Articles on this page are available in 1 other language: Spanish (13) (learn more)

Overview

Brief Summary

Falco sparverius

The smallest falcon in North America (9-12 inches), the American Kestrel is most easily identified by its small size, rufous-brown tail, and rufous-brown back with dark horizontal bars. Other field marks include a white throat, white cheeks, and a slate-blue head with a rufous crown. Male American Kestrels have slate-blue wings, while females are larger and have rufous wings. The American Kestrel breeds across a wide portion of North America from Alaska and Canada to central Mexico. In winter, American Kestrels withdraw from northern portions of their range, wintering from the north-central United States south to Panama. Many American Kestrels in southern portions of this species’ breeding range are non-migratory, as are other populations in Central America, the West Indies, and South America. American Kestrels inhabit a number of open habitats, including grasslands, fields, meadows, and urban areas, that provide cavities for nesting as well as open areas for hunting. This species utilizes similar habitat types in winter as in summer, although nesting cavities are not necessary in that season. American Kestrels eat a variety of small animals, including insects, small birds, and rodents. Due to this species’ preference for open habitat, American Kestrels may be most easily seen perched prominently, perhaps in a tree or on a utility pole, while watching for prey. This species may also be observed hunting, when it may be seen pursuing and capturing prey with its talons. American Kestrels are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

The American kestrel permanently inhabits (without seasonal migration) North and South America from near the tree-line in Alaska and Canada and south to Tierra del Fuego. The bird can also be found in the West Indies, the Juan Fernandez Islands and Chile. It is largely absent from heavily forested areas, including Amazonia.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

American kestrels breed from western and central Alaska and southern
Yukon to northern Ontario, southern Quebec, and southern Newfoundland
south to Mexico.  They winter from south-central Alaska, southern
British Columbia, and northern United States south throughout the
breeding range to Panama [1,2,13,15,25].  Specific distributions of the
four North American subspecies are listed below:

Falco sparverius sparverius- Breeds from east-central Alaska and the
Northwest Territories east to Nova Scotia and south to northern Mexico,
southern Texas, Arkansas, Tennessee, northern Alabama, and northern
Georgia.  This subspecies winters from southern British Columbia to
southern Ontario and New York, south to Nevada, the Gulf Coast of the
United States, Florida (to Key West), and the Bahama Islands; through
Mexico and Central America to eastern Panama [1].

Falco sparverius guadalupensis is a resident subspecies on Guadalupe
Island and in Baja California [1].

Southeastern American kestrels- This subspecies has now been extirpated
over most of its former range [34].  The current range of southeastern
American kestrels was not described in the literature.  Former breeding
range extended from Louisiana (except the coastal area), Mississippi,
central Alabama, and southern Georgia to southern Florida.  Former
winter range extended from their breeding range south to the Gulf coast
of Louisiana and to Key West, Florida [1].

Falco sparverius peninsularis- Breeds in southern Baja California from
Santana south to Cape San Lucas and in the lowlands of Sonora and
Sinaloa.  Winters south to Mazatlan, Sinaloa [1].
  • 1.  American Ornithologists' Union. 1957. Checklist of North American birds.        5th ed. Baltimore, MD: The Lord Baltimore Press, Inc. 691 p.  [21235]
  • 2.  Donohoe, Robert W. 1974. American hornbeam  Carpinus caroliniana Walt.        In: Gill, John D.; Healy, William M., eds. Shrubs and vines for        northeastern wildlife. Gen. Tech. Rep. NE-9. Upper Darby, PA: U.S.        Department of Agriculture, Forest Service, Northeastern Forest        Experiment Station: 86-88.  [13714]
  • 13.  Campbell, R. Wayne; Dawe, Neil K.; McTaggart-Cowan, Ian; [and others]
  • 15.  DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 25.  Herron, Gary B.; Mortimore, Craig A.; Rawlings, Marcus S. 1985.        Red-tailed hawk. In: Nevada raptors: Their biology and management.        Biological Bulletin No. 8. Reno, NV: Nevada Department of Wildlife:        29-30.  [22694]
  • 34.  Loftin, Robert W. 1992. Use of nest boxes by the Florida kestrel.        Florida Field Naturalist. 20(3): 57-88.  [21375]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

    1  Northern Pacific Border
    2  Cascade Mountains
    3  Southern Pacific Border
    4  Sierra Mountains
    5  Columbia Plateau
    6  Upper Basin and Range
    7  Lower Basin and Range
    8  Northern Rocky Mountains
    9  Middle Rocky Mountains
   10  Wyoming Basin
   11  Southern Rocky Mountains
   12  Colorado Plateau
   13  Rocky Mountain Piedmont
   14  Great Plains
   15  Black Hills Uplift
   16  Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
HI ID IL IN IA KS KY LA ME MD
MA MI MN MS MO MT NE NV NH NJ
NM NY NC ND OH OK OR PA RI SC
SD TN TX UT VT VA WA WV WI WY
DC PR VI
AB BC MB NB NF NT NS ON PE PQ
SK YK MEXICO

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

American Kestrels are found in the Nearctic and Neotropical regions. They live in North and South America from near the tree-line in Alaska and Canada to southernmost South America. Their range extends to the West Indies, the Juan Fernandez Islands, and Chile. They are not typically found in rainforest areas and they do not migrate long distances.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: BREEDS: central Alaska and most of forested Canada south through most of North, Central, and South America and the West Indies (including Puerto Rico and the Virgin Islands) to Tierra del Fuego. NORTHERN WINTER: from northern U.S., and locally in southern Canada, southward (Godfrey 1966). In the U.S., most abundant in winter in the western and southern states (Root 1988). See Palmer (1988) for more detail.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

American Kestrels are the smallest falcon in North America. Males weigh between 103 and 120 grams. Females weigh between 126 and 166 grams. The length of the American Kestrel ranges from 19 to 21 centimeters. Their wingspan is between 50 and 60 centimeters. Both sexes have dark eyes, a notched beak, and unfeathered legs. Males have a rust colored back and tail, and blue wings. The tail has a black band. Females are rust colored with black bands on her wings and tail. Both sexes have white patches on their faces. On top of their head is a blue cap, which is usually brighter in males.

Range mass: 103.0 to 166.0 g.

Range length: 19.0 to 21.0 cm.

Range wingspan: 50.0 to 60.0 cm.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: female larger; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

male: 103g to 120g

female: 126g to 166g

Generally, the American kestrel is 19 - 21 cm in length with an average wingspan of 50 - 60 cm.

Excepting the Seychelles kestrel, the American kestral is the smallest species in the genus Falco. There is a strong selection for sexual dichromatism, with males being brightly and rufously colored and females having a more even tone.

Average mass: 117 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 27 cm

Weight: 160 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from peregrine falcon, merlin, and aplomado falcon in having a reddish back and tail and double black marks on sides of head; peregrine falcon is much larger. Smaller than the Eurasian kestrel (averages 34 cm long), which has only a single black mark on each side of the head.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Cover Requirements

More info for the term: cover

American kestrels most often select cavities with tight-fitting
entrances for nests, probably to protect the nest from ground predators
[10].  The need for cover does not seem to affect Foraging behavior.
When foraging, American kestrels are commonly found on high, exposed
perches where they can look out over wide stretches of grassland or
pasture to watch for prey [24].  They prefer to hunt in open areas
covered only by short and sparse ground vegetation [12,24].  During the
winter, the availability of shelters may be a limiting factor.  The
distribution of American kestrels wintering in Ohio was closely linked
to availability of old buildings and other sheltered roosts [12].

The thick understory created by pine regeneration in cut or unburned
forests in Florida may have an adverse effect on southeastern American
kestrel populations [26]. 
  • 10.  Braunting, Daniel. 1983. Nest site selection of the American kestrel        (Falco sparverius). Raptor Research. 17(4): 122.  [22820]
  • 12.  Brye, Victoria J.; Siska, Janice M.; Spreyer, Mark F. 1991. Falcons. In:        Proceedings of the midwest raptor management symposium and workshop;        [Date of conference unknown]
  • 24.  Hardin, Kimberly I.; Evans, Keith E. 1977. Cavity nesting bird habitat        in the oak-hickory forests--a review. Gen. Tech. Rep. NC-30. St. Paul,        MN: U.S. Department of Agriculture, Forest Service, North Central Forest        Experiment Station. 23 p.  [13859]
  • 26.  Hoffman, Mark L.; Collopy, Michael W. 1988. Historical status of the        American kestrel (Falco sparverius paulus) in Florida. Wilson Bulletin.        100(1): 91-107.  [22826]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred Habitat

More info for the terms: cacti, natural, tree

American kestrels occupy a wide variety of open to semiopen habitats,
including farmland and urban areas from sea level up to 13,000 feet
(3,960 m) elevation [29,40].  They generally occur in any habitat that
contains an adequate prey base, perch sites, and (during the nesting
season) nesting sites [40].  In the Sierra Nevada, American kestrels
range up to alpine zones, mountain meadows, and other open areas in late
summer and fall, but winter at lower elevations [54].  In Montana, they
breed at forest edges and in groves, ranging out over adjoining
prairies, croplands, and badlands [40].  In Nevada, the highest
densities of both breeding and wintering American kestrels are often
located near agricultural areas or riparian vegetation that support an
abundant prey base.  Nesting densities in these preferred habitats often
exceeds one pair per square mile [25].  In British Columbia, American
kestrels commonly occupy quaking aspen (Populus tremuloides) groves,
woodland edges, river bottomlands, wooded lakeshores, farmlands, burns,
meadows, orchards, marshes, and bogs [13].

