Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Falco cenchroides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CGGTACCGCCCTCAGCCTCCTTATCCGAGCAGAACTTGGCCAACCRGGAACTCTCCTAGGAGACGACCAAATCTATAATGTCATCGTCACCGCCCATGCCTTCGTAATAATCTTCTTCATAGTTATACCCATCATAATCGGAGGGTTTGGAAACTGACTAGTCCCTCTTATAATTGGAGCTCCCGACATAGCATTCCCCCGCATAAACAACATAAGCTTCTGACTACTTCCTCCATCCTTCCTACTACTCCTAGCATCCTCCACAGTAGAAGCCGGAGCCGGAACAGGATGAACTGTATACCCCCCTCTAGCGGGCAACCTAGCCCATGCTGGTGCCTCAGTAGATCTGGCCATCTTCTCCCTACACCTTGCAGGTGTATCCTCCATCCTAGGAGCAATCAACTTTATCACAACAGCTATTAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCACTATTCGTATGATCCGTACTCATCACCGCCGTACTCCTACTGCTCTCACTCCCAGTCCTAGCTGCTGGCATCACCATATTACTAACCGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCCATTCTCTACCAGCACTTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATTCTCCCAGGATKTGGAATTATCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Falco cenchroides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nankeen Kestrel

The Australian Kestrel or Nankeen Kestrel (Falco cenchroides) is one of the smallest falcons, and unlike many, does not rely on speed to catch its prey. Instead, it simply perches in an exposed position, but it also has a distinctive technique of hovering over crop and grasslands. This bird is thought to be a very close relative of the Common Kestrel, and probably also the Spotted Kestrel. It seems to have evolved of ancestral Common Kestrels dispersing to the Australian region in the Middle Pleistocene—less than 1 million years ago—and adapting to local conditions.[2]

About to pounce

A very common and easily seen raptor, the Nankeen Kestrel is found in Australia, New Guinea, and nearby islands, and is an irregular visitor to New Zealand. It occupies any type of land that is not too densely vegetated, but in particular temperate grasslands and open woodlands. In the tropical north and the sandy deserts of the west, it has a patchy and seasonal distribution.

Like many Australian birds, it has no clear migratory pattern: in the grasslands of the south, established pairs are resident year round, but many other birds migrate north during the austral winter, or roam the arid interior following food supplies.

With kill in talons, Rottnest Island, Western Australia

A small, slim falcon (about 31 to 35 centimetres or 12 to 14 inches long), the Nankeen Kestrel is rufous or brown above and white or off-white below, with a black tail tip. Plumage varies considerably in detail, and some birds can look very scruffy, but the slim build, small size and distinctive straight-winged hovering habit make identification easy. It can be seen in Western Australia on coastal cliffs and windy conditions. Also seen on phone lines and power lines. (The only other Australasian raptors to hover are the elanid kites which are much lighter in colour and a little larger, and the Brown Falcon, which is much larger and more heavily built, and hovers only with difficulty). Altogether, it looks just like a pale, less patterned, and smaller derivate of the Common Kestrel, which it indeed is (see Gloger's Rule, Bergmann's Rule).

Nankeen Kestrel in flight

Diet is varied, with a large number of insects, but also small birds and reptiles, and in particular, small rodents, mostly mice. Nankeen Kestrels are adaptable and hunt in a number of different ways: of these, simply perching in an exposed position (such as on a dead tree or a telephone pole) and watching for prey is the most common, but it is their habit of hovering motionless over crop and grasslands that is most distinctive.

Female

Typically seen singly or in pairs, they can aggregate into loose flocks of up to 30 when conditions are right. Pairs are typically monogamous and may or may not disperse to different areas during the non-breeding season. The nest is any convenient structure: a tree hollow, cliff ledge or disused corvid's nest, for example, and is not modified or added to by the kestrels.

Three to seven eggs are laid in late winter (usually about four) and incubated by the female alone. Hatching takes place after 26 to 28 days, and the male brings food while the female continues to incubate until the young are close to fledging, at which time the female leaves the nest to hunt for them too. Multiple broods are raised in good seasons.

References

  1. ^ BirdLife International (2012). "Falco cenchroides". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Groombridge, Jim J; Jones, Carl G; Bayes, Michelle K; van Zyl, Anthony J; Carrillo, José; Nichols, Richard A; Bruford, Michael W (October 2002). "A molecular phylogeny of African kestrels with reference to divergence across the Indian Ocean". Molecular Phylogenetics and Evolution 25 (2): 267–277. doi:10.1016/S1055-7903(02)00254-3. PMID 12414309. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!