Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

Grey-headed albatrosses normally breed every two years; if a chick is successfully reared the parents will not breed the following year. The nest is made of a cone of mud lined with grasses and all albatrosses lay only one egg. The egg is laid in mid-October and hatches during December. The male performs almost all of the incubation, which he carries out for the first 70 days. The chick takes three to four days to chip out of the egg and is then guarded for approximately three weeks. Most young depart from their natal nest the following May. The youngest recorded breeding bird was seven, and these birds can live to at least 36 years old (3). This albatross feeds while on the sea surface and, even during breeding seasons when restricted by parental duties, undertakes marathon feeding trips, travelling up to 13,000 km on a single feeding flight (3) (6). The diet consists of fish, squid and crustaceans; although young seem to be fed mainly lampreys by their parents (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This medium-sized albatross possesses a distinctive combination of a grey head and neck, black bill, dark grey back and tail and a white breast. The underwing is white, but with black on the leading edge. One of the grey-headed albatross' most distinguishing features is its black bill, which has bright yellow ridges along the top and bottom edges, ending in a pink tip (5). Additionally, a white crescent exists behind the eye. Juveniles have a predominantly black bill and head, a darker nape than adults, indistinct white eyebrows and virtually no white on the underwing (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Thalassarche chrysostoma has a circumpolar distribution over cold subantarctic and Antarctic waters (ACAP 2009). It breeds on South Georgia (Georgias del Sur), Islas Diego Ramirez and Ildefonso (Chile), Prince Edward and Marion Islands (South Africa), Crozet Islands, Kerguelen Islands (French Southern Territories), Campbell Island (New Zealand) and Macquarie Island (Australia). The annual breeding population is c.95,000 pairs, equivalent to a total population of c.250,000 mature individuals in this biennially breeding bird (Croxall and Gales 1998, Brooke 2004). Approximately half the global population occurs on South Georgia (ACAP 2009). Its range at sea while breeding lies largely within or south of the Antarctic Polar Frontal Zone (Prince et al. 1998, Phillips et al. 2004). During the non-breeding season South Georgia birds have been recorded making one or more global circumnavigations, the fastest in just 46 days (Croxall et al. 2005). All New Zealand banded birds have been recovered west of New Zealand in Australian zone (G. Taylor in litt. 2008). At South Georgia, the population is estimated to have declined by 25% between 1977 and 2004 (Poncet et al. 2006; R. Phillips verbally 2012), while on Campbell Island the population underwent major declines prior to 1997 but has apparently since stabilised (W. Misiak in litt. 2013). Population trends are unknown for Chile, Iles Kerguelen and Iles Crozet (representing around one third of the global population), and increasing on Marion Island (ACAP 2012). Very rapid overall declines appear to be taking place even if it is assumed colonies without trend information have remained stable.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Circumpolar high s latitudes; ranges s oceans north to 35°S.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The grey-headed albatross breeds on sub-Antarctic islands along with black-browed albatross (6). The main populations are in the South Atlantic Sector of the Southern Ocean (3), but there are colonies in Diego Ramirez and Islas Ildefonso south of Chile, South Georgia in the South Atlantic, Prince Edward, Crozet and Kerguelen groups in the South Indian Ocean, Macquarie Island south of Australia, and Campbell Island south of New Zealand (5). Found in colder waters during the summer, this species moves northward into the subtropics during the southern winter. These birds have been recorded to circumnavigate the globe, sometimes twice, when they are not breeding (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is a biennial breeder, although 5.4% and 1% of successful breeders on Marion Island and Bird Island respectively, attempt to breed annually. Birds return to colonies between late September and early October, laying occurs in October and chicks hatch by December. Chicks fledge from April to May, returning to breeding colonies at the earliest at three years of age but generally at six or seven years old. First breeding can begin as early as seven years, but the average age on Campbell Island is 13.5 years old and the modal age on South Georgia is 12 years old. It feeds by surface-seizing but can also dive up to depths of six metres (ACAP 2009). Substantial segregation in foraging areas is apparent for male and female Grey-headed Albatross during incubation at South Georgia, with males travelling on average further than females (Phillips et al. 2004). At Iles Kerguelen, Campbell Island and South Georgia (Islas Georgias del Sur), the species is principally an oceanic forager, concentrating in the Antarctic Polar Frontal Zone and associated oceanic upwellings. However, in years of low availability, chick-rearing birds from South Georgia (Islas Georgias del Sur) forage mainly in Antarctic shelf-slope waters around the South Shetland Islands and the Antarctic Peninsula. Prey biogeography also indicates some neritic foraging around Iles Kerguelen and Campbell Island during chick rearing (ACAP 2009). On Marion Island, incubating birds foraged in the Sub-tropical Frontal Zone and the Subantarctic Zone in association with what are most likely eddies. In contrast, during chick rearing, foraging was concentrated in the Subantarctic and Polar Frontal Zones to the south-west of the island, also in association with eddies (Nel et al. 2000, Nel et al. 2001). Habitat Breeding It breeds on steep slopes or cliffs, generally with tussock-grass. Diet Its diet is variable with locality and year (ACAP 2009). It feeds mainly on cephalopods and fish, but crustaceans, carrion and lampreys are locally important (Prince 1980, Cherel et al. 2002, Xavier et al. 2003, Arata et al. 2004). It actively scavenges longline baits.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 436 specimens in 1 taxon.
Water temperature and chemistry ranges based on 430 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.207 - 15.091
  Nitrate (umol/L): 1.697 - 28.640
  Salinity (PPS): 32.635 - 35.132
  Oxygen (ml/l): 5.810 - 8.188
  Phosphate (umol/l): 0.358 - 1.965
  Silicate (umol/l): 1.974 - 65.072

