Overview

Brief Summary

Biology

The Amur falcon feeds mainly on insects, including locusts, grasshoppers, beetles, and flying termites and ants. Small birds and some amphibians may also be taken. Most hunting takes place in the early morning or late evening, with prey usually caught and eaten in flight, or taken from the ground. The Amur falcon may sometimes hover while searching for prey (2) (5). A social bird, the Amur falcon is usually found in flocks, sometimes numbering into the hundreds or even thousands, and often associates with other small falcon species such as the red-footed falcon (Falco vespertinus) and the lesser kestrel (Falco naumanni) (2) (3) (8). The congregation of thousands of falcons at their communal roosting sites in southern Africa is said to be one of the most spectacular bird of prey phenomena in the world (9). Most nesting, however, is solitary, or in small colonies (2) (3). The nest may be built in a tree hole, or the breeding pair may take over an old nest of a corvid. Three to four eggs are laid (sometimes up to six), usually between May and June, and hatch after an incubation period of around 28 to 30 days. Both the male and female help incubate and feed the chicks, which fledge after about a month. The Amur falcon may reach sexual maturity in its first year (2). As well as being one of the longest, the Amur falcon's annual round-trip of 22,000 kilometres is also the most oceanic migrations of any bird of prey, with over 3,000 kilometres of the outbound journey to Africa taking place over the Indian Ocean (6). The entire population of Amur falcons leaves the breeding area in Asia from late August to September, generally travelling in huge flocks, which may also include other small falcon species. The birds stop off in India and Bangladesh for several weeks to fatten up before attempting the Indian Ocean crossing (2) (3) (6) (10). Interestingly, the return journey from Africa to Asia, which takes place between February and March, is less well understood, and is thought to take place overland via the Arabian Peninsula (6) (10), with the birds arriving back in the breeding grounds in April and early May (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

A small, slender bird of prey, with long, pointed wings (5) (6), the Amur falcon is noteworthy for undertaking one of the most arduous annual migrations of any bird of prey (6). The male is a largely dark grey bird, with a chestnut lower belly and thighs, and a white underwing, visible in flight. The dark plumage contrasts with the bright orange-red legs and facial skin, and the orange base to the beak (3) (5). The female is similar in size to the male (3) (5), but differs markedly in plumage, having cream or orange underparts, with dark streaks and bars, grey upperparts with a slaty-coloured head and cream forehead, and bars and spots on the wings and tail, which have broad, dark tips. The cheeks and throat are plain white, and the face bears a dark eye patch and 'moustache'. The juvenile resembles the female, but may be paler, with reddish-brown or buff edges to the feathers. Once considered a subspecies of the red-footed falcon, Falco vespertinus, differences in the plumage, body shape and range of the Amur falcon have led to its classification as a separate species (2) (3) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Steppes of ne Asia; winters from Malawi to South Africa.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The Amur falcon has a wide distribution, breeding across Asia, from eastern Siberia, east through Amurland to Ussuriland, and south through northeast Mongolia and Manchuria, to North Korea and northern and eastern China. The species may also breed in northeast India. The Amur falcon spends the northern winter in the southern Hemisphere, in sub-Saharan Africa, mainly from Malawi to South Africa. During migration, the Amur falcon may pass through parts of India, East Africa and the Arabian Peninsula (2) (3) (5) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Amur falcon typically inhabits open woodland, including marshy and riverine woodland, as well as wooded steppe. In winter, it may be found in savanna and grassland, roosting communally in clumps of trees, and may even roost in towns (2) (3) (5) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Falco amurensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACCTACTCTTCGGATCATGAGCAGGTATAGCTGGCACCGCCCTCAGCCTCCTCATTCGAGCAGAACTTGGCCAACCAGGAACTCTCCTGGGAGACGACCAAATCTACAATGTCATCGTCACCGCCCATGCCTTCGTAATAATCTTTTTCATAGTCATACCCATCATAATCGGAGGATTTGGAAACTGACTAGTCCCCCTTATAATTGGAGCCCCAGACATAGCATTCCCCCGCATAAACAATATAAGCTTCTGACTACTCCCCCCATCCTTCCTATTACTCCTAGCATCCTCAACAGTAGAGGCCGGGGTTGGAACAGGATGAACCGTATACCCTCCCTTAGCAGGCAACCTAGCCCATGCTGGCGCCTCAGTAGACCTAGCCATCTTCTCTTTACACCTCGCAGGTGTATCTTCCATCTTAGGGGCAATCAACTTTATTACAACGGCCATTAACATAAAACCCCCTGCCCTATCACAATACCAAACTCCACTATTCGTATGATCCGTACTTATCACCGCCGTGCTCCTACTACTCTCACTCCCAGTCCTAGCTGCCGGCATCACTATACTATTAACCGACCGAAACCTAAACACCACATTCTTTGACCCCGCTGGAGGGGGAGACCCCATTCTCTACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTTTACATCCTAATTCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Falco amurensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1) and listed on Appendix II of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.1,000,000 individuals (Ferguson-Lees et al. 2001), while national population estimates include: c.100-10,000 breeding pairs and c.50-1,000 individuals on migration in China; c.100-10,000 breeding pairs and < c.50 individuals on migration in Korea; < c.50 individuals on migration in Japan and c.100-10,000 breeding pairs and c.50-1,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

