Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Brief Summary

Biology

Male red grouse mark out their territories with an energetic display during which they leap into the air, giving their characteristic 'go-back-go-back' call. They compete for an area of moor with plenty of heather and bilberry bushes in which the female will produce a nest scrape for her eggs. These eggs are well camouflaged, laid in April and may number ten or more. The chicks hatch after about three weeks, and are fed by both birds for six weeks. They can fly after 13 days. Red grouse have been a quarry species for years, but the sport only became a source of lucrative business when the breech-loading gun was invented in the mid 19th century, and the railways provided access to the moors. The 'Glorious twelfth' of August, the opening of the grouse-shooting season, was apparently chosen to fit in with the parliamentary summer recess, as well as the birds' breeding season.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The red grouse Lagopus lagopus scoticus is the British race of the willow grouse (Lagopus l. lagopus), although it was once believed that the red grouse was a distinct species known as Lagopus scoticus, endemic to the British Isles. Red grouse are dumpy birds, predominantly rufous-red in colour with a low whirring flight punctuated with glides. Like all grouse, they have feathered legs, feet and toes. The males have red eyebrow wattles that are not visible at a distance, and are darker than those of the females. The call is very distinctive and consists of a series of guttural barks, accelerating to a sort of deep trill, often ending with a sound resembling “go-back-go-back-go-back”.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Lagopus lagopus, commonly known as willow ptarmigan, is found within North America in northern Alaska, Victoria Island, Melville Island, Banks Island, Boothia Peninsula, Southampton Island, Baffin Island, South-Eastern Alaska, central British Columbia, Alberta, Saskatchewan, Manitoba, central Ontario and Quebec and Newfoundland. They are also found in Greenland, the United Kingdom, Europe, Russia, Scandinavia and northern Mongolia. Most willow ptarmigan migrate between their winter habitat and breeding range. Although their breeding range is typically lower in both latitude and elevation than their wintering range, most willow ptarmigan inhabiting North American, European and Scandinavian regions stay within a 100 km radius of their summer habitat. It has also been observed in Alaska and British Columbia that males and females of the species often occupy different geographic regions during the winter, with the females migrating to more southerly latitudes than the males.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Circumpolar. Alaska, northern Canada (north to low arctic islands), northern Europe, and northern Asia. In North America may wander irregularly south, during the winter, to Michigan, Wisconsin, casually to Montana, North Dakota, and Maine.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Red grouse are found in north western parts of upland England, Wales, Scotland and Ireland. The related willow grouse ranges throughout the northern boreal forests, in Scandinavia, Finland, Karelia and northern Russia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Willow ptarmigan have chunky bodies, ranging from 28 to 43 cm long, and weighing and average of 0.57 kg. They have short legs with feathered toes, a feature that enables them to navigate through loose snow. They have short tails (with an average of 118 mm or more for males and 116 mm or less for females) and wings (when folded, an average of 190 mm or more for males and 190 mm or less for females).

Willow ptarmigan molt seasonally. Their winter plumage is usually complete by November, depending on the geographic region of the population. It consists of white feathers covering the entire body except the tail, which remains black. However, the tail is often covered by other feathers on the body, making the bird appear completely white. When the spring arrives, the females’ plumage becomes a mottled brown and ochre, while the males have a rusty hazel or chestnut coloring with darker brown barring on the entire body except for the wings and tail. They also have red “combs” on their eyes which are generally more visible during the warmer months. During the fall, the plumage of both male and female willow ptarmigan becomes lighter, with the females’ plumage becoming more gray and white. The males keep the dark barring pattern but take on more ochre tones.

Red grouse populations of Scotland and Ireland do not develop the same white winter plumage as willow ptarmigan populations living in more northerly areas of Europe and North America (which are covered by snow for much of the year). Instead, they retain a plumage that is predominantly dark reddish-brown. This is likely due to the fact that populations in Ireland and Scotland are exposed to a milder maritime climate than populations living inland and further north. Some studies have also found that there is a possible trade off between white winter camouflage and the thermal benefits of keeping a darker plumage for better heat absorption. However, it has also been found that white plumage has physical characteristics that allow for slightly better insulation. For this reason, more studies must be done to determine whether or not white plumage is thermally disadvantageous.

Range mass: 430 to 810 g.

