Articles on this page are available in 1 other language: Chinese (Simplified) (1) (learn more)

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Most individuals of the species are migratory, with western birds wintering in Africa and others in southern Asia (del Hoyo et al. 1994). Birds leave their breeding grounds between August and October, arriving at wintering quarters from late October onwards. The return journey begins in March and April, and breeding territories are occupied again in May and June. Birds are usually seen singly or in pairs or family groups, even on migration, with larger groups being rare except at roosts and especially rich feeding sites (Ferguson-Lees and Christie 2001). It migrates in broad fronts and does not generally concentrate at narrow sea crossings as do many other migratory raptors (del Hoyo et al. 1994, Snow and Perrins 1998). It is mainly diurnal although partly crepuscular and even nocturnal to some extent on migration (Ferguson-Lees and Christie 2001). Habitat It occurs in open wooded areas, and has been recorded up to 4,000 m (del Hoyo et al. 1994). Diet Flying insects form the main part of its diet, although birds are often taken in the breeding season (del Hoyo et al. 1994). Breeding site Birds almost always nest in trees, using abandoned nests of other raptors or corvids (del Hoyo et al. 1994). Management information The species requires trees in which to nest, so although preferring generally open areas in the breeding season it will avoid those that are completely deforested (del Hoyo et al. 1994).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 14.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Falco subbuteo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTCTCCAACCCACAAAGACATTGGCACCCTATACCTACTCTTCGGAGCATGAGCAGGTATAGCCGGTACCGCCCTTAGCCTTCTTATTCGAGCAGAACTTGGCCAACCGGGGACTCTTCTTGGAGACGACCAGATCTACAATGTCATCGTCACCGCCCATGCCTTCGTAATAATCTTCTTCATAGTCATACCCATTATAATCGGAGGATTTGGAAACTGACTAGTCCCCCTTATAATTGGAGCCCCAGACATAGCATTCCCCCGAATAAACAACATAAGTTTCTGATTACTCCCCCCATCCTTCCTACTACTCCTGGCATCTTCCACAGTAGAAGCCGGAGTCGGAACAGGATGAACCGTTTACCCCCCCTTAGCAGGCAACCTGGCCCATGCTGGCGCCTCAGTAGACCTAGCCATCTTCTCCCTGCACCTCGCAGGTGTATCTTCCATCCTGGGGGCAATCAACTTTATCACAACAGCCATTAACATAAAACCCCCTGCCCTGTCACAATACCAAACCCCATTATTCGTGTGATCCGTACTCATCACAGCCGTACTCCTACTGCTCTCACTCCCAGTCTTAGCCGCTGGCATCACCATACTACTAACCGACCGAAATCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCTATTCTCTACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATCCTACCAGGATTTGGAATT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Falco subbuteo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over 10 years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in 10 years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.400,000 individuals (Ferguson-Lees et al. 2001), while national population estimates include: c.100-10,000 breeding pairs, c.50-1,000 individuals on migration and c.1,000-10,000 wintering individuals in China; < c.100,000 breeding pairs and < c.1,000 individuals on migration in Korea; c.100-10,000 breeding pairs and c.50-1,000 individuals on migration in Japan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

The cutting of old growth forest patches in Ukraine is thought to have caused local declines (del Hoyo et al. 1994). Some are shot, notably in Malta where hunters are thought to kill 500-1,000 individuals each year. A growing threat is human disturbance, which facilitates nest predation by crows and squirrels. Pesticide use has likely had only minor impacts, as has egg-collecting, which tends to be a local issue (Ferguson-Lees and Christie 2001). The species is highly vulnerable to the effects of potential wind energy development (Strix 2012).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eurasian hobby

The Eurasian hobby (Falco subbuteo), or just simply hobby, is a small slim falcon. It belongs to a rather close-knit group of similar falcons often considered a subgenus Hypotriorchis.[2]

Description[edit]

Adults are slate-grey above with a dark crown and 2 short black moustachial stripes. The throat is unstreaked white, thighs and undertail coverts are unstreaked rufous and rest of the underparts are whitish with black streaks. Close views enable the red "trousers" and vent to be seen. Sexes are similar. Juveniles are generally much browner, with scaled upper parts and streaked buffy thighs and undertail coverts.[3]