Southeastern American kestrels inhabit mostly open pine forests and
clearings where snags occur [27].  The decrease of isolated or scattered
pine snags in open habitats used by southeastern American kestrels was
closely correlated with the decline in the number of breeding pairs
[50].

Nesting habitat - Nest sites are usually located along roadways,
streams, ponds, or forest edges [15].  Nests may be reused from year to
year.  In Utah, twelve pairs used the same nest site for 2 consecutive
years and eight pairs used the same site again the third year [24].
Southeastern American kestrels often use the same nest site in
successive years [34].  However, Hammerstrom and Hart [23] found that
American kestrels in central Wisconsin did not use the same nest site in
succeeding years even after having raised a brood successfully.

American kestrels prefer to nest in natural cavities with tight-fitting
entrances, or in cavities excavated by other bird species in both live
trees and snags [15,24,29,40].  The diameter of 15 cavity openings used
by American kestrels in British Columbia ranged from 2.5 to 14.1 inches
(6.4-36 cm) [13].  Trees with a d.b.h. greater than 12 inches (30 cm)
are preferred [15].  The species of trees used differs among geographic
regions [13,24,56,58].  Cavities excavated by northern flickers
(Colaptes auratus) and natural cavities located 6.5 to 35 feet (2-10.7
m) above the ground are commonly used as nesting sites [24].  If
cavities are unavailable, American kestrels nest in a variety of sites
including niches in rocky cliffs, under the eaves of buildings, in old
black-billed magpie (Pica pica) nests, in cavities in cacti, in unused
chimneys, or in nest boxes [15,17,24,54].

Herron and others [25] reported that American kestrels in Nevada
generally nest about 20 feet (6 M) from the ground and seem to prefer an
easterly exposure.

Of 41 American kestrel nests in Utah, 28 were located in trees (19 in
old northern flicker holes, two in old magpie nests and seven in natural
cavities).  The species and number of trees used were 18 cottonwood
(Populus spp.), 3 poplar (Populus spp.), 3 willow (Salix spp.), 3 maple
(Acer spp.), 1 elm (Ulmus spp.), and one apple.  Two of the remaining
nests were located in rocky cliffs and the last 11 were found on
building tops [24].  In southeastern Montana and northern Wyoming, most
American kestrel nests were in cavities of ponderosa pine (Pinus
ponderosa) and cottonwood or in sandstone cliffs.  Other nests were in
fenceposts, under bridges, and in abandoned magpie nests.  The greatest
number of nests occurred in ponderosa pine stands.  The mean distance
between occupied nest sites on the survey plots was 0.4 miles (0.7 km)
[56].

In British Columbia, American kestrel nests were situated in woodpecker
holes or natural cavities in living and dead trees (73%), in man-made
structures (23%), and in holes in cliffs.  Sometimes nests of other
species of birds were used, including those of belted kingfishers
(Ceryle alcyon), black-billed magpies, and American crows (Corvus
bachyrhynchos).  Ponderosa pine (29%) and Douglas-fir (Pseudotsuga
menziesii) (10%) were the most often used species of coniferous trees;
important deciduous trees were black cottonwood (Populus trichocarpa)
(19%) and quaking aspen (8%).  Man-made structures included nest boxes
(17%), buildings, power poles, and fence posts [13].

Nests of southeastern American kestrels are commonly located in old
woodpecker holes in snags 12 to 35 feet (39-114 m) above the ground
[27].  Most nest cavities have been excavated by northern flickers,
red-headed woodpeckers (Melanerpes erythrocephalus), or red-bellied
woodpeckers (Melanerpes carolinus) [58].  In north-central Florida,
southeastern American kestrels nested most frequently in longleaf pine
trees.  Turkey oak and live oak (Quercus virginiana) were also occupied.
Natural cavities occurred solely in turkey oak, whereas all nest
cavities in longleaf pine were of woodpecker origin.  The frequent use
of longleaf pine in this study indicates that this tree species is
particularly important for southeastern American kestrels nesting in
north-central Florida.  Turkey oak snags may be important alternate nest
sites for southeastern American kestrels and may increase in importance
as longleaf pine becomes scarcer [58].

Foraging habitat - American kestrels generally forage in open habitats
that contain high perches [29].  They probably use perch sites in tree
islands and along forest edges.  They also hunt by hovering over areas
of short, open vegetation [15].  American kestrels usually search for
prey from elevated perches such as fenceposts, utility poles and wires,
live trees, snags, and rock outcrops [15,36,40].  They prefer perches 16
feet (5 m) high or higher to perches over 8 feet (2.5 m) high [22].
Fischer and others [20] found that American kestrels wintering in
central Utah predominantly used wire perches.  Poles and trees were used
less often.  In Venezuela, 25 feet (7.6 m) tall poles were more
acceptable for perches than 6 foot tall (1.8 m) poles [40]. 

Winter habitat - Winter habitat for American kestrels is generally the
same as nesting habitat, except that high elevation areas are not used
[15,29].  Several studies have found
differential habitat use by male and
female adult American kestrels in the southern United States and
northern Mexico.  In areas of winter segregation, females often occupy
the best habitats which often includes open areas covered with short or
sparse ground vegetation.  Males are found primarily in woodland
openings, along woodland edges, or in other less open habitats.  This
differential habitat use may be due to the males arriving on the
wintering grounds later than the females.  The females therefore may
establish their winter territories in the best habitats before the males
arrive [46,47].
  • 13.  Campbell, R. Wayne; Dawe, Neil K.; McTaggart-Cowan, Ian; [and others]
  • 15.  DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 17.  DuBois, Kristi; Becker, Dale; Thornbrugh, Joe. 1987. Identification of        Montana's birds of prey. Montana Outdoors. 18(6): 11-31.  [3606]
  • 20.  Fischer, David L.; Ellis, Kevin L.; Meese, Robert J. 1984. inter habitat        selection of diurnal raptors in central Utah. Raptor Research. 18(3):        98-102.  [22704]
  • 22.  Gieck, Charlene M. 1991. Artificial nesting structures for bald eagles,        ospreys and American kestrels. In: Proceedings of the Midwest raptor        management symposium and workshop; [Date of conference unknown]
  • 23.  Hamerstrom, Frances; Hamerstrom, Frederick N.; Hart, John. 1973. Nest        boxes: an effective management tool for kestrels. Journal of Wildlife        Management. 37(3): 400-403.  [22824]
  • 24.  Hardin, Kimberly I.; Evans, Keith E. 1977. Cavity nesting bird habitat        in the oak-hickory forests--a review. Gen. Tech. Rep. NC-30. St. Paul,        MN: U.S. Department of Agriculture, Forest Service, North Central Forest        Experiment Station. 23 p.  [13859]
  • 25.  Herron, Gary B.; Mortimore, Craig A.; Rawlings, Marcus S. 1985.        Red-tailed hawk. In: Nevada raptors: Their biology and management.        Biological Bulletin No. 8. Reno, NV: Nevada Department of Wildlife:        29-30.  [22694]
  • 27.  Howell, Arthur H. 1932. Florida bird life. Tallahassee, FL: Florida        Department of Game and Fresh Water Fish. 579 p.  [22879]
  • 29.  Kochert, Michael N. 1986. Raptors. In: Cooperrider, Allan Y.; Boyd,        Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife        habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land        Management, Denver Service Center: 313-349.  [13527]
  • 34.  Loftin, Robert W. 1992. Use of nest boxes by the Florida kestrel.        Florida Field Naturalist. 20(3): 57-88.  [21375]
  • 36.  McClelland, B. Riley. 1979. Cavity nesters: part of Montana's bird        heritage. Montana Outdoors. 10(4): 34-37.  [15176]
  • 40.  Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume        5. New Haven, CT: Yale University Press. 463 p.  [22303]
  • 46.  Smallwood, John A. 1987. Winter territoriality and predation ecology of        American kestrels (Falco sparverius) in southcentral Florida. Columbus,        OH: The Ohio State University. 128 p. Dissertation. In: Dissertation        Abstracts International. 48(9): 2542-B. Abstract.  [22831]
  • 47.  Smallwood, John A. 1988. A mechanism of sexual segregation by habitat in        American kestrels (Falco sparverius) wintering in south-central Florida.        Auk. 105(1): 36-46.  [22832]
  • 50.  Smallwood, J. A.; Collopy, M. W. 1993. Management of the threatened        southeastern American kestrel in Florida: population responses to a        regional nest-box program. Journal of Raptor Research. 27(1): 81.        [22880]
  • 54.  Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife        and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37.        Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific        Southwest Forest and Range Experiment Station. 439 p.  [10237]
  • 56.  Phillips, Robert L.; Wheeler, Anne H.; Lockhart, J. Michael; [and        others]
  • 58.  Hoffman, Mark L.; Collopy, Michael W. 1987. Distribution and nesting        ecology of the American kestrel (Falco sparverius paulus) near Archer,        Florida. Raptor Research Reports. 6: 47-57.  [22825]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

More info for the terms: association, hardwood, succession, tree

American kestrels occupy nearly all open shrubland, grassland and forest
vegetation types [29,40,54].  In Montana, American kestrels prefer
cottonwood (Populus spp.) forests over sagebrush (Artemisia spp.),
shrubland, and pine (Pinus spp.)-juniper (Juniperus spp.) woodland [40].
In California, they prefer large tree stages of succession.  For
breeding in blue oak (Quercus douglasii) savannah and gray pine (Pinus
sabiniana)-oak (Quercus spp.) types, they prefer 40 to 70 percent crown
closure[54].