Graphical representation

Temperature range (°C): -1.207 - 15.091

Nitrate (umol/L): 1.697 - 28.640

Salinity (PPS): 32.635 - 35.132

Oxygen (ml/l): 5.810 - 8.188

Phosphate (umol/l): 0.358 - 1.965

Silicate (umol/l): 1.974 - 65.072
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 22004 specimens in 1 taxon.
Water temperature and chemistry ranges based on 21260 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.605 - 18.067
  Nitrate (umol/L): 0.831 - 28.640
  Salinity (PPS): 32.669 - 34.504
  Oxygen (ml/l): 5.443 - 8.188
  Phosphate (umol/l): 0.324 - 2.046
  Silicate (umol/l): 1.074 - 82.197

Graphical representation

Temperature range (°C): -1.605 - 18.067

Nitrate (umol/L): 0.831 - 28.640

Salinity (PPS): 32.669 - 34.504

Oxygen (ml/l): 5.443 - 8.188

Phosphate (umol/l): 0.324 - 2.046

Silicate (umol/l): 1.074 - 82.197
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding takes place on steep slopes, rocky shores or cliffs, ususally in areas of tussock grass (2). Otherwise found over the open ocean far from shore, often travelling vast distances (1) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding Category

Visitor
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 30 years (wild) Observations: These animals have been estimated to live at least up to 30 years in the wild (http://www.demogr.mpg.de/longevityrecords), though detailed studies are lacking.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Thalassarche chrysostoma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Diomedea chrysostoma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACCGATGACTATTTTCAACCAACCATAAAGATATCGGCACACTATACTTAATTTTTGGTGCATGAGCCGGCATAGTCGGAACCGCACTCAGCTTACTTATCCGTGCAGAACTTGGTCAGCCAGGAACCCTCCTGGGAGAC---GACCAAATCTACAATGTAATCGTCACCGCTCATGCCTTCGTAATAATCTTCTTTATAGTAATACCAATCATGATTGGAGGATTTGGAAACTGACTAGTACCACTTATAATTGGTGCACCTGACATAGCATTTCCACGTATAAATAATATAAGCTTCTGATTACTGCCCCCATCCTTCCTCCTCCTACTAGCATCCTCCACAGTAGAAGCAGGAGCAGGTACAGGATGAACTGTGTACCCGCCTCTAGCTGGCAACCTTGCCCACGCAGGGGCTTCAGTAGACCTGGCCATCTTCTCCCTCCACCTAGCAGGTGTTTCATCAATCCTAGGAGCAATTAACTTCATCACAACTGCCATCAATATAAAACCCCCAGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTCATTACTGCCGTCTTACTCTTACTTTCACTACCTGTCCTTGCCGCCGGTATTACTATACTACTAACAGATCGAAACCTAAATACTACATTCTTCGACCCAGCTGGAGGAGGGGACCCAGTCCTATATCAACATCTTTTCTGATTCTTTGGTCACCCAGAAGTCTACATTTTAATTTTACCTGGCTTTGGAATCATCTCGCATGTAGTAACATACTACGCAGGTAAAAAAGAACCGTTCGGCTACATAGGAATAGTATGAGCCATACTCTCCATTGGATTCCTGGGCTTCATCGTATGGGCCCACCATATATTTACAGTAGGAATAGACGTAGACACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Diomedea chrysostoma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A4bd

