Articles on this page are available in 1 other language: Chinese (Simplified) (1) (learn more)

Overview

Brief Summary

Biology

Travelling in loose flocks of hundreds of birds, this sociable species will also roost together in trees, but migrate singly or in flocks of less than 50, at altitudes of around 2000 m. The lesser kestrel's flapping flight is shallow and rapid and is more conspicuous to prey than the subtle gliding flight that is more normally used. Hunting, usually for small mammals, makes excellent use of the lesser kestrel's powerful eyesight, sharp claws and strong beak. It dives almost silently from a perch or from mid air and pounces on prey with the claws, before swiftly killing its prey with a bite to the back of the head (2). Breeding takes place between March and May, and eggs are laid, not in nests, but in scraped out depressions in trees. Again, lesser kestrels nest as colonies and pairs will display to each other to strengthen the pair bond. The female invests more time than the male in incubating the four to six eggs she lays, and rearing the chicks when they hatch after 28 – 31 days, but the male will contribute by fighting to defend their territory. The chicks hatch over several days and so the last to hatch is smaller than the others. This individual is most likely to die as it cannot compete effectively for food, and when food is particularly scarce it may be killed and eaten by its siblings. The chicks are fed for two to four weeks, and then must learn to hunt for themselves (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The lesser kestrel is a small kestrel with long pointed wings and a long tail marked with a black band at the end. Males and females are distinguishable by colouring. Males have a pale brown back and blue-grey feathers on the crown, rump, neck and tail. The belly is creamy pink with small brown streaks. In females, the back and head are mid brown and the belly is pale. Both back and belly are streaked with brown. Males and females have white undersides to their wings, with black tips (2). The eye ring is bright yellow and the feet are yellow to orange. The ankles and feet lack feathers (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Falco naumanni breeds in Spain, Portugal, Gibraltar (to UK), France, Italy, Bosnia-Herzegovina, FYRO Macedonia, Albania, Greece, Turkey, Morocco, Algeria, Tunisia, Libya, Israel, Palestinian Authority Territories, Jordan, Iran, Iraq, Armenia, Azerbaijan, Georgia, Russia, Ukraine, Afghanistan, Turkmenistan, Uzbekistan, Kazakhstan, China and Mongolia. Birds winter in southern Spain, southern Turkey, Malta and across much of Africa, particularly South Africa. The European population is estimated at 25,000-42,000 pairs, with half of these in Spain. Several thousand pairs breed outside this range, principally in central Asia. Western Palearctic populations have undergone serious declines, although a few have begun to increase again. The western European population has declined by c.95% since 1950, and the species has disappeared from the Ural region of Russia and from northern Kazakhstan, as well as from the western and central parts of the Balkan Peninsula (Davygora 1998, B. Barov in litt. 2007). However, some populations in south-western and central Europe are stable or increasing (Iigo and Barov 2010) and eastern breeding populations are also reported to be stable (Galushin 2009). Italy has seen a marked population increase and range expansion since 2000 (N. Baccetti in litt. 2010), and the population in Andaluca, Spain, has increased from c.2,100 pairs in 1988 to c.4,800 in 2009 (J. R. Garrido in litt. 2011). In Kazakhstan, the species appears to be stable or increasing slightly, perhaps in association with the abandonment of villages and livestock stations in the 1990s (J. Kamp in litt. 2010). Coordinated counts of the South African wintering population recorded 117,000 birds in 2005/2006 (van Zyl 2007, A. van Zyl in litt. 2007) and 98,000 birds in 2006/2007 (A. van Zyl in litt. 2007), but it is not clear whether this represents a genuine reduction in numbers or whether the missing birds were wintering elsewhere, most likely in East Africa (A. van Zyl in litt. 2007). An enormous roost discovered in January 2007 in Senegal contained over 28,600 individuals (most likely European/North African breeders).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The lesser kestrel breeds in the palearctic in Europe and northern Asia roughly between 30 and 50 degrees North latitude. The distribution includes altitudes of up to 500m above sea level. It is a migratory species, spending its winter in Africa, south of the Sahara. From February to April this bird is most numerous in northern Tanzania and southern Kenya.

Biogeographic Regions: palearctic (Native ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Mediterranean basin to e China; winters to s Asia and s Africa.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Found in Europe and northern Asia between latitudes of 30 and 50 º N at up to 500 m above sea level. This species is migratory, moving to sub-Saharan Africa during the winter, and congregating most abundantly in northern Tanzania and southern Kenya (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