Average mass: 570 g.

Range length: 280 to 432 mm.

Average wingspan: 61 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 38 cm

Weight: 601 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Willow ptarmigan inhabit primarily subalpine and subarctic zones. During the summer, they can be found in areas where lush vegetation and a moist environment are present, including arctic valleys, treeline areas, marshy tundra and coastal regions. In Alaska and northern Canada, they are commonly found in areas containing patches of dense vegetation, especially those in which willow (Salix species) or birch (Betula species) shrubs are present. As cooler weather approaches, willow ptarmigan seek more protected areas. This often involves moving further into valleys or more densely vegetated areas within their breeding zone. It has also been observed that during the winter, females and juveniles tend to move into boreal forests in some areas, while the males remain in a subalpine habitat.

Red grouse, Lagopus lagopus scotica, is a subspecies that inhabits Scotland and Ireland. Scottish and Irish populations of red grouse inhabit areas in which heather is readily available. This plant is not only required for shelter and nesting, but also provides a valuable source of food to the population, as it is rich in phosphorus and nitrogen. Although the general area they inhabit is referred to as 'heather moorland', this category can be further broken down into five groups based on specific characteristics of the heather present in that area: dry heath, wet heath, degraded heather, blanket bog and rough moorland grazing. Scottish and Irish red grouse populations generally inhabit areas 150 m above sea level; however, populations have been found to live around sea level and inhabit lowland blanket bogs in northwest Ireland.

Range elevation: 600 to 1980 m.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Open alpine and arctic tundra, especially in areas heavily vegetated with grasses, mosses, herbs and shrubs, less frequently in openings in boreal coniferous forest (AOU 1983). Common especially in thickets of willow and alder (National Geographic Society 1983). Nests on the ground, on tundra, beaches, or near marshes (Terres 1980). The nest is a scrape lined with grasses, moss, and feathers, usually located near a bush or tuft of grass.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Willow grouse are birds of the northern pine and birch forests, heather tundra and mountain slopes. Red grouse are found on open moorland, preferably with heather, and no woodland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Mainly permanent resident but somewhat migratory (Godfrey 1966). During winter may descend to intermontane lowlands; may migrate to areas south of treeline; males tend to remain in alpine fringe habitats or on arctic tundra, females tend to move into forested areas (see Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Willow ptarmigan generally maintain diets that contains 13 to 18% protein, 10 to 20% fiber, 5 to 10% lipids and up to 50% carbohydrates. However, during the winter their diets consist of less protein, but is much more abundant in fiber and carbohydrates. During the summer months, willow ptarmigan consume a variety of different foods, including willow (Salix species) buds, grass shoots, flowers, seeds, berries (including Vaccinium angustifolium, Vaccinium oxycoccos, Vaccinium vitis-idaea and Empetrum nigrum), insects, caterpillars and beetles. As winter approaches and the availability of insects and caterpillars decreases, the amount of berries, seeds and buds consumed increases. During the winter, food is often more difficult to find and willow ptarmigan must dig through the snow to find sustenance. Their winter diet is composed mainly of willow buds and twigs, as well as some birch (Betula species). Up to 94% of the winter diet may come from willow, with up to 80% being from a single Salix species. The adaptation of digestive enzymes and intestinal microflora to provide nutrition and energy from a single food source is unusual; however, studies suggest that willow ptarmigan are well adapted for obtaining nutrition and energy from a variety of different diets, and that although willow is a primary food source, the species is capable of deriving their nutrition from other sources.

Contrary to North American willow ptarmigan populations, Scotland's red grouse population (a subspecies of willow ptarmigan) has a diet consisting of mainly heather. This accounts for 95% of their diet during fall and midwinter months, falling to 90% with the approach of spring. During this time, the increased availability of Erica tetralix and Erica cinerea make up the remaining 10% of the diet. It has also been found that during nesting season, red grouse tend to select for heather rich in nitrogen and phosphorus.

There are typically two peak feeding times for willow ptarmigan during the winter months. During the morning, feeding occurs for approximately 2 hours, with the same time period being followed for evening feeding. It has been observed that as the daylight hours increase, feeding time also increases.