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Arata, J., Cooper, J., Croxall, J., Gales, R., Phillips, R., Robertson, C., Ryan, P.G., Xavier, J. & Misiak, W.

Justification
This species has been uplisted to Endangered as data from some major colonies, in particular South Georgia (Georgias del Sur), which holds around half the global population, suggest that overall declines are taking place at a very rapid rate over three generations (90 years), even if colonies lacking trend information are assumed to be stable. The major driver of declines is likely to be incidental mortality on longline fisheries.


History
  • 2012
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU – A4bd) on the IUCN Red List 2004 (1), and listed on Appendix II of the Convention on the Conservation of Migratory Species (CMS) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There are an estimated c.95,000 pairs breeding per year of this biennially breeding species, based on annual breeding population estimates of 47,674 pairs on South Georgia in 2004 (Poncet et al. 2006), 17,187 pairs in Chile in 2003 (Robertson et al. 2007), 7,905 pairs on Kerguelen in 1985 (Weimerskirch et al. 1988), 7,800 pairs on Campbell Island (Moore 2004), 6,709 pairs on Marion Island in 2013 (ACAP unpubl. data), 5,946 on Crozet in 1982 (Jouventin et al. 1984), 2,000 pairs on Prince Edward Island in 2009 (Ryan et al. 2009) and 69 pairs on Macquarie Island in 2013 (ACAP unpubl. data). This is thought to be equivalent to at least 250,000 mature individuals (Croxall and Gales 1998, Brooke 2004).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
As this species generally forages over oceanic waters it is less likely to encounter longline fisheries targeting Patagonian toothfish in shelf areas, although mortality of breeding birds is still recorded in these fisheries (ACAP 2009). In Australian waters, up to c.400 individuals (>80% juvenile) were killed annually in 1989-1995 by Japanese longliners (Gales et al. 1998). In the Indian Ocean, illegal or unregulated fishing for Patagonian toothfish Dissostichus eleginoides killed an estimated 10,000-20,000 albatrosses (mainly this species) in 1997 and 1998 (CCAMLR 1997, CCAMLR 1998). At Campbell, the long-term decline, which began well before local longline fishery development, appears to be caused by environmental factors, possibly rising sea-surface temperatures resulting in food shortages, but longline fisheries beyond the New Zealand Exclusive Economic Zone (EEZ) may also contribute (Waugh et al. 1999). The species is not caught on fishing vessels monitored by New Zealand observers within the EEZ (G. Taylor in litt. 2008). Outside of EEZs, due to its circumpolar distribution, T. chrysostoma is potentially vulnerable to Southern Ocean pelagic fisheries worldwide. The extensive use of the Subtropical Convergence and Sub-Antarctic Zones by incubating birds from Marion Island, especially females, bring them into contact with intense southern bluefin tuna Thunnus maccoyii longline fishing activity in international waters (40-45°) (ACAP 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is in sharp decline in all monitored populations, with an estimated overall decrease of 48% over three generations (90 years). As with many other albatross species, this decline is largely owing to mortality on longline fisheries (1). In Australian waters up to approximately 400 individuals (over 80% juvenile) were killed annually between 1989 and 1995 by Japanese longliners. In the Indian Ocean an estimated 10,000-20,000 albatrosses, mainly the grey-headed albatross, were killed in 1997 and 1998 by illegal or unregulated fishing for Patagonian toothfish (Dissostichus eleginoides). In contrast, the long-term decline at Cambell appears to be caused predominantly by environmental factors, with rising sea-surface temperatures thought to be causing food shortages (7). Squid fisheries may also impact on populations in some areas (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
CMS Appendix II and ACAP Annex 1. Population monitoring and foraging studies are being undertaken at South Georgia, Diego Ramirez, Marion, Macquarie and Campbell Islands. Macquarie and Campbell are World Heritage Sites and the Prince Edward Islands are a Special Nature Reserve.