The sandhills habitats apparently provide the most suitable habitat for
southeastern American kestrels in Florida [34].  In north-central
Florida, southeastern American kestrels nest in longleaf pine (Pinus
palustris) flatwoods, old-growth slash pine (Pinus elliottii) and
longleaf pine-turkey oak (Quercus laevis) sandhills communities [26,50].
During a 1981 through 1982 nesting survey, southeastern American kestrel
densities were higher in former and existing areas of the longleaf
pine-turkey oak sandhills association (0.41 pairs/sq km) than in areas of
former and existing hardwood hammocks (0.14 pairs/sq km) [58].
Additionally, the sandhill communities, particularly the pine-oak
woodland habitats, provide quality foraging sites for this subspecies
[59].
  • 26.  Hoffman, Mark L.; Collopy, Michael W. 1988. Historical status of the        American kestrel (Falco sparverius paulus) in Florida. Wilson Bulletin.        100(1): 91-107.  [22826]
  • 29.  Kochert, Michael N. 1986. Raptors. In: Cooperrider, Allan Y.; Boyd,        Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife        habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land        Management, Denver Service Center: 313-349.  [13527]
  • 34.  Loftin, Robert W. 1992. Use of nest boxes by the Florida kestrel.        Florida Field Naturalist. 20(3): 57-88.  [21375]
  • 40.  Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume        5. New Haven, CT: Yale University Press. 463 p.  [22303]
  • 50.  Smallwood, J. A.; Collopy, M. W. 1993. Management of the threatened        southeastern American kestrel in Florida: population responses to a        regional nest-box program. Journal of Raptor Research. 27(1): 81.        [22880]
  • 54.  Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife        and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37.        Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific        Southwest Forest and Range Experiment Station. 439 p.  [10237]
  • 58.  Hoffman, Mark L.; Collopy, Michael W. 1987. Distribution and nesting        ecology of the American kestrel (Falco sparverius paulus) near Archer,        Florida. Raptor Research Reports. 6: 47-57.  [22825]
  • 59.  Bohall-Wood, Petra G.; Collopy, Michael W. 1987. Foraging behavior of        southeastern American kestrels in relation to habitat use. Raptor        Research Reports. 6: 58-65.  [22819]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: cover

   American kestrels probably occur in most SAF Cover Types

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

   American kestrels probably occur in most Kuchler Plant Associations

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES29 Sagebrush
FRES30 Desert shrub
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands
FRES42 Annual grasslands
FRES44 Alpine

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

American Kestrels nest in tree cavities, woodpecker holes, crevices of buildings, holes in banks, nest boxes or, rarely, old nests of other birds. American Kestrels are highly adaptable and can live just about anywhere, as long as there is some open ground for hunting and places on which to perch and have a good view of the surroundings, such as telephone wires.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: taiga ; chaparral ; forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The American kestrel nests in tree cavities, woodpecker holes, crevices of buildings, holes in banks, nest boxes or, rarely, old nests of other birds. The American kestrel is highly adaptable behaviorly and lives just about everywhere, as long as there is some open ground for hunting and conspicuous places on which to perch (e.g., telephone wires).

Terrestrial Biomes: taiga ; desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: BREEDING: Open or partly open habitat; prairies, deserts, wooded streams, burned forest, cultivated lands and farmland with scattered trees, open woodland, along roads, sometimes in cities.

Nests in natural holes in trees, abandoned woodpecker holes, holes in buildings or cliffs, abandoned magpie nests, and similar sites. Readily uses nest-boxes, which may dramatically increase density of nesting pairs in some areas (may use boxes put up for wood duck or goldeneye). In western Venezuela, nest cavities tend to face into prevailing winds (Balgooyen 1990). Rarely returns to breed in vicinity where reared, but breeders tend to return to their previous territories (Palmer 1988).

NON-BREEDING: Various open and semi-open habitats. In winter, males use less open habitats than do females (Smallwood 1987, Palmer 1988, Ardia and Bildstein 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northern breeding populations (Alaska, most of Canada, parts of northern U.S.) migrate south to the southern U.S. and Mexico for the northern winter, but breeding pairs farther south may stay together in the same area all year. Some temperate breeders migrate south as far as Panama and probably northern South America (Hilty and Brown 1986). In some areas (e.g., Pennsylvania and Maryland), breeders may be resident whereas the young migrate (Palmer 1988). Winterers begin leaving Florida in February (almost all are gone by April); in southern states east of Rockies there is much movement from at least early March into April, in northern states mainly mid-March to mid-April; on southern Canadian prairie most spring movement occurs in the last 3 weeks of April, continuing to mid-May (Palmer 1988). Migration in Costa Rica occurs mainly September-October and March-April (Stiles and Skutch 1989). Much movement of migrants in Canada and northern U.S. occurs in September, decreasing rapidly around mid-October; arrival in Florida begins in September, lasts well into October; arrives in southern Central America beginning in mid-October (Palmer 1988). In Minnesota and perhaps elsewhere in eastern and mid-western North America, the movement south peaks in September, coinciding with the migration of large dragonflies (specifically Green Darners, Anax junius), which are preyed upon extensively by the migrating kestrels (Nicoletti 1996, Iron 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

American kestrels eat primarily insects during the summer, but also take
mice and other small mammals, birds, lizards, toads, frogs, and small
snakes.  They sometimes eat carrion [15,40,60].  During the winter in
northern latitudes they eat primarily small birds and rodents [17,24].

Invertebrates eaten by American kestrels include earthworms, spiders,
centipedes, scorpions, and insects of seven orders, including both
larvae and adult forms of Diptera, Lepidoptera, and Coleoptera.
Reptiles include five genera of lizards and at least six species of
snakes.  Over 30 species of birds are listed as prey:  They range in
weight from under 10 grams to over 150 grams.  About 30 species of
mammals have also been listed as prey, with a weight range similar to
that of the avian prey [60].  About seven genera of bats are listed as
prey [40].

Some specific prey items of American kestrels include grasshoppers,
dragonflies, crickets, June beetles, weevils, crayfish, snails, small
ground squirrels (Spermophilus spp.), wood rats (Neotoma spp.), pocket
gophers (Geomys spp.), red squirrels (Tamiasciurus hudsonicus),
chipmunks (Tamaia striatus, Eutamias spp.), least weasels (Mustela
rixosa), voles (Microtus spp.), cotton rats (Sigmodon spp.), house mice
(Mus musculus), and shrews (Sorex spp.).  Many house sparrows (Passer
domesticus) are taken in rural and urban areas [40].
  • 15.  DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 17.  DuBois, Kristi; Becker, Dale; Thornbrugh, Joe. 1987. Identification of        Montana's birds of prey. Montana Outdoors. 18(6): 11-31.  [3606]
  • 24.  Hardin, Kimberly I.; Evans, Keith E. 1977. Cavity nesting bird habitat        in the oak-hickory forests--a review. Gen. Tech. Rep. NC-30. St. Paul,        MN: U.S. Department of Agriculture, Forest Service, North Central Forest        Experiment Station. 23 p.  [13859]
  • 40.  Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume        5. New Haven, CT: Yale University Press. 463 p.  [22303]
  • 60.  Mueller, Helmut C. 1987. Prey selection by kestrels: a review. Raptor        Research Reports. 6: 3-106.  [22829]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

In the summer, American kestrels hunt in the early morning and evening, eating large insects (mainly Orthoptera). During winter, they hunt throughout the daylight hours and eat small mammals, mostly rodents, like Microtus pennsylvanicus and Peromyscus leucopus, and Passeriformes, Charadriidae, Squamata, scorpions, and Amphibia.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

In the summer, American kestrels hunt in the early morning and evening, eating large insects (mainly grasshoppers). During winter, they hunt throughout daylight hours and eat small mammals (mice and sparrow-sized birds), sandpiper chicks, lizards, scorpions and amphibians.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In summer feeds on insects (e.g., grasshoppers and crickets) and small vertebrates (e.g., snakes, lizards, birds, mice, sometimes bats). In winter: in north, feeds mainly on birds and mice; arthropods in Florida (Smallwood 1987); large insects, anoles, and snakes in Costa Rica. During migration, at least in eastern North America, high counts coincide with the migration of Green Darners, Anax junius. In September 1995 at Hawk Ridge, Minnesota, Nicoletti (1996) observed 28% of the passing kestrels feeding on Green Darners. Late in the day, 74% fed on darners. Nicoletti theorized that this food source was especially important for juveniles. Iron (1998) observed similar behavior in September 1997 on the north shore of Lake Ontario. Forages from perch or while in flight (e.g., hovering). See Palmer (1988) for extensive account of food and feeding.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predators

Some potential avian predators of American kestrels include great horned
owls (Bubo virginianus), golden eagles (Aquila chrysaetos), red-tailed
hawks (Buteo jamaicensis), and prairie falcons (Falco mexicanus) [39].
Other potential predators that have been reported preying on other
raptor species and their clutches include coyotes (Canis latrans),
bobcats (Lynx rufus), skunks (Mephitis mephitis and Spilogale putorius),
raccoons (Procyon lotor), and crows and ravens (Corvus spp).
  • 39.  Meyer, Ruthe Lash; Balgooyen, Thomas G. 1987. A study and implications        of habitat separation by sex of wintering American kestrels. Raptor        Research Reports. 6: 107-123.  [22828]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

American Kestrels play an important role in controlling populations of small mammals, particularly rodents, in open habitats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Falconiformes and Strigiformes may prey on adult American kestrels. Most predation probably occurs on eggs, babies in the nest (called nestlings), and young birds. A list of possible predators is given below. American kestrels protect their young by nesting in cavities. Their sharp talons and keen eyesight may help to protect them from other predators.