Willow ptarmigan chicks consume mainly caterpillars, insects, flowers and seeds, largely due to their need for a diet high in protein in order to facilitate extremely fast growth. Willow ptarmigan usually feed in flocks. The size of the flock generally increases or decreases depending on the availability and amount of food present.

Animal Foods: insects

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers; bryophytes

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Summer diet consists of leaves and flower buds of willows, alders, and birches; fruits of blueberry, cranberry, crowberry; insects. Winter diet mainly catkins and buds of trees and bushes (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / dung saprobe
apothecium of Ascobolus carletonii is saprobic in/on dung or excretions of dung of Lagopus lagopus

Animal / dung saprobe
densely crowded apothecium of Ryparobius brunneus is saprobic in/on dung or excretions of dung of Lagopus lagopus

Animal / dung saprobe
apothecium of Ryparobius dubius var. lagopi is saprobic in/on dung or excretions of dung of Lagopus lagopus

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Willow ptarmigan are predators of various insect and beetle species. They may be infected with flukes (Trematoda species), tapeworms (Cestoda species), roundworms (Nematoda species) and ectoparasites. Many parasites are thought to decrease the body weight of willow ptarmigan, which can lead to death if the weight loss is severe enough. Although this has not been formally observed in North America, populations of red grouse in Scotland have experienced significant decline due to body parasites.

As well as being a predator to many invertebrates, willow ptarmigan are also prey to a number of larger bird and mammal species, including hooded crows, ravens, magpies, red foxes, gyrfalcons, wolverines, wolves and Arctic foxes.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Willow ptarmigan have many known predators, many of which prey solely on eggs or willow ptarmigan chicks. It has been observed that predation on willow ptarmigan nests is much more common by avian predators than by mammalian predators.

In response to predators, willow ptarmigan will often freeze in a crouching position with their heads lowered and extended. They may perform a diversionary walk to distract predators from the nest or their mate, and may also feign injury by moving slowly along the ground while quivering their wings. This movement makes the ptarmigan appear as though it is dragging itself.

One of the most important anti-predator adaptations of willow ptarmigan is plumage that seasonally changes with the environment. As the snow melts and the surroundings change color, moulting from white to mottled brown occurs very quickly to ensure optimal camouflage. The same pattern is followed for each seasonal change, with the plumage rapidly changing to match the environment. It has also been observed that female willow ptarmigan will choose feeding areas in which they will be better camouflaged rather than ones that offer better nutritional benefits.

Several known predators of North American willow ptarmigan populations include: hooded crows, ravens, magpies, red foxes, pine martens, mink, short-tailed weasels, least weasels, gulls, northern harriers, golden eagles, bald eagles, rough-legged hawks, gyrfalcons, peregrine falcons, northern goshawks, snowy owls, wolverine, wolves, Arctic foxes, lynx and polar bears.

Known predators of Scottish red grouse populations include: red foxes, wildcats, golden eagles, hen-harriers, sparrow-hawks and common buzzards and rough-legged buzzards. Merlins and short-eared owls have been known to kill young red grouse (up to the age of about 8 weeks) however, they are not important predators for adult red grouse.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Family group stays together until late fall; may join other groups and form winter flocks. Cycles of low/high population fluctuations occur but not well understood (Terres 1980). Female breeding territory averaged 2.5-3 ha in British Columbia. Male breeding territories ranged from 1-8 hectares in British Columbia; polygynous males had territories averaging 5.3 hectares, monogamous males had territories averaging 3.9 hectares, and unmated males had territories averaging 2.9 hectares (Hannon and Dobush 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Several different communication sounds have been observed in willow ptarmigan and at least 11 different calls have been observed. Both sexes have territorial calls that are similar. However, ‘flight-song’, ‘rattle’, ‘kohwa’ and ‘aroo’ are only heard in males. ‘Koks’, ‘ko-ko-ko’ and ‘krrow’ sounds are heard in both males and females during threat, mating or territorial situations. These sounds may also be used to stay in contact with a mate or offspring. Females will ‘purr’ or ‘moan’ to communicate with their chicks. Both sexes will ‘hiss’ or ‘moan’ in defense of their offspring or mates. Males give calls that are noticeably stronger and more modulated than females' calls. Like all birds, willow ptarmigan perceive their environments through auditory, visual, tactile and chemical stimuli.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Willow ptarmigan have an extremely high population turnover, with an annual mortality rate of 60% to 72%. This high mortality rate means there is significantly less competition for territory during breeding seasons than in other species. The primary cause of death in willow ptarmigan populations is predation, whereas death due to weather conditions or food shortage is rarely observed. However, it has been observed that in Scottish willow ptarmigan (red grouse) populations, hens’ access to sprouting vegetation noticeably influences the viability of chicks. Chick weight and egg size also play a role in the survival of Scottish willow ptarmigan chicks both in captivity and in the wild. The longest survival record of a male specimen is 9 years, and the longest survival recorded for a female is 8 years (both recorded in British Colombia). These survival records are based on banded birds returning to breeding areas.