Conservation Actions Proposed
Continue existing monitoring and commence at poorly-known sites (Environment Australia 1999). Determine migration patterns in off seasons from other populations and overlap with fisheries, particularly those operating in the southern Indian Ocean. Promote adoption of best-practice mitigation measures in all fisheries within the species's range, particularly via intergovernmental mechanisms such as ACAP, CCAMLR and FAO.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The grey-headed albatross is listed on Appendix II on the Convention on the Conservation of Migratory Species (CMS), which states that these species would significantly benefit from international cooperation (4). It is also on Annex 1 of the Agreement on the Conservation of Albatrosses and Petrels (ACAP), which seeks to coordinate activity to mitigate known threats to albatrosses (8). Population monitoring and foraging studies are being undertaken at South Georgia, Diego Ramirez, Marion, Macquarie and Cambell Islands. Macquarie and Cambell are World Heritage Sites and the Prince Edward Islands are a special Nature Reserve (7). As with all migratory species, however, it is unlikely that conservation action by one country acting independently of other nations will be fully effective, and clearly international action is required (8). Crucially, progress needs to be made in preventing entanglement in fishing gear and bycatch by longline fisheries if this albatross is to flourish once more.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

IUCN Red List Category

Vulnerable
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Grey-headed albatross

The grey-headed albatross (Thalassarche chrysostoma) also known as the grey-headed mollymawk, is a large seabird from the albatross family. It has a circumpolar distribution, nesting on isolated islands in the Southern Ocean and feeding at high latitudes, further south than any of the other mollymawks. Its name derives from its ashy-grey head, throat and upper neck.

Taxonomy[edit]

Mollymawks are a type of albatross that belong to the Diomedeidae family and come from the Procellariiformes order, along with shearwaters, fulmars, storm petrels, and diving petrels. They share certain identifying features. First, they have nasal passages that attach to the upper bill called naricorns. Although the nostrils on the albatross are on the sides of the bill. The bills of Procellariiformes are also unique in that they are split into between seven and nine horny plates. Finally, they produce a stomach oil made up of wax esters and triglycerides that is stored in the proventriculus. This is used against predators as well as an energy rich food source for chicks and for the adults during their long flights.[3] They also have a salt gland that is situated above the nasal passage and helps desalinate their bodies, due to the high amount of ocean water that they imbibe. It excretes a concentrated brine from the nostrils.[4]

Etymology[edit]

The name chrysostoma is derived from two Greek words. Khrusos means "gold" and stoma means "the mouth", in reference to its golden bill.[5]

Description[edit]

The grey-headed albatross averages 81 cm (32 in) in length and 2.2 m (7.2 ft) in wingspan. Weight can range from 2.8 to 4.4 kg (6.2 to 9.7 lb), with a mean mass of 3.65 kg (8.0 lb).[6] It has a dark ashy-grey head, throat, and upper neck, and its upper wings, mantle, and tail, are almost black. It has a white rump, underparts, and a white crescent behind its eyes. Its bill is black, with bright yellow upper and lower ridges, that shades to pink-orange at the tip. Its underwings are white with a lot of black on the leading edge and less on the trailing edge. Juveniles have a black bill and head and a darker nape. Its eye crescent is indistinct and its underwing is almost completely dark.[7]