Known Predators:

  • Bubo virginianus
  • Aquila chrysaetos
  • Buteo jamaicensis
  • Falconidae
  • Canis latrans
  • Procyon lotor
  • Mephitis mephitis
  • Lynx rufus
  • Corvus brachyrhynchos and Corvus corax 

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

  • H. W. Koepcke and M. Koepcke, Sobre el proceso de transformacion de la materia organica en las playas arenosas marinas del Peru. Publ. Univ. Nac. Mayer San Marcos, Zoologie Serie A, No. 8, from p. 24 (1952).
  • P. G. Howes, The Giant Cactus Forest and Its World: A Brief Biology of the Giant Cactus Forest of Our American Southwest (Duell, Sloan, and Pearce, New York; Little, Brown, Boston; 1954), from pp. 222-239, from p. 227.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: cover, frequency, fresh, marsh

American kestrels occur in the following 10 major fire-dependent plant
associations in the western United States:  grasslands, semidesert
shrub-grasslands, sagebrush (Artemisia spp.)-grasslands, chaparral,
pinyon-juniper (Pinus spp.-Juniperus spp.) woodland, ponderosa pine,
Douglas-fir, spruce-fir (Picea spp.-Abies spp.), redwood (Sequoia
sempervirens), and giant sequoia (Sequoiadendron giganteum) forests
[33].  American kestrels occur in fire-dependent longleaf pine
communities in the eastern United States [26,58].

Although fire may reduce potential nest trees, it may also create snags
for nest and perch sites and enhance the foraging habitat of American
kestrels.  In the Sierra Nevada, nesting American kestrels were two to
three times more numerous in a burned-over forest than in an unburned
forest nearby.  This difference was attributed to the greater
availability of nest cavities in the burned forest [4].  At Sagehen
Creek, California, American kestrels breed (but do not winter) in burned
forests and along edges between sagebrush and forest habitats.  American
kestrels do not use areas of thick cover because they require an open
understory in which to maneuver and visually locate prey.  American
kestrels often use fresh burns when foraging due to increased prey
visibility [16,32,49].  A decrease in the frequency of ground fires
leads to an increase in vegetative cover and, therefore, has a negative
impact on habitat quality for American kestrels [4,26].  In the Sierra
Nevada, Balgooyen [4] found that open areas created by a severe fire in
ponderosa pine and lodgepole pine (Pinus contorta)-red fir (Abies
magnifica) forests provided only temporary habitat for American
kestrels.  Eleven to twelve years after the fire, brush vegetation
including deerbrush (Ceanothus integerrimus) and snowbrush ceanothus (C.
velutinus) formed dense cover in the burned areas [4].

American kestrels are favored by fires that open up or clear
pinyon-juniper woodlands [35].  Raptors associated with pinyon-juniper
woodlands depend upon edges of openings created by fire and scattered
islands of unburned woodlands [16].  In pinyon-juniper woodlands on the
Humboldt National Forest, California, American kestrels were observed
only on burned areas and only during the second season.  Surveys were
conducted in only two seasons [35].

American kestrels congregate at both controlled and naturally occurring
fires to hunt along the edge (usually the windward side) for insects,
small mammals, and reptiles [40,49,57].  Howell [27] reported seeing 13
southeastern American kestrels feeding over a "raging" marsh fire.
During a January fire in scrublands near Immokalee, Florida, 15 American
kestrels were observed hunting along the approximate 492 feet (150 m)
windward edge of the fire.  The linear concentration (1 bird/10 m) was a
hundredfold greater than that on utility lines in the area that same
winter.  American kestrels preyed exclusively on insects which flew away
from the fire into the wind [49].
  • 4.  Balgooyen, Thomas G. 1976. Behavior and ecology of the American kestrel        (Falco sparverius L.) in the Sierra Nevada of California. University of        California Publications in Zoology: No. 103. Berkeley, CA: University of        California Press. 85 p.  [22966]
  • 16.  Dodd, Norris L. 1988. Fire management and southwestern raptors. In:        Gliski, R. L.; Pendleton, Beth Giron; Moss, Mary Beth; [and others]
  • 26.  Hoffman, Mark L.; Collopy, Michael W. 1988. Historical status of the        American kestrel (Falco sparverius paulus) in Florida. Wilson Bulletin.        100(1): 91-107.  [22826]
  • 27.  Howell, Arthur H. 1932. Florida bird life. Tallahassee, FL: Florida        Department of Game and Fresh Water Fish. 579 p.  [22879]
  • 32.  Landers, J. Larry. 1987. Prescribed burning for managing wildlife in        southeastern pine forests. In: Dickson, James G.; Maughan, O. Eugene,        eds. Managing southern forests for wildlife and fish: a proceedings;        [Date of conference unknown]
  • 33.  Lehman, Robert N.; Allendorf, John W. 1989. The effects of fire, fire        exclusion and fire management on raptor habitats in the western United        States. In: Proceedings of the western raptor management symposium and        workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series        No. 12. Washington, DC: National Wildlife Federation: 236-244.  [22324]
  • 35.  Mason, Robert B. 1981. Response of birds and rodents to controlled        burning in pinyon-juniper woodlands. Reno, NV: University of Nevada. 55        p. Thesis.  [1545]
  • 40.  Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume        5. New Haven, CT: Yale University Press. 463 p.  [22303]
  • 49.  Smallwood, John A.; Woodrey, Mark; Smallwood, Nathan J.; Kettler, Mary        Anne. 1982. Foraging by cattle egrets and American kestrels at a fire's        edge. Journal of Field Ornithologists. 53(2): 171-172.  [13809]
  • 57.  Sprunt, Alexander, Jr. 1954. Florida bird life. New York: Coward-McCann,        Inc.; National Audubon Society. 527 p.  [22878]
  • 58.  Hoffman, Mark L.; Collopy, Michael W. 1987. Distribution and nesting        ecology of the American kestrel (Falco sparverius paulus) near Archer,        Florida. Raptor Research Reports. 6: 47-57.  [22825]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

Age at sexual maturity - Both sexes of American kestrels are capable of
breeding as yearlings [40].

Breeding season - The breeding season varies depending on geographic
area.  Pairs are sometimes formed from 6 to 14 weeks before laying
begins [40].  In Ontario, laying begins in early April [40].  In
California, American kestrels breed from early April to early September,
with peak activity between early June and late August [54].  In Montana,
courtship begins in May [17] and in Nevada, the breeding season occurs
from April to July [25].  In Florida, the southeastern kestrel generally
begins laying eggs in early or mid-April [7].

Clutch size and incubation - American kestrels generally lay three to
seven eggs [17,54].  They may raise two clutches in one season.  The
second clutch size is generally smaller than the first.  Yearlings lay
repeat clutches less often than do older birds.  American kestrels may
lay an additional clutch if the first clutch is destroyed [40].  The
eggs are incubated for 28 to 30 days [13,17,25,40].

Fledging - Nestlings fledge in 25 to 31 days [13,25,40].  Fledglings
continue to be fed by the parents until feather development is complete,
usually 12 days after nest departure [25,40].  The fledglings may
continue to stay with parents for 30 days or more [40].

Spring migration - Spring migration begins in February from northern
South America and Central America and begins in March in northern
Mexico.  In California, most birds have begun leaving wintering areas by
mid-February.  American kestrels wintering in Florida begin leaving in
February, and almost all have left by April.  In southern states from
the Rockies east, migration occurs from early March through April, and
in northern states mid-March to mid-April.  On the southern Canadian
prairies, most spring migration is in the last 3 weeks of April, but it
continues to about mid-May [40].

Fall migration - The juveniles leave the breeding range before the
adults [40] and mature female American kestrels generally arrive on
their wintering ground before males [46,47].  In warm climates some
adults stay on their breeding territories year-round [25].
Additionally, some American kestrels winter in northern urban areas that
have a year-round food supply and warm roosting places [40].

In Canada and the northern United States, fall migration begins in
September.  Arrival in Florida begins in September and lasts at least
well into October.  American kestrels arrive in southern Central America
south to Panama beginning in mid-October [40].  Southeastern kestrels
stay on their territories year-round [34].