This small falcon has a length of 30-36 cm with long pointed wings. The long tail has a broad black terminal band. This falcon has strong sexual dimorphism in its plumage. Males have a chestnut back and a blue-grey crown, neck, rump, and tail. Their belly is a creamy pink with small brown streaks. The eye ring is bright yellow while the feet are an orange-yellow. The undersides of the wings are white with a black tip. Females have a brown back and head with a pale belly. Both the back and belly are streaked with brown. The wings are also light with dark barring and black tips. Juvenile lesser kestrels look similar to the females.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is usually a colonial breeder, often in the vicinity of human settlements. It forages in steppe-like habitats, natural and managed grasslands, and non-intensive cultivation. It is mainly migratory, with most breeders overwintering in sub-Saharan Africa, although some travel to parts of north-west Africa, southern Europe and southern Asia. Migrants leave their breeding grounds in September and return between February and April (del Hoyo et al. 1994). It migrates in flocks of varying sizes, usually tens to low hundreds, often with other falcons such as F. tinnunculus, F. vespertinus and F. amurensis (Ferguson-Lees and Christie 2001). Large numbers, sometimes up to thousands, gather at roosts on migration (del Hoyo et al. 1994). They cross water bodies readily on a broad front, flying high enough to be barely detectable; they fly lower over land (often c.20-30 m), particularly on northward migration (Brown et al. 1982, Ferguson-Lees and Christie 2001).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lesser kestrels are found in bushed, wooded, and open grassland and cultivation. They nest on mountain slopes, gorges, deep ravines, and other rocky terrain, all of which must have open areas around them for the birds to hunt. They are found most numerously in highland farming regions and on grassy plains during the winter range.

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

An inhabitant of highland farming regions and grassy plains in the winter range, the lesser kestrel prefers open or wooded grassland and cultivated areas during the summer breeding season. It nests in areas with mountain slopes, gorges and deep ravines surrounded by open areas for hunting (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Kestrels are carnivorous, feeding on small mammals, especially voles, however they are very adaptable to other prey selections. They will eat almost anything they can kill. Their selected prey is either the most abundant or most easily caught of the area. Other prey examples are young rabbits, birds, small bats, lizards, snakes, frogs, insects, earthworms, fish, and crabs. Kestrels can change their hunting style depending on the kind of prey, weather conditions, and their energy requirements. These predators take full advantage of their keen eyesight, sharp claws, and strong beak. They hunt from a perch or from the air. The vertebrate prey is pounced on from a rapid dive, then grabbed by the claws and killed by a bite to the base of the skull. Attacks on less active prey results from slow shallow dives where the kestrel lands and takes the prey directly into its beak.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
6.2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.9 years (wild) Observations: Oldest bird in banding studies was 10.9 years of age (http://www.euring.org/data_and_codes/longevity.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding occurs during the months of March through June. Kestrels do not build nests. Instead they lay their eggs in a depression they scrape in the trees of the nesting location. They breed in colonies of up to 100 pairs. Females invest more time in nesting activities than males. Kestrels have a normal clutch size of 4 to 6, laid over a two day interval, but the range in number of eggs is 1 to 7. Incubation starts after the third egg is laid and lasts 28 to 31 days. Because incubation is delayed until the after the third egg, the first three eggs usually hatch on the same day with the rest following in the next couple of days. This means the last bird hatched is smaller than the rest. The difference in size allows the brood to be reduced by sibling rivalry if sources of food are short. Kestrel nestlings have been seen to kill and eat brood-mates, but most deaths occur because of failure to compete for food. Parents continue to feed their young for 2 to 4 weeks after hatching.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Falco naumanni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CAAAGACATTGGCACCTTGTACCTACTCTTCGGAGCATGGGCAGGCATAGCCGGCACCGCCCTCAGCCTCCTTATTCGGGCAGAACTTGGTCAACCAGGGACCCTCTTGGGAGACGACCAAATCTACAATGTTATTGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATACCCATCATAATCGGAGGATTTGGAAACTGACTAGTCCCCCTTATAATTGGAGCCCCAGACATAGCATTCCCCCGCATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTATTGCTCCTAGCATCTTCCACAGTAGAAGCCGGAGTCGGAACAGGGTGAACCGTATACCCCCCTCTAGCAGGCAACTTAGCCCATGCTGGCGCCTCAGTAGATCTAGCCATCTTCTCCTTACACCTCGCAGGTGTATCCTCCATCCTAGGGGCAATCAACTTTATCACAACAGCCATTAACATAAAACCCCCTACCCTATCACAATACCAAACTCCACTATTCGTGTGATCCGTACTCATCACCGCCGTGCTCCTGCTACTCTCACTTCCAGTCCTAGCCGCCGGCATCACCATACTACTGACCGACCGAAACCTGAACACCACATTCTTCGACCCCGCCGGAGGAGGGGACCCCATTCTCTACCAGCACTTATTCTGATTCTTTGGTCACCCAGAAGTCTACATCCTAATCCTCCCAGGATTTGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Falco naumanni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Baccetti, N., Biber, J., Garrido, J., Kamp, J. & van Zyl, A.

Justification
This species underwent rapid declines in western Europe, equivalent to c.46% in each decade since 1950, on its wintering grounds in South Africa, equivalent to c.25% in each decade since 1971, and possibly in parts of its Asian range; however, recent evidence indicates a stable or slightly positive population trend overall during the last three generations. Consequently it has been downlisted from Vulnerable and now qualifies as Least Concern because it no longer approaches any of the thresholds for Vulnerable under the IUCN criteria.


History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Threatened (T)