Range and habitat[edit]

Breeding population and trends[7]
LocationPopulationDateTrend
South Georgia Island48,000 pairs2006Declining
Marion Island6,200 pairs2003Stable
Prince Edward Island3,000 pairs2003
Campbell Island7,800 pair2004Declining
Macquarie Island84 pairs1998
Crozet Islands5,940 pairs1998
Kerguelen Islands7,905 pairs1998
Islas Diego Ramirez16,408 pairs2002
Total250,0002004Decreasing

Grey-headed albatrosses nest in colonies on several islands in the Southern Ocean, with large colonies on South Georgia in the South Atlantic, and smaller colonies on Islas Diego Ramírez, Kerguelen Islands, Crozet Islands, Marion Island, and Prince Edward Island in the Indian Ocean, Campbell Island and Macquarie Island south of New Zealand, and Chile. While breeding, they will forage for food within or south of the Antarctic Polar Frontal Zone.[8][9] Birds that roost in the Marion Island area forage for food in the sub-tropical zone.[10] Juveniles or non-breeding adults fly freely throughout all the southern oceans,[7] north to 35°S.[11]

Behaviour[edit]

Chick at nest

Feeding[edit]

At sea the grey-headed albatross is highly pelagic, more so than other mollymawks, feeding in the open oceans rather than over the continental shelves. They feed predominantly on squid, taking also some fish, crustacea, carrion, cephalopods, and lampreys.[12][13][14][15] Krill is less important as a food source for this species, reflecting their more pelagic feeding range. They are capable of diving as deep as 7 m (23 ft) to chase prey, but do not do so frequently.

Reproduction[edit]

A single egg is laid in a large nest, typically built on steep slopes or cliffs with tussock grass,[7] and incubated for 72 days. Studies at South Georgia's Bird Island have shown that the growing chick is fed 616 g (21.7 oz) of food every 1.2 days, with the chick increasing in weight to around 4,900 g (170 oz). Chicks then tend to lose weight before fledging, which happens after 141 days. Chick will generally not return to the colony for 6–7 years after fledging, and will not breed for the first time until several years after that.[citation needed] If a pair has managed to successfully raise a chick it will not breed in the following year, taking the year off.[7] During this time spent away from the colony they can cover great distances, often circling the globe several times.

Conservation[edit]

Flying in Drake's Passage, Southern Ocean

The IUCN classifies this bird as vulnerable due to rapidly declining numbers.[1] It has an occurrence range of 79,000,000 km2 (31,000,000 sq mi) and a breeding range of 1,800 km2 (690 sq mi),[7] with a population, estimated in 2004, of 250,000.[16][17] Estimates place 48,000 pairs at South Georgia Island,[18] 6,200 on Marion Island,[19] 3,000 pairs on Prince Edward Island,[20] 7,800 pairs on Campbell Island,[21] 16,408 pairs in Chile,[22] 84 pairs on Macquarie Island, 5,940 on Crozet Island, and 7,905 on Kerguelen Islands[23]

Populations have been shrinking based on different studies. Bird Island numbers have been reduced 20% to 30% in the last 30 years.[24] Marion Island registered 1.75% reduction per year until 1992 and now appears to be stable.[25] Campbell Island has seen reduction of 79% to 87% since the 1940s.[26] Overall, the trends looks like a 30-40% reduction over 90 years (3 generations).[7] Illegal or unregulated fishing in the Indian Ocean for the Patagonian toothfish, Dissostichus eleginoides resulted in 10-20,000 dead albatrosses, mainly this species, in 1997 and 1998.[27][28][29] Longline fishing is responsible for other deaths.[23] Finally, possible food loss due to rising ocean temperatures may be affecting this species.

To assist this species, studies are being undertaken at most of the islands. Also, Prince Edward Island is a special nature preserve, and Campbell Island and Macquarie Island are World Heritage Sites[citation needed].