Willow ptarmigan, like many Arctic species, undergo cyclical population fluctuations, with peaks every 9 to 10 years. It is thought that weather conditions and therefore the availability and quality of food may contribute to these fluctuations.

Range lifespan

Status: wild:
9 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9 years (wild) Observations: In the wild, animal rarely live more than 4 years (John Terres 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Territorial establishment of the male willow ptarmigan occurs during early spring, with the males arriving about 2 weeks before the females. During the period of territorial establishment, males become intolerant of other males establishing territory. Breeding territories are usually smaller when the population is larger. Polygynous males also have larger territories than monogamous males.

There have been many different documented courtship displays by willow ptarmigan. Some of these include Tail-Fanning, Waltzing, Rapid-Stamping, Bowing and Head-Wagging. Most of these behaviors are displayed by the males of the species. When Tail-Fanning occurs, the male cocks his tail, sometimes fanning it, and lowers his wings to scrape the ground as he approaches a female. This behavior may lead into Waltzing, in which the male drapes his wings around the female and slowly circles her using short, high steps. He may also tilt his tail and angle his body towards her. Rapid-Stamping occurs when the male runs toward the female while slightly fanning his tail, arching his neck and holding his head low with the beak open. Bowing is a display in which the male raises and lowers his head while holding his body low to the ground. Head-Wagging can be performed by males or females. One member of the mating pair will crouch by its mate, while wagging its extended head side to side. This display is usually performed alternately. Females may also show submissive behavior, after which mating usually occurs.

Male willow ptarmigan develop nuptial plumage during April or May. This is a key visual signal for female attraction. The nuptial plumage is predominantly bright brown and white, and the supraorbital comb also becomes more prominent. Females are generally more attracted to males with larger territories, combs and more vigorous courtship displays. However, females may leave the territory if the display is too aggressive. Mating usually occurs after the female displays a submissive posture.

Male willow ptarmigan are usually monogamous within a season. Approximately 83 to 86% of pairs will remate the following year if both members of the mating pair survive. However, 5 to 20% of male willow ptarmigan are polygynous (mating with more than one female), and usually have larger territories than unpaired or monogamous males. Few female willow ptarmigan are polygynous. This is possibly due to the higher predation on nests of polygynous females. Monogamous females are accompanied by their mate for around 94% of their active diurnal period, which contributes to the slightly higher survival rate of monogamous females’ broods over broods of polygynous females. It has been suggested that most willow ptarmigan are generally not polygynous because hens are capable of preventing other females from settling with their mate.

Mating System: monogamous ; polygynous

Willow ptarmigans mate seasonally during the spring and summer. After mating, the ptarmigan pair excavates a bowl-shaped nest in the ground. These bowl nests are often sheltered from most sides, but one side of the nest is usually left unprotected as a means of escape. They are usually lined with leaves, grass and feathers, and range from 15 to 20 cm wide and 8 to 16 cm deep. Willow ptarmigan generally lay between 4 and 14 eggs which are usually incubated for 20 to 23 days in late June to early July. When a developed chick is ready to hatch and makes the first cracks on it's eggshell (also known as 'pipping'), eggs usually hatch within a few hours. Hatching occurs during daylight hours. Willow ptarmigan hatchlings are precocial and usually weight about 15 g. They grow extremely fast and leave the nest to feed the same day they hatch. They no longer rely on their parents for warmth after 7 to 10 days, and are able to fly within 10 to 12 days. Chicks are usually adult-sized by autumn and are able to fend for themselves by this time (about 5 to 7 months of age). Both male and female willow ptarmigan are capable of breeding as yearlings however, not all yearling males will acquire territory or a mate.

