTATTACAACGGCCATTAACATAAAACCCCCTGCCCTATCACAATACCAAACTCCACTATTCGTATGATCCGTACTTATCACCGCCGTGCTCCTACTACTCTCACTCCCAGTCCTAGCTGCCGGCATCACTATACTATTAACCGACCGAAACCTAAACACCACATTCTTTGACCCCGCTGGAGGGGGAGACCCCATTCTCTACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTTTACATCCTAATTCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Falco amurensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (extent of occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5