The Amur falcon still has a wide distribution and a large global population, which is believed to be stable (7). There are no specific threats reported for this species, which can still be seen in large flocks, sometimes numbering as many as 5,000 birds (2). However, the grassland areas the Amur falcon inhabits in its wintering quarters in southern Africa are under intense pressure from agriculture and commercial afforestation (8), which could bring the species under increasing pressure across its non-breeding range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

A number of conservation measures are currently in place for the Amur falcon. As well as being listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), meaning that international trade in the Amur falcon should be carefully regulated (4), the species is on Appendix II of the Convention on Migratory Species (CMS), which aims to conserve migratory species throughout their range (11). The Amur falcon, along with other birds of prey, is also listed under Class B of the African Convention on the Conservation of Nature and Natural Resources, meaning that, within its African range, it can only be legally killed or captured with special authorisation (12). The congregation of thousands of Amur falcons at their winter roosting sites gives the perfect opportunity to census the species' global population, allowing population numbers and trends to be quantified, and any potential conservation threats to be identified and addressed (2) (9). The Migrating Kestrel Project, co-ordinated by the Birds of Prey Working Group of the Endangered Wildlife Trust, South Africa, was initiated in 1994 for this purpose, and continues to date (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Amur Falcon

The Amur falcon (Falco amurensis) is a small raptor of the falcon family. It breeds in south-eastern Siberia and Northern China before migrating in large flocks across India and over the Arabian Sea to winter in Southern Africa. It was earlier treated as a subspecies of the red-footed falcon (Falco vespertinus) and known as the Eastern red-footed falcon. Males are dark grey with reddish brown thighs and undertail coverts; reddish orange eye-ring, cere, and feet. Females are duller above with dark scaly markings on white underparts, an orange eye ring, cere, and legs. Only a pale wash of rufous is visible on their thighs and undertail coverts. Their diet consists mainly of insects such as termites and during migration over the sea, are thought to feed on migrating dragonflies. The route that they take from Africa back to their breeding grounds is as yet unclear.

Description[edit]

Male

Males are characteristically dark sooty grey above with rufous thighs and vent. In flight the wing lining is white, contrasting with the dark wing feathers. Adult males of the closely related red-footed falcon have a dark grey wing lining. In Africa, males can be confused with melanistic Gabar goshawks but the chestnut on the vent is distinctive. Also there may be some superficial resemblance to sooty falcon and grey kestrel, but those two species both have yellow feet and cere. The wings are long as in most falcons (with a span of 63–71 cm) and at rest the wing tip reaches or extends just beyond the tail-tip.[2]

Females can be more confusing as they share a pattern common to many falcons but are distinctive in having an orange eye-ring, a red cere and reddish orange feet. Juveniles can be confused only with those of the red-footed falcon but lack the buffy underwing coverts.

Taxonomy[edit]

The Amur falcon was long considered a subspecies or morph of the red-footed falcon, but it is nowadays considered distinct. Nonetheless, it is the red-footed falcon's closest relative; their relationship to other falcons is more enigmatic. They appear morphologically somewhat intermediate between kestrels and hobbies and DNA sequence data has been unable to further resolve this question, mainly due to lack of comprehensive sampling.[3][4][5]

Distribution and migration[edit]

The Amur falcon breeds in east Asia from the Transbaikalia, Amurland, and northern Mongolian region to parts of North Korea. They migrate in a broad front through India, sometimes further east over Thailand and Cambodia and then over the Arabian Sea, sometimes in passage on the Maldives and other islands to reach southern Africa. Birds going over India are thought to be aided by strong winds blowing westward. These winds are strong at an altitude of about 3000m and the birds are thought to fly at a height of above 1000m during migration.[7] The route taken to return to their breeding grounds is not clear but they avoid the long ocean crossing and possibly take an overland route northward through Africa and to the west of the Himalayas.[2] Vagrants have been recorded as far west as in Italy, Sweden, St. Helena and the United Kingdom.[6]