Longevity - American kestrels have been reported to live up to 11 years
[40].  However, most do not live that long. Palmer [40] reported an
annual average survival of 12.6 months, the oldest bird being aged 9
years, 10 months.  Captives at the McGill University colony live an
average of 5 years and 2 months [40].
  • 7.  Bent, Arthur Cleveland. 1962. Life histories of North American wild        fowl. Part 1. New York: Dover Publications, Inc. 244 p.  [20027]
  • 13.  Campbell, R. Wayne; Dawe, Neil K.; McTaggart-Cowan, Ian; [and others]
  • 17.  DuBois, Kristi; Becker, Dale; Thornbrugh, Joe. 1987. Identification of        Montana's birds of prey. Montana Outdoors. 18(6): 11-31.  [3606]
  • 25.  Herron, Gary B.; Mortimore, Craig A.; Rawlings, Marcus S. 1985.        Red-tailed hawk. In: Nevada raptors: Their biology and management.        Biological Bulletin No. 8. Reno, NV: Nevada Department of Wildlife:        29-30.  [22694]
  • 34.  Loftin, Robert W. 1992. Use of nest boxes by the Florida kestrel.        Florida Field Naturalist. 20(3): 57-88.  [21375]
  • 40.  Palmer, Ralph S., editor. 1988. Handbook of North American birds. Volume        5. New Haven, CT: Yale University Press. 463 p.  [22303]
  • 46.  Smallwood, John A. 1987. Winter territoriality and predation ecology of        American kestrels (Falco sparverius) in southcentral Florida. Columbus,        OH: The Ohio State University. 128 p. Dissertation. In: Dissertation        Abstracts International. 48(9): 2542-B. Abstract.  [22831]
  • 47.  Smallwood, John A. 1988. A mechanism of sexual segregation by habitat in        American kestrels (Falco sparverius) wintering in south-central Florida.        Auk. 105(1): 36-46.  [22832]
  • 54.  Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife        and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37.        Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific        Southwest Forest and Range Experiment Station. 439 p.  [10237]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Average territory size was 109.4 ha and 129.6 ha in two western U.S. studies (Cade 1982); home range diameter during the breeding season ranged from about 0.5 to 2.4 km in different regions; see Palmer (1988) for further data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

American Kestrels have an alarm call which sounds like "killee killee killee."

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Hunts most actively in the morning and late afternoon; rests during the middle of the day.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

One researcher estimated that the average lifespan of American Kestrels as 12.6 months. One bird was recorded as reaching 11 years and 9 year old kestrals are not uncommon. Average lifespan in a captive colony was 5 years.

Range lifespan

Status: wild:
11.0 (high) years.

Average lifespan

Status: captivity:
5.0 years.

Average lifespan

Status: wild:
176 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Status: wild:
176 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17 years (captivity) Observations: In captivity, these animals live about 5 years compared to little over 1 year in the wild. The maximum longevity reported in the wild is 9.8 years (http://www.fs.fed.us/database/feis/). There is also anecdotal evidence suggesting one animal was alive at age 17 (John Terres 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

American Kestrels are cavity nesters, though they will sometimes nest on cliffs. The female lays 3 to 7 eggs (usually 4 or 5) over a period of 2 or 3 days. Eggs are white, cream or pale pink with an average size of 35 x 29 mm. Females do most of the incubating, which means the females sit on the nest to keep the eggs warm until they hatch. Males have been known to incubate occasionally, and both sexes have brooding patches (patches on their belly where skin is not covered by feathers). Eggs hatch after 29 to 30 days of incubation. The young chicks are non-competitive, meaning they don't fight among themselves for food.

Breeding interval: American Kestrels raise one family of chicks per year.

Breeding season: Breeding season varies with region, in eastern North America the breeding season ranges from mid-April through June.

Range eggs per season: 3.0 to 7.0.

Range time to hatching: 30.0 (high) days.

Average fledging age: 30.0 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average eggs per season: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Once chicks have hatched, females beg food from males. The female, in turn, feeds the young for the first 20 days. After that period, chicks beg for food from males and feed themselves on what he brings to the nest. After 30 days, chicks leave the nest. The family remains as a unit for some time. The survival rate of chicks is about 50% under natural conditions, but it is usually higher under better conditions, such as when using human-provided nesting boxes.

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

For up to six weeks before egg laying, females are promiscuous, mating with two or three males. Once a female settles with one mate, the pair mate frequently until egg laying. Three to seven eggs are laid (usually 4 or 5) over a period of 2 or 3 days. Eggs are white, cream or pale pink with an average size of 35 x 29 mm. Laying dates vary with geographical location:

Chile: September - October

Trinidad: May

Curacao: January

Florida: mid-March - early June

Central USA: mid-April - early June

Canada: late May - mid-June

The female does most of the incubation, but males have been known to occasionally sit. Both sexes have brooding patches. Incubation lasts 29 - 30 days and hatched chicks are non-competitive. Once chicks have hatched, females beg food from males. The female, in turn, feeds the young for the first 20 days. After that period, chicks beg for food from males and feed themselves. After 30 days, chicks leave the nest. The family remains as a unit for some time. The survival rate of chicks is about 50% under natural conditions, but it is usually higher under better conditions (e.g., human-provided nesting boxes).

Average time to hatching: 29 days.

Average eggs per season: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

See Palmer (1988) for egg dates. Clutch size is 3-7 (usually 4-5). Incubation mainly by female, lasts usually 29-31 days. Two broods a year may be raised in some areas (e.g., central North America [Toland 1985], Chile). Young are tended by both parents, leave nest in about 29-31 days, may stay with parents for 2-4 weeks or more (no later than late summer in U.S.). Readily lays replacement clutch if first clutch is lost. Most first breed at 1 year. Monogamy through successive breeding seasons seems to prevail (Palmer 1988). Nesting density varies greatly throughout range, depending on nest-site availability and probably food supply; may tolerate close nesting by other pairs in some regions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Falco sparverius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTATTTTCAACAAACCACAAAGACATTGGCACCCTATACCTACTCTTCGGAGCATGAGCAGGCATAGCCGGCACTGCCCTCAGCCTCCTTATCCGAGCAGAACTCGGACAACCAGGAACCCTCCTAGGAGAT---GACCAAATCTACAATGTCATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTTATACCCATTATGATCGGAGGATTTGGAAACTGACTAGTCCCCCTTATAATTGGAGCCCCAGACATAGCGTTTCCACGCATAAACAACATAAGCTTCTGACTCCTCCCCCCATCCTTCCTACTACTCCTAGCATCCTCCACAGTAGAAGCTGGGGTTGGGACAGGATGAACCGTATACCCCCCCTTAGCAGGCAACCTAGCCCATGCTGGCGCCTCAGTAGACCTAGCCATCTTCTCCCTACACCTCGCAGGTGTATCTTCCATTCTGGGGGCAATCAACTTTATCACAACAGCCATCAACATAAAACCCCCCGCCCTATCACAATACCAAACCCCACTATTCGTATGGTCCGTTCTCATCACCGCCGTCCTCCTACTGCTTTCACTCCCAGTACTAGCTGCCGGCATCACCATACTATTAACTGACCGAAACCTAAACACTACATTCTTTGACCCTGCTGGAGGAGGAGACCCCATTCTCTATCAACACCTGTTCTGATTCTTCGGCCACCCAGAAGTTTACATCTTAATTCTCCCCGGCTTTGGAATCATCTCCCATGTTGTAGCATATTACGCAGGTAAAAAAGAACCATTCGGCTATATAGGAATAGTCTGAGCCATATTATCAATTGGATTCCTAGGCTTCATCGTATGAGCCCACCACATATTTACCGTAGGAATAGACGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Falco sparverius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Information on state- and province-level protection status of animals in the
United States and Canada is available at NatureServe, although recent
changes in status may not be included.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There is an estimate of 1.2 million breeding pairs in North America. The availability of nesting places (tree-cavities) may be the main limiting factor in breeding populations of American Kestrels. Humans can help by installing nesting boxes.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The availability of nesting places (tree-cavities) may be the chief density limiting factor in breeding populations of American kestrels. This density can be increased by the installation of nesting boxes. However, whether or not additional nesting boxes are introduced, the bird is common.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Use of Fire in Population Management

More info for the terms: fire suppression, prescribed fire

Prescribed fire can be beneficial to American kestrel populations by
enhancing habitat and increasing the prey base [16,32,33].  In the
sandhills communities of Florida, fire suppression has caused some sites
to have dense understories, particularly of fire-intolerant rosemary
(Ceratiola ericoides).  Such sites may be unsuitable for southeastern
American kestrels and a program of prescribed burning in these habitats
is recommended [58].  Several studies indicate that many prey
populations increase rapidly subsequent to burning in response to
increased food availability [16,32].  Fire suppression in grasslands was
detrimental to small bird and mammal populations due to organic matter
accumulation and reduced plant vigor [55].

Prescribed burning plans should strive for creation of maximum
interspersion of openings and edge, with high vegetative diversity.
Habitats should be maintained in a random mosaic of open areas and
standing trees and snags should be conserved.  In most cases, burning
plans must be integrated with proper range management.  Reseeding of
perennial grasses as well as a period of rest from livestock grazing may
be necessary to achieve desired goals.  Burning should be deferred until
nesting is completed in areas where impact to breeding American kestrels
may occur.  After logging, Benson [6] suggested broadcast burning rather
than piling slash to reduce high temperature fires which may be
destructive to soil organisms and small mammals.  For more information
regarding the use of prescribed fire in specific habitats for the
benefit of raptors, see Dodd [16].

