Overview

Brief Summary

Biology

The graceful red-footed falcon flies with occasional quick wing beats and longer periods of gliding while it continually adjusts its long wings and tail. It captures much of its food in flight, particularly crickets, locusts and grasshoppers (2), and the falcon's flight can become erratic and jerky when in pursuit of a meal. It will often hover, kestrel-like, for short periods (4), as it searches for prey on the ground (2), and will also run along the ground after prey such as voles, mice, shrews, lizards and toads (2) (4). The red-footed falcon hunts most actively around dawn and dusk, when it can be seen flying low, particularly over rivers (2). The red-footed falcon is a social bird and is rarely encountered singly (4). They roost in large colonies, sometimes consisting of thousands of birds (2), and the entire population migrates together between south-west Africa and their Eurasian breeding grounds. After spending November to February on their wintering grounds, the red-footed falcons travel vast distances and arrive at the breeding grounds from mid-April to mid-May (2). Here they nest in colonies of tens or thousands of pairs, occupying old nests of raptors and corvids (for example, rooks), cliff or tree holes, or nest on the ground protected by a shrub (2). Three to four eggs are normally laid, at intervals of two days, which are then incubated by both parents for 27 to 28 days. The chicks fledge 27 to 30 days after hatching and gain complete independence around one week later (2). September sees the falcons begin their great journey once again and large numbers can be seen over the coastal plains of Israel in early October (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The red-footed falcon is a small, slender bird of prey in which the male and female vary considerably in appearance (4). Males have mostly slate-grey plumage, which contrasts with its warm chestnut lower belly, undertail and thighs (2). Its legs are, unsurprisingly, red, as are the eye-rings and a patch at the base of its bill (2). The larger females have blue-grey upperparts and tail patterned with black bands, with rusty orange or yellowish plumage on the under parts. The pale head bears a rust-coloured crown, a blackish eye patch and slight moustache. Not so suited to its common name, the bare parts of the female red-footed falcon are orange (2). Its scientific species name, vespertinus, is Latin for 'of the evening' and probably refers to the time of the day when the red-footed falcon can be seen hunting (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Falco vespertinus breeds in eastern Europe and west, central and north-central Asia, with its main range from Belarus south to Hungary, northern Serbia and Montenegro, Romania, Moldova and east Bulgaria, eastward through Ukraine and north-west and south Russia and north Kazakhstan to extreme north-west China and the upper Lena river (Russia). It winters in southern Africa, from South Africa northwards to southern Kenya(Ferguson-Lees et al. 2001). In Central Europe, 1,000-3,500 birds congregate at migratory roost sites (P. Palatitz in litt. 2007). It has a large global population estimated to be 300,000-800,000 individuals (Ferguson-Lees et al. 2001), but recent evidence suggests that it is undergoing large declines in parts of its range. The European population of 26,000-39,000 pairs (forming 25-49% of the global population) suffered a large decline during 1970-1990(Tucker and Heath 1994), and has continued to decline during 1990-2000, particularly in the key populations in Russia and Ukraine, with overall declines exceeding 30% in 10 years (three generations)(BirdLife International 2004). A national scale survey conducted in Ukraine in 2009, estimated an approximate decline of 23% compared to 1990-2000 (Kostenko 2009). Declines have also been reported from eastern Siberia, where the species may have disappeared as a breeder from the Baikal region(I. Fefelov in litt. 2005, Popov 2000). In Hungary estimated populations have declined from 2,000-2,500 pairs in the late 1980s to 600-700 pairs based on surveys in 2003-2006(P. Palatitz in litt. 2005, 2007), and in Bulgaria previously estimated 50-150 pairs dropped to 15- 50 pairs based on a partial survey conducted in 2009 (Palatitz et al. 2009). In 2006, surveys in Bulgaria found the species breeding at only 26 sites, out of 75 known locations (Anon. 2007). However, populations in central Asia appear to be stable, with the species reported to be common in suitable habitats in Kazakhstan (especially in forest-steppe zone with Rook Corvus frugilegus colonies), and no evidence of any population declines there(E. Bragin in litt. 2005). Some small marginal populations in south-west Europe are also stable or increasing(BirdLife International 2004), especially in Italy (P. Palatitz in litt. 2007).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Central Eurasia; winters in Africa south of the Sahara.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The red-footed falcon breeds in eastern Europe and west, central and north-central Asia, from Estonia and Hungary to extreme north-western China. It spends winter in south-west Africa, from Angola, Namibia and north South Africa, through Botswana to Zimbabwe and Zambia (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species breeds in open lowlands with trees and plenty of insects, on which it feeds, including steppe and forest-steppe, open woodland, cultivation and pastureland with tall hedgerows or fringing trees, agricultural areas with shelterbelts and, in the north-east, boggy areas and taiga edge. It is usually colonial, breeding in disused nests of other birds (most commonly C. frugilegus), but can also be solitary. It is found from sea-level to c.300 m in the west, but to 1,500 m in Asia (Ferguson-Lees et al. 2001). It is often crepuscular (Ferguson-Lees and Christie 2001). The species is migratory, with birds travelling great distances to their wintering grounds in southern Africa (del Hoyo et al. 1994). Most leave their breeding grounds in August and September, making the return journey between February and May (del Hoyo et al. 1994, Ferguson-Lees and Christie 2001). Birds migrate in a broad front across the Mediterranean Sea, not concentrating at bottleneck sites to the extent that many other raptors do (Brown et al. 1982, del Hoyo et al. 1994, Snow and Perrins 1998). On migration, they form mixed flocks often over 100 strong with other falcons such as F. naumanni, and tend to stay at very high altitudes for the majority of the journey (Ferguson-Lees and Christie 2001).


Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In their Eurasian breeding range, red-footed falcons inhabit open habitats with some tree cover. This includes steppe, wooded steppe, cultivation and pastures, normally in lowland, although up to 1,500 metres in Asia. In Africa, red-footed falcons can be found in grassland, savanna and scrubland (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 13.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Falco vespertinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATACCTACTCTTCGGAGCATGAGCAGGTATAGCTGGCACCGCCCTCAGCCTCCTCATTCGAGCAGAACTTGGCCAACCAGGAACTCTCCTGGGAGACGACCAAATCTACAATGTCATCGTCACCGCCCATGCCTTCGTAATAATCTTTTTCATAGTCATACCCATCATAATCGGAGGATTTGGAAACTGACTAGTCCCCCTTATAATTGGAGCCCCAGACATAGCATTCCCCCGCATAAACAATATAAGTTTCTGACTACTCCCCCCATCCTTCCTATTACTACTAGCATCCTCAACAGTAGAGGCCGGAGTTGGAACAGGATGAACCGTATACCCCCCCTTAGCAGGCAACCTGGCTCATGCTGGCGCCTCAGTAGATCTAGCCATCTTCTCTTTACACCTCGCAGGTGTATCTTCCATCTTAGGGGCAATCAACTTTATTACAACGGCCATTAACATAAAACCCCCTGCCCTATCACAATACCAAACTCCACTATTCGTATGATCCGTACTTATCACCGCCGTGCTCCTGCTACTCTCACTCCCAGTCCTAGCTGCCGGCATCACTATACTATTAACCGACCGAAACCTAAACACCACATTCTTTGACCCCGCTGGAGGAGGAGACCCCATCCTCTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Falco vespertinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Bragin, E., Fefelov, I., Palatitz, P., Petkov, N. & van Zyl, A.

Justification
This species is listed as Near Threatened because it is experiencing a moderately rapid population decline, owing to habitat loss and degradation. This species would qualify for uplisting to a higher threat category if evidence suggests a rapid population decline.