The hobby has a distinct first-summer plumage.[4]

Size: Length 29–36 cm, Wingspan 74–84 cm, Weight 175–285 g [5]

Taxonomy and systematics[edit]

This species was first described by Linnaeus in his Systema naturae in 1758 as Falco subbuteo.[6]

Currently two subspecies are recognized:

  • subbuteo: the nominate race is resident in Africa, Europe and Central and East Asia, winters in Central and South Africa and South Asia
  • streichi: described by Hartert and Neumann in 1907, is smaller in size and is found further east of subbuteo's distribution range

Distribution and status[edit]

This species breeds across Africa, Europe and Asia. It is a long-distance migrant, wintering in Africa and Asia.

Behaviour and ecology[edit]

It is a bird of open country such as farmland, marshes, taiga and savannah. They are widespread in lowlands with scattered small woods. It is an elegant bird of prey, appearing sickle-like in flight with its long pointed wings and square tail, often resembling a swift when gliding with folded wings. It flies powerfully and fast. It will take large insects, such as dragonflies, which it transfers from talons to beak and eats while soaring slowly in circles.[7] It also captures small bats and small birds like swallows, swifts, pipits etc. in flight. Its speed and aerobatic skills enable it to take swallows and even swifts on the wing, and barn swallows or house martins have a characteristic "hobby" alarm call. It is known to harass swallows while they are roosting and dispersing from roosts.[3] When not breeding, it is crepuscular, hawking principally in the mornings and evenings. While on migration, they may move in small groups.

Hobbies nest in old nests of crows and other birds. The tree selected is most often one in a hedge or on the extreme edge of a spinney, whence the bird can observe intruders from a considerable distance. It lays 2–4 eggs. Incubation is said to take 28 days and both parents share in this duty, though the female does the greater part.[8]

It is a very bold and courageous bird and was used in falconry, trained to hawk birds like quails, larks, hoopoes, drongos etc.[9]

Notes[edit]

  1. ^ BirdLife International (2013). "Falco subbuteo". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Helbig et al. (1994), Wink et al. (1998), Nittinger et al. (2005)
  3. ^ a b Rasmussen PC & JC Anderton (2005). Birds of South Asia: The Ripley Guide. Volume 2. Smithsonian Institution & Lynx Edicions. pp. 114–115. 
  4. ^ Small, Brian (1992): First-summer Hobbies in the New Forest British Birds 85(5): 251–5
  5. ^ http://www.europeanraptors.org/raptors/eurasian_hobby.html
  6. ^ (Latin) Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). p. 89. "F. cera pedibusque flavis, dorso fusco, nucha alba abdomine pallido maculis oblongis fuseis." 
  7. ^ Butler, EA, (1875). "Notes on the Avifauna of Mount Aboo and Northern Guzerat". Stray Feathers 3: 443–444. 
  8. ^ Baker, ECS (1928). Fauna of British India. Birds. Volume 5 (2 ed.). Taylor and Francis, London. pp. 41–45. 
  9. ^ Jerdon, TC (1864). The birds of India. Volume 1. George Wyman and Co, Calcutta. pp. 34–35. 

References[edit]

  • Helbig, A.J.; Seibold, I.; Bednarek, W.; Brüning, H.; Gaucher, P.; Ristow, D.; Scharlau, W.; Schmidl, D. & Wink, Michael (1994): Phylogenetic relationships among falcon species (genus Falco) according to DNA sequence variation of the cytochrome b gene. In: Meyburg, B.-U. & Chancellor, R.D. (eds.): Raptor conservation today: 593–599. PDF fulltext
  • Nittinger, F.; Haring, E.; Pinsker, W.; Wink, Michael & Gamauf, A. (2005): Out of Africa? Phylogenetic relationships between Falco biarmicus and other hierofalcons (Aves Falconidae). Journal of Zoological Systematics and Evolutionary Research 43(4): 321–331. doi:10.1111/j.1439-0469.2005.00326.x PDF fulltext
  • Wink, Michael; Seibold, I.; Lotfikhah, F. & Bednarek, W. (1998): Molecular systematics of holarctic raptors (Order Falconiformes). In: Chancellor, R.D., Meyburg, B.-U. & Ferrero, J.J. (eds.): Holarctic Birds of Prey: 29–48. Adenex & WWGBP. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!