An extensive body of research has been published on fire effects on animals
in semidesert grassland, oak savanna, and Madrean oak woodlands of southeastern
Arizona, including the response of American kestrel to fire. See the Research Project Summary of this work for more information on
American kestrel and more than 100 additional species of birds, small
mammals, grasshoppers, and herbaceous and woody plant species.
  • 6.  Baker, W. Wilson. 1974. Longevity of lightning-struck trees and notes on        wildlife use. In: Proceedings, annual Tall Timbers fire ecology        conference; 1973 March 22-23; Tallahassee, FL. No. 13. Tallahassee, FL:        Tall Timbers Research Station: 497-504.  [19015]
  • 16.  Dodd, Norris L. 1988. Fire management and southwestern raptors. In:        Gliski, R. L.; Pendleton, Beth Giron; Moss, Mary Beth; [and others]
  • 32.  Landers, J. Larry. 1987. Prescribed burning for managing wildlife in        southeastern pine forests. In: Dickson, James G.; Maughan, O. Eugene,        eds. Managing southern forests for wildlife and fish: a proceedings;        [Date of conference unknown]
  • 33.  Lehman, Robert N.; Allendorf, John W. 1989. The effects of fire, fire        exclusion and fire management on raptor habitats in the western United        States. In: Proceedings of the western raptor management symposium and        workshop; 1987 October 26-28; Boise, ID. Scientific and Technical Series        No. 12. Washington, DC: National Wildlife Federation: 236-244.  [22324]
  • 55.  Wagle, R. F. 1981. Fire: its effects on plant succession and wildlife in        the Southwest. Tucson, AZ: University of Arizona. 82 p.  [4031]
  • 58.  Hoffman, Mark L.; Collopy, Michael W. 1987. Distribution and nesting        ecology of the American kestrel (Falco sparverius paulus) near Archer,        Florida. Raptor Research Reports. 6: 47-57.  [22825]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Considerations

More info for the terms: natural, snag

Although most American kestrel populations are currently stable or
increasing, there are numerous land use practices that could adversely
affect them [25].  Agriculture, wetland drainage, mineral exploration
and mining, recreational activities, and general urban development can
lead to nest site unsuitability and reduction of prey populations [12].
Additionally, the increased demand for firewood in recent years has
reduced the number of trees which are most suitable for nesting and
perching American kestrels.  Nest cavities excavated by woodpeckers are
seldom present in young stands.  There is also evidence that many of the
pesticides used for insect control adversely affect American kestrel
populations.  Accumulation of pesticide residues in the American kestrel
can result in lowered reproductive success or death of the individual
[25].

The lack of suitable nesting cavities has been suspected to be the
limiting factor for southeastern American kestrels [50].  In areas
formerly dominated by longleaf pine flatwoods in north-central Florida,
southeastern American kestrels have declined an estimated 82 percent
since the early 1940's.  Nest-site availability has decreased
significantly due to widespread logging of longleaf pine, plus the
clearing of isolated longleaf pine trees from agricultural fields.
Along the central Florida ridge in Lake, Orange, and Seminoli counties,
southeastern American kestrels declined with the conversion of the
original longleaf pine-turkey oak communities to citrus groves [26].

Nest boxes can provide nest sites for American kestrels in areas of
declining availability of natural cavities.  Nest box program goals
should include expansion and reestablishment of nesting habitat.  Nest
boxes require continuous maintenance so a program of snag management to
promote natural nest sites should occur along with a nest box program
[22].

Nest boxes are not always the optimal management tool.  Both predation
and parasitism can increase after boxes are installed.  Predator guards
must be installed on wooden poles and trees.  Annual cleaning and
replacement of wood shavings reduces parasite loads.  A major problem
with nest boxes is that European starlings (Sturnus vulgaris) also use
them.  In Iowa, occupied boxes were used by starlings 62 percent of the
time.  If starlings are controlled, American kestrels are more likely to
occupy the boxes [22].
 
American kestrels are fairly tolerant of human activity at the nest and
can be flushed from the nest and even caught on the nest without
abandonment [34].  In Ohio, American kestrels used areas nearer centers
of human activity than did other raptors wintering in the same area
[20].
  • 12.  Brye, Victoria J.; Siska, Janice M.; Spreyer, Mark F. 1991. Falcons. In:        Proceedings of the midwest raptor management symposium and workshop;        [Date of conference unknown]
  • 20.  Fischer, David L.; Ellis, Kevin L.; Meese, Robert J. 1984. inter habitat        selection of diurnal raptors in central Utah. Raptor Research. 18(3):        98-102.  [22704]
  • 22.  Gieck, Charlene M. 1991. Artificial nesting structures for bald eagles,        ospreys and American kestrels. In: Proceedings of the Midwest raptor        management symposium and workshop; [Date of conference unknown]
  • 25.  Herron, Gary B.; Mortimore, Craig A.; Rawlings, Marcus S. 1985.        Red-tailed hawk. In: Nevada raptors: Their biology and management.        Biological Bulletin No. 8. Reno, NV: Nevada Department of Wildlife:        29-30.  [22694]
  • 26.  Hoffman, Mark L.; Collopy, Michael W. 1988. Historical status of the        American kestrel (Falco sparverius paulus) in Florida. Wilson Bulletin.        100(1): 91-107.  [22826]
  • 34.  Loftin, Robert W. 1992. Use of nest boxes by the Florida kestrel.        Florida Field Naturalist. 20(3): 57-88.  [21375]
  • 50.  Smallwood, J. A.; Collopy, M. W. 1993. Management of the threatened        southeastern American kestrel in Florida: population responses to a        regional nest-box program. Journal of Raptor Research. 27(1): 81.        [22880]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: See Palmer (1988) for nest box design. See Varland and Loughlin (1993) for information on reproductive success of kestrels using nest boxes in several areas throughout North America (occupancy rate 25-73%, fledging success at least 90%).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

American kestrels play an important part in controlling creatures that humans usually consider a nuisance, such as mice or insects.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The American kestrel plays a prominent part in controlling creatures that humans usually consider a nuisance (mice, insects, etc.).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

American Kestrel

Male upperparts pattern
Adult female in Winnipeg, Canada

The American Kestrel (Falco sparverius), sometimes colloquially known as the Sparrow Hawk, is a small falcon, and the only kestrel found in the Americas. It is the most common falcon in North America, and is found in a wide variety of habitats. At 19–21 centimeters (7–8 in) long, it is also the smallest falcon in North America. It exhibits sexual dimorphism in size and plumage, although both sexes have a rufous back with noticeable barring. Juveniles are similar in plumage to adults.

The American Kestrel hunts by hovering in the air with rapid wing beats or perching and scanning the ground for prey. Its diet typically consists of grasshoppers, lizards, mice, and other small birds. It nests in cavities in trees, cliffs, buildings, and other structures. The female lays three to seven eggs, which both sexes help to incubate. It is a common bird to be used in falconry, especially by beginners.

Its breeding range extends from central and western Alaska across northern Canada to Nova Scotia, and south throughout North America, into central Mexico and the Caribbean. It is a local breeder in Central America and is widely distributed throughout South America. Most birds breeding in Canada and the northern United States migrate south in the winter. It is an occasional vagrant to western Europe.

Contents

Description

The American Kestrel is the smallest falcon in North America and, under traditional classification, is the smallest raptor in America.[2] The American Kestrel is sexually dimorphic, although there is some overlap in plumage coloration between the sexes. The bird ranges from 12 to 27 cm (4.7 to 11 in) in length with a wingspan of 50–61 cm (20–24 in). The female kestrel is larger than the male. The male weighs 80–105 g (2.8–3.7 oz), as opposed to the female which weighs 100–120 grams (3.5–4.2 oz). In standard measurements, the wing bone is 16–21 cm (6.3–8.3 in) long, the tail is 11–15 cm (4.3–5.9 in) and the tarsus is 3.2–4 cm (1.3–1.6 in).[3][4][5]

In contrast to many other raptor species, the sexes differ more in plumage than in size. Males have blue-grey wings with black spots and white undersides with black barring. The back is rufous, with barring on the lower half. The belly and flanks are white with black spotting. The tail is also rufous, with a white or rufous tip and a black subterminal band.[6] The back and wings of the female American Kestrel are rufous with dark brown barring. The undersides of the females are creamy to buff with heavy brown streaking. The tail is noticeably different from the male's, being rufous in color with numerous narrow dark black bars. Juveniles exhibit coloration patterns similar to the adults'.[6] In both sexes, the head is white with a bluish-grey top. There are also two narrow, vertical black facial markings on each side of the head, while other falcons have one.[7] Two black spots (ocelli) can be found on each side of the white or orangish nape.[8] The function of these spots is debated, but the most commonly accepted theory is that they act as "false eyes", and help to protect the bird from potential attackers.[9] The wings are moderately long, fairly narrow, and taper to a point.