Breeding interval: Willow ptarmigan breed once a year.

Breeding season: Mating occurs during the spring and summer months.

Range eggs per season: 4 to 14.

Range time to hatching: 20 to 23 days.

Average birth mass: 15 g.

Range fledging age: 10 to 12 days.

Range time to independence: 5 to 7 months.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Willow ptarmigan are the only members of the grouse family in which males exhibit significant parental care. A male willow ptarmigan stays by the nest to defend his clutch and female during the incubation period, and will defend the brood until the chicks are independent (around autumn). Females usually brood the chicks however, lone males are capable of successfully raising chicks. It has also been observed that parents and replacement males may adopt unrelated chicks. A study in which male mates were removed from the territory after incubation had begun showed that 50% of the previously unpaired males and 5% of the paired males joined the widows to give care to and defend the chicks. Observations show that replacement males are generally younger, more vocal and sit closer to the nest than parental males. Possible motivations for unpaired males to adopt unrelated chicks include the possibility of mating with the female should the first brood be unsuccessful and gaining mating experience in order to attract a mate in subsequent breeding seasons.

Parental Investment: precocial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding begins in mid-May in south to early June in north; in northern Canada, date of clutch initiation apparently is related to timing of snow melt (Hannon et al. 1988). Clutch size is 4-17 (usually 6-11) Incubation lasts 20-26 days (Harrison 1978); in northern Canada, incubated 20-22 days after clutch completion (Hannon et al. 1988). Nestlings are precocial and downy. Young are guarded by both parents, can fly at about 12-13 days, independent at about 2 months. Mature in 1 year. Monogamous.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lagopus lagopus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 32 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCACAAAGACATTGGCACTCTTTACCTAATTTTCGGCACATGAGCAGGCATAATCGGCACAGCACTAAGCCTCCTAATCCGTGCAGAACTAGGACAACCTGGAACACTCCTAGGAGACGACCAAATCTATAACGTAATCGTAACAGCCCATGCCTTCGTCATAATTTTCTTTATAGTTATACCCATCATGATCGGAGGCTTCGGGAACTGATTAGTCCCCCTTATAATCGGTGCCCCAGACATAGCATTCCCCCGCATAAATAACATAAGCTTCTGACTCCTTCCACCCTCTTTCCTCCTCTTACTAGCCTCATCCACTGTAGAAGCTGGAGCTGGTACTGGATGAACTGTTTATCCCCCCTTAGCTGGCAACCTTGCCCACGCTGGTGCATCAGTGGATCTAGCTATCTTTTCCCTCCACCTGGCTGGCGTATCATCCATCCTAGGAGCTATTAACTTCATTACTACCATCATTAATATAAAACCCCCCACACTATCACAATATCAAACACCCCTATTCGTATGATCTGTCCTCATCACTGCCATCCTTCTACTACTCTCCCTACCCGTCCTAGCTGCTGGAATTACAATACTACTCACTGACCGAAACCTCAATACTACCTTCTTTGACCCTGCAGGGGGAGGAGACCCAGTCCTATATCAACATCTATTTTGATTCTTCGGACACCCAGAAGTCTACATCCTCATCCTCCCAGGATTTGGAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lagopus lagopus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 30
Specimens with Barcodes: 110
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Willow ptarmigan are extremely widespread and their conservation status is of least concern. However, as of 2009, they were classified as critically imperiled in the province of Alberta, Canada. This does not follow the general trend for Canadian willow grouse populations, as populations in other provinces are classified as being either secure, apparently secure or unknown/under review.

Several new possible threats to ptarmigan populations have emerged in recent years. Although ecotourism has not directly altered ptarmigan populations, it has inadvertently contributed to the destruction of already fragile habitats that support this species. Pollutants are also becoming a more serious problem to many Arctic populations, including willow ptarmigan.