History
  • 2012
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List 2007 (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number 300,000-800,000 individuals, with 26,000-39,000 pairs in Europe.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Threats include destruction of suitable nest-sites when rookery trees are felled for agricultural expansion or timber(Ferguson-Lees et al. 2001; Anon. 2007) and, more significantly, the widespread use of pesticides is affecting the food supply(Ferguson-Lees et al. 2001). In Central Europe, agricultural intensification is causing habitat loss, and a decrease in extensive grassland management, especially grazing, is affecting the species' food supply (P. Palatitz in litt. 2007). From 1980 to 1999 intensive poisoning of C. frugilegus in Hungary forced the species to change its nest site selection habits, and large colonies have nearly disappeared there as a result, with only 38% of the population breeding colonially(P. Palatitz in litt. 2005). As productivity is generally greater in larger colonies, further decreases may occur. The species appears to be hunted opportunistically during migration. In October 2007, 52 birds that had been roosting at Phasouri, Cyprus, were found shot, with 46 already dead and 6 wounded (BirdLife International news [www.birdlife.org/news] 2007). Two suspects were arrested seven days later; they contested charges in court in December 2007, and a trial was scheduled for January 2008 (BirdLife International news [www.birdlife.org/news] 2007).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evidence suggests that numbers of the red-footed falcon are declining in parts of its range (2) (5). This may be the result of a number of threats including the destruction of suitable nest sites and the widespread use of pesticides which affects the falcon's food supply (5). A decline in rooks in some areas has resulted in a lack of old nests which the red-footed falcon can occupy, and illegal logging has meant the loss of important woodland sites (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
Added to Annex I of EU Birds Directive in 2004. Recent conservation measures in Hungary have shown that birds will occupy artificial colonies, meaning that this could be a useful mid-term conservation tool to stop population fragmentation (P. Palatitz in litt. 2007). The species is also included in Agro-environmental programs in Hungary. Following surveys in Bulgaria, which indicated a decline in the number of suitable breeding sites, over 100 nest boxes were constructed and installed in suitable places during 2006; however, none were used by the species in 2007(Anon. 2007). Anti-poaching patrols have been increased in the Akrotiri area of Cyprus, following the unprecedented loss of a migratory flock to hunters in October 2007 (BirdLife International news [www.birdlife.org/news] 2007). Sporadic irregular population surveys have been carried out and are implemented in Serbia, while a nation-wide census of the species was concluded in 2009, in the Ukraine (Kostenko 2009). A European Action Plan for the species has been in implementation since 2010 (Palatitz et al. 2009).

Conservation Actions Proposed
Continue to carry out regular surveys to monitor population trends. Conduct further research into the effects of changes in agriculture and land management. Change farming and land-use practices in Central Europe, through EU policy and/or national schemes. Provide more artificial colonies for the species. Prevent hunting in problem areas through law enforcement, prosecution and awareness campaigns.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

While the red-footed falcon is not yet globally threatened (1), conservation action may be required to prevent it becoming so. A complex conservation program is underway in Hungary and western Romania, which aims to increase and maintain the breeding population of the red-footed falcon in the region. It is working to achieve this through increasing the number of potential nesting sites, imposing actions to conserve rookeries and increasing public awareness (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-footed falcon

The red-footed falcon (Falco vespertinus), formerly western red-footed falcon, is a bird of prey. It belongs to the family Falconidae, the falcons. This bird is found in eastern Europe and Asia although its numbers are dwindling rapidly due to habitat loss and hunting. It is migratory, wintering in Africa. It is a regular wanderer to western Europe, and in August 2004 a red-footed falcon was found in North America for the first time on the island of Martha's Vineyard, Massachusetts.

Adult male
Adult female
Falco vespertinus – Toulouse Museum, France

The Amur falcon was formerly included herein as a subspecies but it is nowadays considered well distinct. Nonetheless, it is the present species' closest relative; their relationship to other falcons is more enigmatic. They appear morphologically somewhat intermediate between kestrels and hobbies and DNA sequence data has been unable to further resolve this question, mainly due to lack of comprehensive sampling. They might be closer to the merlin than to most other living falcons, or more generally related to this species and American falcons such as the American kestrel and the aplomado falcon.[2][3][4]

It is a medium-small, long-winged species. The adult male is all blue-grey, except for his red undertail and legs; its underwings are uniformly grey. The female has a grey back and wings, orange head and underparts, and a white face with black eye stripe and moustaches.

Young birds are brown above and buff below with dark streaks, and a face pattern like the female. Red-footed falcons are 28–34 cm (11–13½ in) in length with a wingspan of 65–75 cm (25½–29½ in). The average mass is 155 g (5.5 oz).[5]

This falcon is a colonial breeder, reusing the old nests of corvids, such as rooks. It lays two to four eggs. Its maximum lifespan is 13.25 years in the wild and 18 years in captivity.[5]

Breeding and Some Behavior[edit]