Vocalizations

The American Kestrel has three basic vocalizations – the "klee" or "killy", the "whine", and the "chitter."[10] The "klee" is usually delivered as a rapid series – klee, klee, klee, klee when the kestrel is upset or excited. This call is used in a wide variety of situations and is heard from both sexes, but the larger females typically have lower-pitched voices than the males. The "whine" call is primarily associated with feeding, but is also uttered during copulation. The "chitter" is used in activities which involve interaction between male and female birds, including courtship feeding, copulation, and the feeding of nestlings.[11] Nestlings can produce calls similar to those of adults at 16 days old.[12]

Taxonomy

Until the sixth edition of the AOU Checklist of North American Birds was published by the American Ornithologists' Union in 1983, the most commonly used name for the American Kestrel was the Sparrow Hawk or Sparrowhawk. This was due to a mistaken connection with the Eurasian Sparrowhawk in the genus Accipiter. The sixth edition of the AOU Checklist corrected this, officially renaming the bird American Kestrel. Several other colloquial names for the kestrel are also in use, including Grasshopper Hawk, due to its diet, and Killy Hawk, due to its distinct call.[13]

The American Kestrel's scientific name, Falco sparverius, was given by Carolus Linnaeus in his 18th century work Systema Naturae.[14] The genus refers to the falcate, or hooked, shape of the beak, and the specific name means "pertaining to a sparrow", referring to the bird's small size and occasional hunting of sparrows.[13]

Seventeen subspecies of the American Kestrel are recognized, generally based upon plumage, size, and vocalizations:[15]

  • F. s. sparverius, described by Linnaeus in 1758, is the nominate subspecies. It is found in most of the United States, Canada, and Mexico.
  • F. s. paulus, described by Howe and King in 1902, is found in the Southeast United States, from Louisiana to Florida.
  • F. s. peninsularis, described by Mearns in 1892, is found in southern Baja California.
  • F. s. tropicalis, described by Griscom in 1930, is found from southern Mexico to northern Honduras.
  • F. s. nicaraguensis, described by Howell in 1965, is found in Honduras and Nicaragua.
  • F. s. sparveroides, described by Vigors in 1827, is found in Cuba and the Isle of Youth, and southern to central Bahamas.
  • F. s. dominicensis, described by Gmelin in 1788, is found in Hispaniola.
  • F. s. caribaearum, described by Gmelin in 1788, is found in Puerto Rico through the Lesser Antilles to Grenada.
  • F. s. brevipennis, described by Berlepsch in 1892, is found in the Netherlands Antilles.
  • F. s. isabellinus, described by Swainson in 1837, is found from Venezuela to northern Brazil.
  • F. s. ochraceus, described by Cory in 1915, is found in eastern Colombia and northwest Venezuela.
  • F. s. caucae, described by Chapman in 1915, is found in western Colombia.
  • F. s. aequatorialis, described by Mearns in 1892, is found in northern Ecuador.
  • F. s. peruvianus, described by Cory in 1915, is found in southwest Ecuador, Peru, and northern Chile.
  • F. s. fernandensis, described by Chapman in 1915, is found on the Juan Fernández Islands off Chile.
  • F. s. cinnamominu, described by Swainson in 1837, is found in Peru, Chile, and Argentina.
  • F. s. cearae, described by Cory in 1915, is found from northeast Brazil south to eastern Bolivia.

Ecology and behavior

Female about to pounce

American Kestrels are found in a wide variety of habitats, including grasslands, meadows, deserts, and other open to semiopen regions. They can also be found in both urban and suburban areas. A kestrel's habitat must include perches, open space for hunting, and cavities for nesting (whether natural or man-made).[16] The American Kestrel is able to live in very diverse conditions, ranging from above the Arctic Circle,[17] to the tropics of Central America, to elevations of over 4,500 meters (14,764 ft) in the Andes Mountains.[18] The bird is distributed from northern Canada and Alaska to the southernmost tip of South America, Tierra del Fuego. It is the only kestrel found in the Americas.[19] It has occurred as a vagrant in the UK, Denmark, Malta and the Azores.[20]

American Kestrels in Canada and the northern United States typically migrate south in the winter, sometimes going as far as Central America and the Caribbean. Birds that breed south of about 35 degrees north latitude are usually year-round residents. Migration also depends on local weather conditions.[21] Wintering kestrels' choice of habitat varies by sex. Females are found in open areas more often than males during the non-breeding season. A common explanation for this behavior is that the larger females arrive at the preferred habitat first and exclude males from their territory.[22]

The American Kestrel is not long-lived, with a lifespan of <5 years for wild birds.[23] The oldest banded wild bird was 11 years and 7 months,[24] while captive kestrels can live up to 14–17 years.[23] In a study, humans accounted for 43.2% of 1,355 reported deaths, which included direct killing and roadkills, while predation (including by larger birds of prey) accounted for 2.8%. This statistic is likely biased, however, as reported deaths are usually found near or in areas populated by humans.[23]

Feeding

Female eating a dead bird in California

American Kestrels feed largely on small animals such as grasshoppers, dragonflies, lizards, mice, and voles. They will occasionally eat other small birds. The kestrel has also been reported to have killed larger animals such as snakes, bats, and squirrels.[25] The kestrel maintains high population densities, in part because of the broad scope of its diet. The American Kestrel's primary mode of hunting is by perching and waiting for prey to come near. The bird is characteristically seen along roadsides or fields perched on objects such as trees, overhead power lines, or fence posts. It also hunts by hovering in the air with rapid wing beats and scanning the ground for prey. Other hunting techniques include low flight over fields, or chasing insects in the air.[26]

Prey is almost always caught on the ground. Before striking, the kestrel characteristically bobs its head and tail, then makes a direct flight toward the prey to grab it in its talons. During the breeding season, the bird will carry large prey back to its mate or young. One study found that an American Kestrel pair "foraged in ways that minimized the costs of energy acquisition in its particular situation". For example, if the success rate for catching prey decreases significantly in a particular area, the bird will move to a different area.[27]

A young bird in the sun

Reproduction

American Kestrels are sexually mature by their first spring.[28] In migratory populations, the males arrive at the breeding ground before females, then the female selects a mate. Pair bonds are strong, often permanent. Pairs usually use previous nesting sites in consecutive years. This gives birds an advantage over younger or invading individuals, as they would already be familiar with the hunting grounds, neighbors, predators, and other features of the site.[29] Males perform elaborate dive displays to advertise their territory and attract a mate. These displays consist of several climbs and dives, with three or four "klee" calls at their peaks. Females are promiscuous for about one to two weeks after their arrival at the nesting site. This is thought to stimulate ovulation.[30] Food transfers from the male to the female occur from about four to five weeks prior to egg laying to one to two weeks after.[31]

American Kestrels are cavity nesters, but they are able to adapt to a wide variety of nesting situations. They generally prefer natural cavities (such as in trees) with closed tops and tight fitting entrances, as to provide for maximum protection of the eggs and young.[32] Kestrels occasionally nest in holes created by large woodpeckers,[33] or use the abandoned nests of other birds, such as Red-tailed Hawks, Merlins, and crows.[34] They have been recorded nesting on cliff ledges and building tops, as well as in abandoned cavities in cactuses.[35] American Kestrels also commonly utilize nesting boxes.[36]

Three to seven eggs (typically four or five) are laid approximately 24–72 hours apart. The average egg size is 32 mm by 29 mm, 10% larger than average for birds of its body size. The eggs are white to cream in color with brown or grey splotching. Incubation usually lasts 30 days and is mainly the responsibility of the female, although the male incubates 15–20% of the time. Eggs which are lost are typically replaced in 11–12 days. Hatching takes place over three to four days. Hatchlings are altricial, and are only able to sit up after five days. They grow very quickly, reaching an adult weight after 16–17 days. After 28–31 days, their wings develop and they are able to leave the nest.[37]

Status and conservation

The American Kestrel is likely the most abundant falcon in North America, although its total population is difficult to quantify, as local populations can change quickly due to resource availability. Count data from the USGS Breeding Bird Survey (BBS) indicate that the North American breeding population is experiencing long-term and gradual but sustained declines, with some regions, such as New England and coastal California, exhibiting more rapid declines.[38][39] Count data from raptor migration corridors also indicate regional population declines and largely corroborate BBS data.[40] The North American population has been estimated at 1.2 million pairs, with the Central and South American populations being as large. A smaller estimate is 236,000 birds wintering in North America. A population increase occurred in the 18th and 19th centuries, probably due to deforestation for agriculture. The resulting pastures provided an ideal habitat for kestrels.[23]

Male with handler, San Diego Zoo

The southeastern U.S. subspecies (Falco sparverius paulus) has declined 82% since 1940 due to a decrease in nest site availability. This decline is a result of Longleaf Pines being cleared from agricultural fields.[41] Despite this, the American Kestrel is classed as Least Concern on the IUCN Red List.[1]

The Peregrine Fund, a leading non-profit organization advancing research and conservation of birds of prey worldwide, launched the American Kestrel Partnership in 2012.[42] The American Kestrel Partnership developed and maintains a web-based network for citizen and professional scientists to enter, manage, and consolidate data from kestrel nestbox monitoring programs in the Western Hemisphere. The database is being used by researchers to model and understand relationships between kestrel nesting parameters (e.g., phenology, occupancy, survival, productivity, and nestling weight and exposure to environmental toxins) and environmental factors, such as land use, landscape composition and configuration, climate conditions (e.g., drought), and point sources of environmental toxins. The American Kestrel Partnership's website, with support from the Cornell Laboratory of Ornithology, features two live, streaming video feeds from a kestrel nestbox and breeding pair on The Peregrine Fund's campus in Boise, Idaho.[42]