The Scottish red grouse population has shown significant decline in recent years. This is thought to have occurred primarily due to the reduction of heather abundance (which are a main food source for red grouse), caused by afforestation and farming.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Not protected (game species), in the UK. Included in the Birds of Conservation Concern Amber List (medium conservation concern).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The Game Conservancy Trust has studied long-term records of red grouse populations, which indicate that the species has been in decline for some decades. In part, this has been caused by a reduction in game keeping on the moors, with more birds lost to predators such as foxes and crows. But there has also been a change in moorland management, leading to degradation of the habitat and a loss of the heather on which the birds rely for food.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The successful conservation of any species is largely determined by proper management of its habitat. The red grouse is a good example of a species which has declined through a lack of suitable habitat management. In the last 50 years the uplands have lost 20-40% of heather and semi-natural scrub to commercial forestry and over-grazing, particularly by sheep. Upland moorland, especially moorland covered by heather, is a scarce habitat and considered internationally important. It supports a number of uncommon bird species including hen harrier, golden eagle, dotterel and ptarmigan, as well as red grouse. 
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of willow ptarmigan on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Willow ptarmigan are extremely popular upland game birds in North America and Europe and are regularly used for sport. A subspecies of willow ptarmigan, Scottish red grouse, have particularly important economic value in Scotland. The abundance of red grouse is often a determining factor in land value and revenue, and thus employment and use of the land. The decline of the Scottish red grouse population has lead to loss of revenue in the Central Highlands.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Willow Ptarmigan

The Willow Ptarmigan (Lagopus lagopus) is a bird in the grouse subfamily Tetraoninae of the pheasant family Phasianidae. It is also known as the Willow Grouse and in the British Isles, where it was previously believed to be a separate species, as the Red Grouse. It is a sedentary species, breeding in birch and other forests and moorlands in northern Europe, the tundra of Scandinavia, Siberia, Alaska and northern Canada, in particular in the provinces of Newfoundland and Labrador. It is the state bird of Alaska. In the summer the birds are largely brown, with dappled plumage, but in the winter they are white with black tails (though the red grouse does not adopt a winter plumage). The species has remained little changed from the bird that roamed the tundra during the Pleistocene. Nesting takes place in the spring when clutches of four to ten eggs are laid in a scrape on the ground. The chicks are precocial and soon leave the nest and while they are young, both parents play a part in caring for them. The chicks eat insects and young plant growth while the adults are completely herbivorous, eating leaves, flowers, buds, seeds and berries during the summer and largely subsisting on the buds and twigs of willow and other dwarf shrubs and trees during the winter.

Contents

Description [edit]

The Willow Ptarmigan is a medium to large ground-dwelling bird and is the most numerous of the three species of Ptarmigan. Males and females are about the same size, the adult length varying between 35 and 44 centimetres (14 and 17 in) with a wingspan ranging from 60 and 65 centimetres (24 and 26 in). The weight is 430 to 810 grams (15 to 29 oz). It is deep-chested and has a fairly long neck, a broad bill, short feathered legs and a moderately short rounded tail. In the summer, the male's plumage is marbled brown, with a reddish hue to the neck and breast, a black tail and white wings and underparts. It has two inconspicuous wattles above the eyes, which become red and prominent in the breeding season. The female is similar in appearance but lacks the wattles and has brown feathers scattered among the white feathers on the belly. During winter, the plumage of both sexes becomes completely white, except for the black tail. Immature birds resemble the adults.[2]

The Willow Ptarmigan can be distinguished from the closely related Rock Ptarmigan (Lagopus muta) by its larger size and thicker bill and by the fact that it is not generally found above the tree line while the Rock Ptarmigan prefers more elevated, barren habitat. The summer plumage is browner and in the winter, the male Willow Ptarmigan lacks the Rock Ptarmigan's black stripe between the eyes and bill.[2] The White-tailed Ptarmigan (Lagopus leucura) in North America is smaller, has a white tail and finely-barred greyer plumage and lives permanently above the tree line.[3]

The distinctive British Isles subspecies L. l. scoticus (Red Grouse) was once considered a separate true British species but is now classified as a sub-species.[4] This moorland bird is reddish brown all over, except for the white feet, and is common across the north and west of Great Britain and in localised areas on Ireland.

The voice is low-pitched and guttural and includes chuckles, repeated clucking sounds, expostulations. When displaying, the male makes rattles and barking noises.[2] When disturbed it flies off rapidly making a loud call that sounds like go-back, go-back, go-back.