Azerbaijan Red-footed falcons were witnessed copulating several times over a week-long period and "showed a strong preference for an old magpie nest" [6] Frequent copulation was interspersed with joint inspections of the magpie nest. The morning after the aforementioned observations, the pair was again observed and they repeated their behavior. Both then defended against an attack by a lesser kestrel. On this day neither bird spent much time in the nest, but always remained perched beside it. At the end of the week the researchers revisited the nest. The behavior this time was that the female sat in the nest and the male perched outside but in the same tree. Further defensive responses to lesser kestrels were observed. The male red-footed falcon hunted for large insects and fed them to the female. Copulation then occurred. After copulation, the female returned to sit in the nest until the male fed her again. This behavior continued for several days. This pair clearly showed territorial behavior. The frequent copulations and lengthy stay of the female in the nest suggested incubation but the researchers did not check the nest.[6]

Carpathian Basin Researchers used a species distribution model for red-footed falcons. This model can play a crucial role in identifying key nesting sites for endangered species. According to the researchers, the red-footed falcon is officially listed as near-threatened, due to the drastic breeding population decline of the past decades. Red-footed falcons breed in colonies and in solitary pairs. They do not build a nest. In Hungary, the landscape scale distribution of rookeries remained stable, while the density and size of rookeries decreased and their location shifted to human settlements. Similar patterns were reported from other European countries. The reasons of rookery declines can be attributed to a large-scale persecution in the mid-80s resulting in a 90% population crash. Because of this, most potential breeding colonies for red-footed falcons disappeared, causing a decline in the number of breeding pairs. Conservation projects have established artificial nest box colonies to rectify this problem. There is little evidence of this plan's effectiveness and also little evidence on recent population trends and distribution, from Northern Serbia, where 5-10% of the total European Union population is thought to breed. The researchers' main focus was on understanding the relationship between landscape scale habitat variables and red-footed falcon presence. The researchers found that the increase of natural grasslands had a positive effect on nest site presence while the increase of broad-leaved forests negatively influenced the probability of nest site presence. Their modeling approach proved successful in describing the landscape scale habitat composition of red-footed falcon breeding sites in the modeling area. Natural grasslands have a considerable impact on the probability of nest site presence. Therefore, locating their breeding sites or creating breeding sites by providing artificial colonies with the aid of our results has additional conservation and socio-economic benefits for wildlife and human population.[7]

Serbia

Near the village Melenci (Voivodina, northern Serbia) there were 22 red-footed falcon Falco vespertinus nests in 1991 in which offspring had been successfully brought up. The contents of four nests were checked daily from the start of incubation until the fledglings left the nests. Breeding success did not differ between the group of 4 nests disturbed by inspections and the remaining 18. Despite the fact that the ratio of parent bird presence (both, only female, only male) and absence differed in the comparison of the four nests, red-footed falcon parents were usually found in the close surroundings, i.e. they attended their nest. The attendance of the birds to the nests differed between the sexes during incubation as well as hatching and the nestling period, which fact can be interpreted as a difference between the roles of females and males. In 59% of the cases it was the female, while in 41% it was the male bird that was sitting on the eggs. At the time of hatching it was mostly the female (female 86%, male 14%) that was present in the nest, while after hatching it was only the female. Later on the adult birds usually took off from the branch supporting the nest, from neighbouring trees, or from abandoned rook (Corvus frugilegus) nests, rather than from the nest itself. Females participated more times in the defence of the nest than males, yet the ratios of the studied types of behaviour (alarm, repellence, attack) did not differ between the sexes. However, significant difference appeared to be present between four nests when the distribution frequency of the three behaviour types was looked at. The distribution of the reaction types of the parent birds to disturbance was significantly different in the periods of incubation, hatching and nestling, respectively. As nesting proceeded and parental investment grew, the number of repellences and attacks increased proportionally.[8]

Serbia

The survey of population size and distribution of red-footed falcons proceeded in June–July 2000 and 2001 respectively, ten years after the first census (1990 and 1991). Data of only those nests were processed in which there was breeding. Breeding Success was calculated from the number of offspring per reproductive female. During the survey in Voivodina in 1990-1991 there were 308 and 124 pairs, respectively, whereas ten years later, in the year 2000 there were 116, and in 2001 only 61 pairs of red-footed falcons. Even if the marked fluctuations observed are not considered, the red-footed falcon population breeding in Voivodina shows a declining tendency. The south-western margin of the distribution area has moved towards the northeast by about 50-70 kilometres. More than 90% of the nesting sites, including the larger nesting colonies, are found in the Banat region, i.e. east of the Tisa River. More than 90% of the red-footed falcons continue to nest in rook colonies. No significant change has occurred in their breeding success.[9]

Dietary habits[edit]