Relationship with humans

One important use of American Kestrels is in falconry. Although most falconers prefer larger birds such as Peregrine Falcons and Northern Goshawks when hunting, kestrels can be used to catch small birds, insects, and rodents. American Kestrels are also often used in scientific studies, because they can be bred easily in captivity. By artificially manipulating the daylight hours in captivity, scientists have bred them more than once a year.[43]

Migratory raptors native to the United States are protected by the Migratory Bird Treaty Act of 1918, so American Kestrels are illegal to possess without a permit in the United States, Canada, and Mexico.[44]

References

  1. ^ a b BirdLife International (2012). "Falco sparverius". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ The American Kestrel: Falcon of Many Names by Wauer and Clark. Johnson Books (2005), ISBN 1555663532
  3. ^ McCollough. "American Kestrel Falco sparverius". University of Michigan Museum of Geology. Archived from the original on 13 September 2010. Retrieved 13 September 2010. 
  4. ^ Raptors of the World by Ferguson-Lees, Christie, Franklin, Mead & Burton. Houghton Mifflin (2001), ISBN 0-618-12762-3
  5. ^ American Kestrel, Life History, All About Birds – Cornell Lab of Ornithology. Allaboutbirds.org. Retrieved on 2013-02-25.
  6. ^ a b "American Kestrel, Falco sparverius". Cornell Lab of Ornithology. Retrieved 13 September 2010. 
  7. ^ Tveten & Tveten (2004), p. 210
  8. ^ Clark & Wheeler (2001), p. 252
  9. ^ Negro, Juan José; Bortolotti, Gary R.; Sarasola, José Hernán (2007). "Deceptive plumage signals in birds: manipulation of predators or prey?". Biological Journal of the Linnean Society (Linnean Society of London) 90 (3): 467–477. doi:10.1111/j.1095-8312.2007.00735.x. 
  10. ^ Mueller, Helmut C. (1971). "Displays and Vocalizations of the Sparrow Hawk". The Wilson Bulletin (Wilson Ornithological Society) 83 (3): 249–254. 
  11. ^ Wauer (2005), pp. 11–12
  12. ^ Smallwoood, John A.; Dudajek, Valerie (2003). "Vocal Development in American Kestrel (Falco sparverius) Nestlings". Journal of Raptor Research (Raptor Research Foundation) 37 (1): 37–43. 
  13. ^ a b Wauer (2005), p. 4
  14. ^ Linnaeus, Carolus (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata (in Latin). Holmiae: Laurentii Salvii. p. 152. 
  15. ^ Smallwood, John A.; Bird, David M. (2002). "American Kestrel: Systematics". Cornell Lab of Ornithology. Retrieved 4 September 2010. 
  16. ^ "American Kestrel, Life History". All About Birds. Cornell Lab of Ornithology. Retrieved 3 September 2010. 
  17. ^ Wauer (2005), p. 15
  18. ^ Fjeldså & Krabbe (1990), p. 112
  19. ^ Smallwood, John A.; Bird, David M. (2002). "American Kestrel: Introduction". Cornell Lab of Ornithology. Archived from the original on 26 September 2010. Retrieved 2 November 2010. 
  20. ^ Snow, David; Perrins, Christopher M (editors) (1998). The Birds of the Western Palearctic concise edition (2 volumes). Oxford: Oxford University Press. p. 152. ISBN 0-19-850188-9. 
  21. ^ Wauer (2005), pp. 23–24
  22. ^ Ardia, Daniel R.; Bildstein, Keith L. (1997). "Sex-related differences in habitat selection in wintering American kestrels,Falco sparverius". Animal Behavior (The Association for the Study of Animal Behaviour) 53 (6): 1305–1311. doi:10.1006/anbe.1996.0364. 
  23. ^ a b c d Smallwood, John A.; Bird, David M. (2002). "American Kestrel: Demography and Populations". Cornell Lab of Ornithology. Retrieved 27 May 2012. 
  24. ^ Clapp, Roger B.; Klimkiewicz, M. Kathleen; Kennard, John H. (1982). "Longevity Records of North American Birds: Gaviidae through Alcidae". Journal of Field Ornithology (Association of Field Ornithologists) 53 (2): 81–124. JSTOR 4512701. 
  25. ^ Sherrod, Steve K. (1978). "Diets of North American Falconiformes". Journal of Raptor Research (Raptor Research Foundation) 12 (2): 103–106. 
  26. ^ Collopy, Michael W.; Koplin, James R. (1983). "Diet, Capture Success, and Mode of Hunting by Female American Kestrels in Winter". The Condor (Cooper Ornithological Society) 85 (3): 69–371. doi:10.2307/1367081. JSTOR 136708. 
  27. ^ Rudolph, Seri G. (1982). "Foraging Strategies of American Kestrels During Breeding". Ecology (Ecological Society of America) 63 (5): 1268–1276. doi:10.2307/1938854. JSTOR 1938854. 
  28. ^ Duncan, James, R.; Bird, David M. (1989). "The influence of relatedness and display effort on the mate choice of captive female American kestrels". Animal Behavior (The Association for the Study of Animal Behaviour) 37: 112–117. doi:10.1016/0003-3472(89)90011-0. 
  29. ^ Wauer (2005), p. 52
  30. ^ Wauer (2005), p. 54
  31. ^ Smallwood, John A.; Bird, David M. (2002). "American Kestrel: Behavior". Cornell Lab of Ornithology. Retrieved 25 September 2010. 
  32. ^ Wauer (2005), p. 55
  33. ^ Gault, Kathleen E.; Walters, Jeffrey R.; Tomcho, Joseph, Jr.; Phillips, Louis F., Jr.; Butler, Andrew (2004). "Nest Success of Southeastern American Kestrels Associated with Red-Cockaded Woodpeckers in Old-Growth Longleaf Pine Habitat in Northwest Florida". Southeastern Naturalist (Humboldt Field Research Institute) 3 (2): 191–204. doi:10.1656/1528-7092(2004)003[0191:NSOSAK]2.0.CO;2. ISSN 1528-7092. JSTOR 3878098. 
  34. ^ Wauer (2005), pp. 55–56
  35. ^ Smith, Dwight G.; Wilson, Charles R.; Frost, Herbert H. (1972). "The Biology of the American Kestrel in Central Utah". The Southwestern Naturalist (Southwestern Association of Naturalists) 17 (1): 73–83. doi:10.2307/3669841. JSTOR 3669841. 
  36. ^ Rohrbaugh, Ronald W., Jr.; Yahner, Richard H. (1997). "Effects of Macrohabitat and Microhabitat on Nest-Box Use and Nesting Success of American Kestrels". The Wilson Bulletin (Wilson Ornithological Society) 109 (3): 410–423. JSTOR 4163837. 
  37. ^ Wauer (2005), pp. 59–63
  38. ^ Sauer, J.R.; Hines, J.E.; Fallon, J.E.; Pardieck, J.L.; Ziolkowski,Jr., D.J.; Link, W.A. (2011). "The North American Breeding Bird Survey, Results and Analysis 1966 – 2010. Version 12.07.2011". USGS Patuxent Wildlife Research Center. Retrieved 27 May 2012. 
  39. ^ "American Kestrel Partnership: population declines". The Peregrine Fund. 2012. Retrieved 27 May 2012. 
  40. ^ "Raptor Population Index, Regional Population Trend Summaries 2011". Raptor Population Index. 2012. Retrieved 27 May 2012. 
  41. ^ Hoffman, Mark L.; Collopy, Michael W. (1988). "Historical Status of the American Kestrel (Falco sparverius paulus) in Florida". The Wilson Bulletin (Wilson Ornithological Society) 100 (1): 91–107. JSTOR 4162520. 
  42. ^ a b "American Kestrel Partnership". The Peregrine Fund. 2012. Retrieved 27 May 2012. 
  43. ^ Wauer (2005), pp. 75–76
  44. ^ "Legal Requirements for Raptor Possession". Bureau of Land Management. 15 July 2008. Archived from the original on 21 August 2010. Retrieved 29 October 2010. 

Cited books

  • Clark, William S.; Wheeler, Brian K. (2001). A field guide to hawks of North America. New York, NY: Houghton Mifflin Harcourt. ISBN 0-395-67067-5. 
  • Fjeldså, Jon; Krabbe, Niels (1990). Birds of the High Andes: A Manual to the Birds of the Temperate Zone of the Andes and Patagonia, South America. Svendborg, Denmark: Apollo Books. ISBN 87-88757-16-1. 
  • L. Tveten, John; Tveten, Gloria (2004). "Our Smallest Falcon—American Kestrel: 198/1996". Our life with birds: a nature trails book. College Station, TX: Texas A&M University Press. ISBN 1-58544-380-8. 
  • Wauer, Roland H. (2005). The American kestrel: falcon of many names. Boulder, CO: Johnson Books. ISBN 1-55566-353-2. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Olsen et al. (1989) for a study of relationships within the genus FALCO based on electrophoretic patterns of feather proteins.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!