Overview

Brief Summary

Biology

The Amur falcon feeds mainly on insects, including locusts, grasshoppers, beetles, and flying termites and ants. Small birds and some amphibians may also be taken. Most hunting takes place in the early morning or late evening, with prey usually caught and eaten in flight, or taken from the ground. The Amur falcon may sometimes hover while searching for prey (2) (5). A social bird, the Amur falcon is usually found in flocks, sometimes numbering into the hundreds or even thousands, and often associates with other small falcon species such as the red-footed falcon (Falco vespertinus) and the lesser kestrel (Falco naumanni) (2) (3) (8). The congregation of thousands of falcons at their communal roosting sites in southern Africa is said to be one of the most spectacular bird of prey phenomena in the world (9). Most nesting, however, is solitary, or in small colonies (2) (3). The nest may be built in a tree hole, or the breeding pair may take over an old nest of a corvid. Three to four eggs are laid (sometimes up to six), usually between May and June, and hatch after an incubation period of around 28 to 30 days. Both the male and female help incubate and feed the chicks, which fledge after about a month. The Amur falcon may reach sexual maturity in its first year (2). As well as being one of the longest, the Amur falcon's annual round-trip of 22,000 kilometres is also the most oceanic migrations of any bird of prey, with over 3,000 kilometres of the outbound journey to Africa taking place over the Indian Ocean (6). The entire population of Amur falcons leaves the breeding area in Asia from late August to September, generally travelling in huge flocks, which may also include other small falcon species. The birds stop off in India and Bangladesh for several weeks to fatten up before attempting the Indian Ocean crossing (2) (3) (6) (10). Interestingly, the return journey from Africa to Asia, which takes place between February and March, is less well understood, and is thought to take place overland via the Arabian Peninsula (6) (10), with the birds arriving back in the breeding grounds in April and early May (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

A small, slender bird of prey, with long, pointed wings (5) (6), the Amur falcon is noteworthy for undertaking one of the most arduous annual migrations of any bird of prey (6). The male is a largely dark grey bird, with a chestnut lower belly and thighs, and a white underwing, visible in flight. The dark plumage contrasts with the bright orange-red legs and facial skin, and the orange base to the beak (3) (5). The female is similar in size to the male (3) (5), but differs markedly in plumage, having cream or orange underparts, with dark streaks and bars, grey upperparts with a slaty-coloured head and cream forehead, and bars and spots on the wings and tail, which have broad, dark tips. The cheeks and throat are plain white, and the face bears a dark eye patch and 'moustache'. The juvenile resembles the female, but may be paler, with reddish-brown or buff edges to the feathers. Once considered a subspecies of the red-footed falcon, Falco vespertinus, differences in the plumage, body shape and range of the Amur falcon have led to its classification as a separate species (2) (3) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Steppes of ne Asia; winters from Malawi to South Africa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The Amur falcon has a wide distribution, breeding across Asia, from eastern Siberia, east through Amurland to Ussuriland, and south through northeast Mongolia and Manchuria, to North Korea and northern and eastern China. The species may also breed in northeast India. The Amur falcon spends the northern winter in the southern Hemisphere, in sub-Saharan Africa, mainly from Malawi to South Africa. During migration, the Amur falcon may pass through parts of India, East Africa and the Arabian Peninsula (2) (3) (5) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Amur falcon typically inhabits open woodland, including marshy and riverine woodland, as well as wooded steppe. In winter, it may be found in savanna and grassland, roosting communally in clumps of trees, and may even roost in towns (2) (3) (5) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Falco amurensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACCTACTCTTCGGATCATGAGCAGGTATAGCTGGCACCGCCCTCAGCCTCCTCATTCGAGCAGAACTTGGCCAACCAGGAACTCTCCTGGGAGACGACCAAATCTACAATGTCATCGTCACCGCCCATGCCTTCGTAATAATCTTTTTCATAGTCATACCCATCATAATCGGAGGATTTGGAAACTGACTAGTCCCCCTTATAATTGGAGCCCCAGACATAGCATTCCCCCGCATAAACAATATAAGCTTCTGACTACTCCCCCCATCCTTCCTATTACTCCTAGCATCCTCAACAGTAGAGGCCGGGGTTGGAACAGGATGAACCGTATACCCTCCCTTAGCAGGCAACCTAGCCCATGCTGGCGCCTCAGTAGACCTAGCCATCTTCTCTTTACACCTCGCAGGTGTATCTTCCATCTTAGGGGCAATCAACTTTATTACAACGGCCATTAACATAAAACCCCCTGCCCTATCACAATACCAAACTCCACTATTCGTATGATCCGTACTTATCACCGCCGTGCTCCTACTACTCTCACTCCCAGTCCTAGCTGCCGGCATCACTATACTATTAACCGACCGAAACCTAAACACCACATTCTTTGACCCCGCTGGAGGGGGAGACCCCATTCTCTACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTTTACATCCTAATTCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Falco amurensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1) and listed on Appendix II of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The Amur falcon still has a wide distribution and a large global population, which is believed to be stable (7). There are no specific threats reported for this species, which can still be seen in large flocks, sometimes numbering as many as 5,000 birds (2). However, the grassland areas the Amur falcon inhabits in its wintering quarters in southern Africa are under intense pressure from agriculture and commercial afforestation (8), which could bring the species under increasing pressure across its non-breeding range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