Behaviour and ecology[edit]

The Amur falcon feeds mainly late in the evening or early in the morning capturing a wide range of insects in the air or on the ground. They capture most of their prey in flight, sometimes by hovering but will also pick prey by alighting on the ground.[6] The winter diet appears to be almost entirely made up of insects[8] but they take small birds and amphibians to feed their young in their breeding range. The rains in Africa produce swarms of termites, locusts, ants and beetles that provide ample food.[9] Their migration over the Arabian Sea coincides with the timing of the migration of dragonflies (Pantala flavescens) and these are thought to provide food during the most arduous part of their migration route.[10] Their breeding habitats are in open wooded country with marshes. During migration they stay in open forest or grasslands, roosting colonially on exposed perches or wires.[6]

The breeding season is May to June and several pairs may nest close together. Abandoned nest platforms belonging to birds of prey or corvids and even tree hollows are re-used for nesting. Three or four eggs are laid (at two day intervals). Both parents take turns to incubate and feed the chicks which hatch after about a month. The young birds leave the nest after about a month.[6]

Status and conservation[edit]

The wide breeding range and large population size of the Amur falcon have led to the species being assessed as being of least concern. The flocking behaviour during migration and the density at which they occur however expose them to hunting and other threats. During their migration from their breeding area to the winter quarters they are plump and are hunted for food in parts of northeastern India as well as in eastern Africa.[1][11] In 2012, mass trapping and capture of migrating Amur falcons in Nagaland (India) was reported in the media and a campaign was begun to prevent their killing. As part of this campaign, three birds were fitted with 5 gm satellite transmitters that allowed them to be tracked during their migration.[12]

References[edit]

  1. ^ a b BirdLife International (2012). "Falco amurensis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c Rasmussen, PC & JC Anderton (2005). Birds of South Asia. The Ripley Guide. Volume 2. Washington, DC & Barcelona: Smithsonian Institution & Lynx Edicions. p. 113. 
  3. ^ Wink, Michael; Seibold, I.; Lotfikhah, F. & Bednarek, W. (1998): Molecular systematics of holarctic raptors (Order Falconiformes). In: Chancellor, R.D., Meyburg, B.-U. & Ferrero, J.J. (eds.): Holarctic Birds of Prey: 29–48. Adenex & WWGBP.
  4. ^ Griffiths, Carole S. (1999). "Phylogeny of the Falconidae inferred from molecular and morphological data". Auk 116 (1): 116–130. doi:10.2307/4089459. 
  5. ^ Griffiths, Carole S.; Barrowclough, George F.; Groth, Jeff G. & Mertz, Lisa (2004). "Phylogeny of the Falconidae (Aves): a comparison of the efficacy of morphological, mitochondrial, and nuclear data". Molecular Phylogenetics and Evolution 32 (1): 101–109. doi:10.1016/j.ympev.2003.11.019. PMID 15186800. 
  6. ^ a b c d e Orta, J. (1994). "Amur Falcon". In del Hoyo, J., A. Elliott, and J. Sargatal. Handbook of birds of the world. Vol. 2. New World vultures to guineafowl. Barcelona: Lynx Edicions. pp. 265–266. 
  7. ^ Clement, Peter; Holman, David (2001). "Passage records of Amur Falcon Falco amurensis from SE Asia and southern Africa including first records from Ethiopia.". Bulletin of the British Ornithologists' Club 121 (1): 222–230. 
  8. ^ Kopij, Grzegorz (2009). "Seasonal variation in the diet of the Amur kestrel (Falco amurensis) in its winter quarter in Lesotho". African Journal of Ecology 48 (2): 559–562. doi:10.1111/j.1365-2028.2009.01130.x. 
  9. ^ Pietersen, Darren W; Symes, Craig T (2010). "Assessing the diet of Amur Falcon Falco amurensis and Lesser Kestrel Falco naumanni using stomach content analysis". Ostrich: Journal of African Ornithology 81 (1): 39–44. doi:10.2989/00306525.2010.455817. 
  10. ^ Anderson, R. Charles (2009). "Do dragonflies migrate across the western Indian Ocean?". Journal of Tropical Ecology 25: 347–358. doi:10.1017/S0266467409006087. 
  11. ^ Ali, S & S. Dillon Ripley. Handbook of the Birds of India and Pakistan. Volume 1. (2 ed.). New Delhi: Oxford University Press. pp. 361–363. 
  12. ^ Boyes, Steve. "Safe Passage For Amur Falcons Through India". National Geographic. Retrieved 11 December 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!