Footnotes[edit]

  1. ^ a b BirdLife International (2013). "Thalassarche chrysostoma". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Brands, S. (2008)
  3. ^ Double, M. C. (2003)
  4. ^ Ehrlich, Paul R. (1988)
  5. ^ Gotch, A. F. (1995)
  6. ^ Brooke, Michael, Albatrosses and Petrels across the World (Bird Families of the World). Oxford University Press (2004), ISBN 978-0-19-850125-1
  7. ^ a b c d e f g BirdLife International (2008)
  8. ^ Prince, et al. (1998)
  9. ^ Phillips, et al. (2004)
  10. ^ Nel, et al. (2001)
  11. ^ Clements, James (2007)
  12. ^ Prince (1980)
  13. ^ Cherel, et al. (2002)
  14. ^ Xavier, et al. (2003)
  15. ^ Arata, et al. (2004)
  16. ^ Croxall & Gales (1998)
  17. ^ Brooke, (2004)
  18. ^ Poncet, et al. (2006)
  19. ^ Crawford, et al. (2003)
  20. ^ Ryan, et al. (2003)
  21. ^ Moore (2004)
  22. ^ Arata & Morena (2002)
  23. ^ a b Gales (1998)
  24. ^ Croxall et al. (1998)
  25. ^ Nel et al. (2002)
  26. ^ Taylor, (2000)
  27. ^ CCAMLR (1997)
  28. ^ CCAMLR (1998)
  29. ^ Nel et al. (2002a)

References[edit]