The red-footed falcon is a bird of prey with a diet consisting of a variety of insects, amphibians, reptiles, mammals and birds, such as great green bush-crickets, spadefoot toads, sand lizards, the common vole and bird nestlings, respectively. This bird's distinctive method of hunting is shared by the common kestrel. It regularly hovers, searching the ground below, then makes a short steep dive towards the target. When feeding their nestlings, the youngest nestlings receive the most food more frequently and more regularly. Chicks that are between 0 and 3 weeks old will get fed bigger prey like toads, lizards, bird nestlings, and great green bush-crickets, while nestlings over that age will get fed less frequently and with less variety. Young nestlings's diet consists mostly of Orthoptera and Coleoptera with a little bit of Vertebrata, while older nestlings's diet mostly consists of Orthoptera and almost never receives Vertebrata.[10]

Habitat[edit]

The red-footed falcon tends to reside in typical steppe type habitats ranging from Eastern Europe to Lake Baikal in Central Asia. This is a diurnal bird of open country with some trees, often near water. They tend to migrate far south for the winter, including in areas of Africa.[11] The red-footed falcon tends not to make their own nests, but tend to use abandoned nests made by other birds such as the hooded crow, rook, and magpie. The nests that are chosen tend to be higher than the majority of the other nests; the nests tend to be 13–20 meters above the ground and within 3–4 meters of the tree top. Most of these nests tend to be near the edge of woods, avoiding nesting on solitary trees. Breeding takes place in these abandoned nests; usually breeding occurs colonially in rookeries because these birds tend to stay together in groups. This is also important because fledging success tends to be higher when these birds are in colonies and are not solitary. The red-footed falcon relies on the nests built by rooks, and with a decline in population of rooks, the number of suitable rookeries for colonial nesting has also decreased, leading humans to ideas of conservation.[12]

Threats[edit]

A major impact on the red footed falcon's population is loss and degradation of natural nest sites. Rooks and rookeries are regularly attacked, by shooting into the nests, killing birds and cutting down the trees they were living in for the wood. Pesticides are also a huge threat as they are depleting their natural food sources, making food competitive. There is also an increased mortality caused by electrocution due to the bird's habit of sitting perched on power lines. From 1980 to 1999 intensive poisoning of C. frugilegus in Hungary forced the species to change its nest site selection habits, and large colonies have nearly disappeared there as a result, with only 38% of the population breeding colonially. As productivity is generally greater in larger colonies, further decreases may occur. The species appears to be hunted opportunistically during migration.

Conservation[edit]

The total population of Falco vespertinus around the world is estimated to be between 26,000 to 39,000 pairs. Most of the population breeds in the steppe grasslands of Russia and central Asia, although a significant amount also breeds in the Ukraine, Romania and Hungary. In 2005, the population in Hungary was estimated to be between 700 to 800, showing a steady decline.[13] Red-footed falcons can be considered as a classic umbrella species because they affect other species living in the community. They play a popular role in the Natura 2000 designation process.[14] Therefore, locating their breeding sites or creating breeding sites by providing artificial colonies has additional conservation and socio-economic benefits for both wildlife and the local human population.[15]

Conservation of Falco vespertinus in the Pannonian Region[edit]

A conservation program, which was funded by the EU's LIFE Nature financial instrument, was initiated on January 1, 2006 with the goal of increasing and maintaining the breeding population of the species in Hungary and western Romania.[16] This conservation project developed a method to create more nesting sites by creating artificial nest box colonies.[15] It's pretty common for the birds to be preyed upon by martens or other mammalian predators during incubation or during the nestling state, even in the artificial colonies. Some extreme cases show that the predators may threaten the existence of every clutch in the colony. They are using many methods to repel or trap potential predators in order to avoid predation. Some of those methods are listed in this section.[16] There are many known threatening factors and the program takes active conservation measures against them. Some of these factors include being electrocuted by electric pylons so the program locates and insulates the exposed cables. Roadside trees are a common nesting site for ralcons because they are also home to corvids. Previously, only safety aspects were considered in the management of these nesting facilities. Therefore the project will submit a conservation based management plan to the correct authorities. One of the reasons of red-footed falcon decline is the collapse of the rook population due to drastic pest control measures. Based on previous experience and information from stakeholders, a draft "corvus management plan" will be prepared to handle the conflict situations caused by rooks.[16]