Taxonomy and systematics [edit]

Red Grouse, L. l. scoticus, plumage shows less white than other subspecies
Male L. l. alascensis in winter plumage
Female L. l. lagopus in summer plumage

The Willow Ptarmigan's scientific name, Lagopus lagopus is derived from Ancient Greek lagos (λαγως) "hare" + pous (πους) "foot", in reference to the bird's feathered feet which allow it to negotiate frozen ground (see also Snowshoe Hare).

Depending on the author, some ten to twenty subspecies of the Willow Ptarmigan have been recognized by different authors. Most differ little in appearance, though as noted above, L. l. scoticus is rather distinct. Some commonly-accepted subspecies are:

  • L. l. lagopus (Linnaeus, 1758) – Scandinavian Willow Ptarmigan
  • L. l. scoticus (Latham, 1787)Red Grouse
  • L. l. alascensis Swarth, 1926 – Alaskan Willow Ptarmigan
  • L. l. variegatus Salomonsen, 1936 – Trondheimsfjord Willow Ptarmigan

During the Pleistocene, the species widely occurred in continental Europe. Authors who recognize paleosubspecies have named the Pleistocene Willow Ptarmigan L. l. noaillensis (though the older name medius might be the correct one). These marginally different birds gradually changed from the earlier (Pliocene) Lagopus atavus into the present-day species. Pleistocene Willow Ptarmigan are recorded from diverse sites until the end of the Vistulian glaciation about 10,000 years ago, when the species, by then all but identical with the living birds, retreated northwards like its tundra habitat.[5][6][7][8][9]

Diet [edit]

The Willow Ptarmigan has a varied and seasonal diet.[10] The bird is herbivorous for most of its life and subsists on various plant materials.[11] As juveniles, they may feed on insects due to an inability to digest plant material caused by underdeveloped cecums.[11] In the summer, their diet is highly varied and may consist of berries, flowers, leaves, twigs, and seeds. During the winter, the majority of a Willow Ptarmigan’s nutrition is obtained from shrubs such as Salix alaxensis.[12] Recently, there has been an increase in shrub expansion in arctic Alaska that is thought to be greatly affecting the Willow Ptarmigan’s diet. Combined with snow depth, ptarmigan browsing helps shape the landscape of the area.[12] When the snow is very deep, the birds cannot access the shorter shrubs as they are covered, so they will eat the taller species that poke through the snow. In one study it was found that 90% of the buds of S. alaxensis within their reach had been browsed.[12] This will stunt the willows and create a feedback cycle extending through the entire ecosystem. However, in winters with below average snowfall, the browsing of the ptarmigan will not have such a drastic effect as its feeding will be spread out across a range of lower plant species. It is also believed that the greening of parts of the Arctic is affecting Willow Ptarmigan populations by altering the shape and size of the shrubs they feed on.[12]

Behaviour [edit]

Nest in Salla (Finland)
Willow Ptarmigan chicks, Denali National Park and Preserve (Alaska, USA)

Male Willow Ptarmigan's are territorial birds. Males arrive in the breeding areas and set up territories in April and May, aggressively defending them against male interlopers. When the females arrive a few weeks later, the male performs courtship displays such as aerial manoeuvres, strutting and tail-fanning. When she has chosen a mate and a nesting site, the female lays a clutch of six to ten eggs in a shallow depression in the ground. The nest site is usually in a hidden location at the edge of a clearing.[13]

A small minority of male Willow Ptarmigan are polygynous but most are monogamous. They are assiduous at guarding both nest and mate, particularly early in the incubation period and when the eggs are nearly ready to hatch. During this time, the greatest danger may be from conspecifics.[14] In most other species of grouse, only the female takes care of the young, but the male Willow Ptarmigan also helps with feeding the brood and protecting them. He may take over completely if the female dies. In particular, the male defends the young from predators and both he and his mate can dive-bomb intruders or lure attackers away by pretending to have a broken wing. Nevertheless, the chicks face many dangers which range from attacks by foxes or birds of prey, getting separated from the rest of the brood, bad weather and coccidiosis. Fewer than 35% of chicks survive to eleven months and only a minority of these reach maturity. Despite this, in favourable seasons, many juveniles may survive and the population of Willow Ptarmigan is prone to wide fluctuations in size.[13]