A number of conservation measures are currently in place for the Amur falcon. As well as being listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), meaning that international trade in the Amur falcon should be carefully regulated (4), the species is on Appendix II of the Convention on Migratory Species (CMS), which aims to conserve migratory species throughout their range (11). The Amur falcon, along with other birds of prey, is also listed under Class B of the African Convention on the Conservation of Nature and Natural Resources, meaning that, within its African range, it can only be legally killed or captured with special authorisation (12). The congregation of thousands of Amur falcons at their winter roosting sites gives the perfect opportunity to census the species' global population, allowing population numbers and trends to be quantified, and any potential conservation threats to be identified and addressed (2) (9). The Migrating Kestrel Project, co-ordinated by the Birds of Prey Working Group of the Endangered Wildlife Trust, South Africa, was initiated in 1994 for this purpose, and continues to date (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Amur Falcon

The Amur Falcon (Falco amurensis), formerly Eastern Red-footed Falcon, is a small raptor of the falcon family. It breeds in south-eastern Siberia and Northern China, wintering in Southern Africa. Its diet consists mainly of insects, such as termites.

Contents

Description

Amur Falcon in Mongolia

Males are characteristically dark sooty brown, and may offer confusion with melanistic Gabar Goshawk, but the chestnut on the vent should prevent confusion here. Also there may be some superficial resemblance to Sooty Falcon and Grey Kestrel, but those two species both have yellow feet and cere. Separating male Amur and Red-footed Falcons is best done by the white underwing coverts on Amur Falcon, whereas the underwing of male Red-footed Falcons is uniformly grey.

Females may offer a bit more confusion with a wider range of falcons as they have a typical falcon head pattern. The grey on the top of the head should quickly rule out confusion with Red-footed Falcons. The female has barring on the lower belly. Red cere and feet rule out all other falcons.

For juveniles, red feet should restrict ID to the Amur and Red-footed group, and the darker crown and lack of buff all the way up the belly rules out Western Red-footed Falcon. Females and juveniles lack the buff underwing coverts of Red-footed Falcon.

Taxonomy

It was long considered a subspecies or mere morph of the Red-footed Falcon, but it is nowadays considered well distinct. Nonetheless, it is the Red-footed Falcon's closest relative; their relationship to other falcons is more enigmatic. They appear morphologically somewhat intermediate between kestrels and hobbies and DNA sequence data has been unable to further resolve this question, mainly due to lack of comprehensive sampling. They might be closer to the Merlin than to most other living falcons, or more generally related to this species and American falcons such as the American Kestrel and the Aplomado Falcon.[2][3][4]

Relationship with humans

Every year, more than 100,000 Amur Falcons are hunted for food at Nagaland during their passage between breeding and wintering grounds.[5]

References

  1. ^ BirdLife International (2012). "Falco amurensis". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106003604. Retrieved 16 July 2012.
  2. ^ Wink, Michael; Seibold, I.; Lotfikhah, F. & Bednarek, W. (1998): Molecular systematics of holarctic raptors (Order Falconiformes). In: Chancellor, R.D., Meyburg, B.-U. & Ferrero, J.J. (eds.): Holarctic Birds of Prey: 29–48. Adenex & WWGBP.
  3. ^ Griffiths, Carole S. (1999). "Phylogeny of the Falconidae inferred from molecular and morphological data". Auk 116 (1): 116–130. doi:10.2307/4089459. 
  4. ^ Griffiths, Carole S.; Barrowclough, George F.; Groth, Jeff G. & Mertz, Lisa (2004). "Phylogeny of the Falconidae (Aves): a comparison of the efficacy of morphological, mitochondrial, and nuclear data". Molecular Phylogenetics and Evolution 32 (1): 101–109. doi:10.1016/j.ympev.2003.11.019. PMID 15186800. 
  5. ^ Shocking Amur Falcon Massacre in Nagaland. Conservation India. Retrieved on 2013-03-26.

Identification

European occurrences

  • Corso, Andrea and Pete Dennis (1998) Amur Falcons in Italy – a new Western Palearctic bird Birding World 11(7):259-60
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!