Future conservation efforts proposed include continuing to conduct regular surveys throughout the area. Figuring out additional ways to help the species is crucial. Red-footed falcons are known to use artificial colonies, therefore, they can be a useful mid-term conservation tool to prevent their population from fragmenting. Also, there may be ways to help out the species by changing farming and land-use practices in Central Europe. Surveys in Bulgaria indicated that there is a decline in available breeding sites for the birds.[17]

References[edit]

  1. ^ BirdLife International (2013). "Falco vespertinus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Wink, Michael; Seibold, I.; Lotfikhah, F. & Bednarek, W. (1998): Molecular systematics of holarctic raptors (Order Falconiformes). In: Chancellor, R.D., Meyburg, B.-U. & Ferrero, J.J. (eds.): Holarctic Birds of Prey: 29–48. Adenex & WWGBP.
  3. ^ Griffiths, Carole S. (1999). "Phylogeny of the Falconidae inferred from molecular and morphological data". Auk 116 (1): 116–130. doi:10.2307/4089459. 
  4. ^ Griffiths, Carole S.; Barrowclough, George F.; Groth, Jeff G. & Mertz, Lisa (2004). "Phylogeny of the Falconidae (Aves): a comparison of the efficacy of morphological, mitochondrial, and nuclear data". Molecular Phylogenetics and Evolution 32 (1): 101–9. doi:10.1016/j.ympev.2003.11.019. PMID 15186800. 
  5. ^ a b Wasser, D. E.; Sherman, P.W. (2010). "Avian longevities and their interpretation under evolutionary theories of senescence". Journal of Zoology 280 (2): 103–155. doi:10.1111/j.1469-7998.2009.00671.x. 
  6. ^ a b Heiss, Michael (2011). "The first breeding record of the Red-footed Falcon, Falco vespertinus (Linnaeus, 1766), in Azerbaijan". Zoology in the Middle East 52 (1): 113–15. doi:10.1080/09397140.2011.10638486. 
  7. ^ Harnos, A (2012). "Allocating active conservation measures using species distribution models: a case study of red-footed falcon breeding site management in the Carpathian Basin". Animal Conservation 15 (6): 648–57.
  8. ^ Purger, J.J. (2001). "Defence behaviour of Red-footed Falcons Falco vespertinus in the breeding period and the effects of disturbance on breeding success". Ornis Fennica 78 (1): 13–21.
  9. ^ Purger, J.J. (2008). "Numbers and distribution of Red-footed Falcons (Falco vespertinus) breeding in Voivodina (northern Serbia): a comparison between 1990-1991 and 2000-2001". Belgian Journal of Zoology 138 (1): 3–7.
  10. ^ Purger, J.J. "Diet of Red-footed Falcon Falco vespertinus nestlings from hatching to fledging". Retrieved 17 October 2013. 
  11. ^ Fehervari, Peter; A. Harnos; D. Neidert; P. Palatitz; SZ. Solt (2008). Modeling Habitat Selection of the Red-Footed Falcon (Falco vespertinus): A Possible Explanation of Recent Changes in Breeding Range Within Hungary. pp. 1–14. Retrieved 17 October 2013. 
  12. ^ Purger, J.J; Andreja Tepavcevic (1999). "Pattern analysis of red-footed falcon (Falco vespertinus) nests in the rook (Corvus frugilegus) colony near Torda (Voivodina, Yugoslavia), using fuzzy correspondences and entropy". Ecological Modelling: 91–97. Retrieved 17 October 2013. 
  13. ^ "Conservation of Falco vespertinus in the Pannonian Region LIFE05 NAT/H/ 000122". 
  14. ^ "Natura 2000". 
  15. ^ a b Fehérvári, P.; Solt, S.; Palatitz, P.; Barna, K.; Ágoston, A.; Gergely, J.; Nagy, A.; Nagy, K.; Harnos, A.; Altwegg, Res; Penteriani, Vincenzo (1 December 2012). "Allocating active conservation measures using species distribution models: a case study of red-footed falcon breeding site management in the Carpathian Basin". Animal Conservation 15 (6): 648–657. doi:10.1111/j.1469-1795.2012.00559.x. 
  16. ^ a b c "Conservation of Falco vespertinus in the Pannonian Region LIFE05 NAT/H/ 000122". 
  17. ^ "www.iucnredlist.org". IUCN Red List of Threatened Species. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!