Willow Ptarmigans are hardy vegetarian birds, but insects are also taken by the hatchling young. The main diet of the adults at all times of year is willow, with leaves being eaten in summer and buds, twigs and catkins supplying the main nutritional needs in winter and early spring. Berries also form part of the diet when available. By September, families begin to form flocks. The females and young migrate to lower altitudes and may overwinter 100 miles (160 km) from their breeding grounds in wooded valleys and hilly country. The males also congregate in small groups but do not usually travel as far as the females.[13]

Widespread and not uncommon in its remote habitat, the Willow Ptarmigan is classified as a species of "Least Concern" by the IUCN. This is because, even if, as is suspected, numbers are declining slightly, it has a very wide range with a total population estimated at forty million individuals.[1]

References [edit]

  1. ^ a b BirdLife International (BLI) (2008). Lagopus lagopus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 19 May 2008.
  2. ^ a b c Braun, C. E., K. Martin, and L. A. Robb. (1993). "Willow Ptarmigan". All about birds. The Cornell Lab of Ornithology. Retrieved 2013-02-07. 
  3. ^ "White-Tailed Ptarmigan (Lagopus leucurus)". Alaska Department of Fish and Game. Retrieved 2013-02-07. 
  4. ^ Ridpath, S.M. & Thirgood, S.J. (1997). Birds of prey and red grouse. London: Stationery Office ISBN 0117021768.
  5. ^ Válóczi, Tibor (1999): A Vaskapu-barlang (Bükk-hegység) felső pleisztocén faunájának vizsgálata [Investigation of the Upper-Pleistocene fauna of Vaskapu-Cave (Bükk-mountain)]. Folia Historico Naturalia Musei Matraensis 23: 79–96 [Hungarian with English abstract]. PDF fulltext
  6. ^ Boev, Zlatozar (2002). "Tetraonidae VIGORS, 1825 (Galliformes – Aves) in the Neogene-Quaternary record of Bulgaria and the origin and evolution of the family". Acta Zoologica Cracoviensia 45 (Special Issue): 263–282. 
  7. ^ Mlíkovský, Jirí (2002): Cenozoic Birds of the World (Part 1: Europe). Ninox Press, Prague. ISBN 80-901105-3-8 PDF fulltext
  8. ^ Mourer-Chauviré, C.; Philippe, M.; Quinif, Y.; Chaline, J.; Debard, E.; Guérin, C. & Hugueney, M. (2003). "Position of the palaeontological site Aven I des Abîmes de La Fage, at Noailles (Corrèze, France), in the European Pleistocene chronology". Boreas 32 (3): 521–531. doi:10.1080/03009480310003405. 
  9. ^ Tomek, Teresa & Bocheński, Zygmunt (2005). "Weichselian and Holocene bird remains from Komarowa Cave, Central Poland". Acta zoologica cracoviensia 48A (1–2): 43–65. doi:10.3409/173491505783995743. 
  10. ^ Wilson 2008
  11. ^ a b Stokkan, KA (1992). "Energetics and adaptations to cold in Ptarmigan in winter". Ornis Scandinavica 23 (3): 366–270. doi:10.2307/3676662. JSTOR 3676662. 
  12. ^ a b c d Tape KD, Lord R, Marshall HP, Ruess RW (2010). "Snow-mediated ptarmigan browsing and shrub expansion in Arctic Alaska". Ecoscience 17 (2): 186–193. doi:10.2980/17-2-3323.  Unknown parameter |unused_data= ignored (help)
  13. ^ a b c "Willow Ptarmigan". Small Game Hunting in Alaska. Alaska Department of Fish and Game. Retrieved 2013-02-05. 
  14. ^ Martin, Kathy (1984). "Reproductive defence priorities of male willow ptarmigan (Lagopus lagopus): enhancing mate survival or extending paternity options?". Behavioral Ecology and Sociobiology 16 (1): 57–63. doi:10.1007/BF00293104. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Composed of two groups: Lagopus of North America and SCOTICUS of the British Isles (AOU 1998). Ellsworth et al. (1995) examined phylogenetic relationships among North American grouse based on mtDNA data and found that Falcipennis canadensis is more closely related to Bonasa umbellus (ruffed grouse) than to Dendragapus obscurus (blue grouse), which is allied with Lagopus (ptarmigan) and Tetrao (capercaillie, a European grouse).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!