  • Arata, J.; Moreno, C. A. (2002). "Progress report of Chilean research on albatross ecology and conservation". Convention for the Conservation of Antarctic Marine Living Resources Working Group on Fish Stock Assessment. 
  • Arata, J.; Robertson, G.; Valencia, J.; Xavier, J. C.; Moreno, C. A. (2004). "Diet of Grey-headed Albatrosses at Diego Ramirez Islands, Chile: ecological implications". Antarctic Science (16): 263–275. 
  • BirdLife International (2008). "Grey-headed Albatross - BirdLife Species Factsheet". Data Zone. Retrieved 22 Feb 2009. 
  • Brands, Sheila (14 Aug 2008). "Systema Naturae 2000 / Classification - Diomedea subg. Thalassogeron -". Project: The Taxonomicon. Retrieved 22 Feb 2009. 
  • Brooke, M. (2004). "Procellariidae". Albatrosses And Petrels Across The World. Oxford, UK: Oxford University Press. ISBN 0-19-850125-0. 
  • CCAMLR (1998). Report of the XVII meeting of the Scientific Committee. Hobart (Hobart, Australia: Committee for the Conservation of Antarctic Marine Living Resources). 
  • CCAMLR (1997). Report of the XVI meeting of the Scientific Committee. Hobart (Hobart, Australia: Committee for the Conservation of Antarctic Marine Living Resources). 
  • Cherel, Y.; Weimerskirch, H.; Trouve, C. (2002). "Dietary evidence for spatial foraging segregation in sympatric albatrosses (Diomedea spp.) rearing chicks at Iles Nuageuses, Kerguelen". Marine Biology (141): 1117–1129. 
  • Clements, James (2007). The Clements Checklist of the Birds of the World (6 ed.). Ithaca, NY: Cornell University Press. ISBN 978-0-8014-4501-9. 
  • Crawford, R. J. M.; Cooper, J.; Dyer, B. M.; Greyling, M.; Klages, N. T. W.; Ryan, P. G.; Petersen, S.; Underhill, L. G.; Upfold, L.; others (2003). "Populations of surface nesting seabirds at Marion Island, 1994/95-2002/03". African Journal of Marine Science (25): 427–440. 
  • Croxall, J. P.; Gales, R. (1998). "Assessment of the conservation status of albatrosses". In Robertson, G.; Gales, R. Albatross biology and conservation. Chipping Norton, Australia: Surrey Beatty & Sons. 
  • Croxall, J. P.; Prince, P. A.; Rothery, P.; Wood, A. G. (1998). "Population changes in albatrosses at South Georgia". In Robertson, G.; Gales, R. Albatross biology and conservation. Chipping Norton, Australia: Surrey Beatty & Sons. pp. 69–83. 
  • Croxall, J. P., Silk, J.R.D., Phillips, R.A., Afanasyev, V., Briggs, D.R., (2005) "Global Circumnavigations: Tracking year-round ranges of nonbreeding Albatrosses" Science 307 249-250.
  • del Hoyo, Josep, Elliott, Andrew & Sargatal, Jordi (1992). Handbook of Birds of the World Vol 1. Barcelona:Lynx Edicions, ISBN 84-87334-10-5
  • Double, M. C. (2003). "Procellariiformes (Tubenosed Seabirds)". In Hutchins, Michael; Jackson, Jerome A.; Bock, Walter J. et al. Grzimek's Animal Life Encyclopedia. 8. Birds I Tinamous and Ratites to Hoatzins. Joseph E. Trumpey, Chief Scientific Illustrator (2 ed.). Farmington Hills, MI: Gale Group. pp. 107–111. ISBN 0-7876-5784-0. 
  • Ehrlich, Paul R.; Dobkin, David, S.; Wheye, Darryl (1988). The Birders Handbook (First ed.). New York, NY: Simon & Schuster. pp. 29–31. ISBN 0-671-65989-8. 
  • Gales, R. (1998). "Albatross populations: status and threats". In Robertson, G.; Gales, R. Albatross biology and conservation. Chipping Norton, Australia: Surrey Beatty & Sons. 
  • Gotch, A. F. (1995) [1979]. "Albatrosses, Fulmars, Shearwaters, and Petrels". Latin Names Explained A Guide to the Scientific Classifications of Reptiles, Birds & Mammals. New York, NY: Facts on File. p. 191. ISBN 0-8160-3377-3. 
  • Moore, P. J. (2004). "Abundance and population trends of mollymawks on Campbell Island". Science for Conservation (Wellington, NZ: Department of Conservation) (242). 
  • Nel, D. C.; Lutjeharms, J. R. E.; Pakhomov, E. A.; Ansorge, I. J.; Ryan, P. G.; Klages, N. T. W. (2001). "Exploitation of mesoscale oceanographic features by Grey-headed Albatross Thalassarche chrysostoma in the southern Indian Ocean". Marine Ecology Progress Series (217): 15–26. 
  • Nel, D. C.; Ryan, P. G.; Crawford, R. J. M.; Cooper, J.; Huyser, O. (2002). "Population trends of albatrosses and petrels at sub-Antarctic Marion Island". Polar Biology (25): 81–89. 
  • Nel, D. C.; Ryan, P. G.; Watkins, B. P. (2002a). "Seabird mortality in the Patagonian Toothfish longline fishery around the Prince Edward Islands". Antarctic Science (14): 151–161. 
  • Phillips, R. A.; Silk, J. R. D.; Phalan, B.; Catry, P.; Croxall, J. P. (2004). "Seasonal sexual segregation of two Thalassarche albatross species: competitive exclusion, reproductive role specialization or foraging niche divergence?". Proceedings of the Royal Society B (271): 1283–1291. 
  • Poncet, S.; Robertson, G.; Phillips, R. A.; Lawton, K.; Phalan, B.; Trathan, P. N.; Croxall, J. P. (2006). "Status and distribution of wandering Black-browed and Grey-headed Albatrosses breeding at South Georgia". Polar Biology (29): 772–781. 
  • Prince, P. A. (1980). "The food and feeding ecology of Grey-headed Albatross Diomedea chrysostoma and Black-rowed Albatross D. melanophris". Ibis (122): 476–488. 
  • Prince, P. A.; Croxall, J. P.; Trathan, P. N.; Wood, A. G. (1998). "The pelagic distribtuion of South Georgia albatrosses and their relationships with fisheries". In Robertson, G.; Gales, R. Albatross biology and conservation. Chipping Norton, Australia: Surrey Beatty & Sons. 
  • Ryan, P. G.; Cooper, J.; Dyer, B. M.; Underhill, L. G.; Crawford, R. J. M.; Bester, M. N. (2003). "Counts of surface-nesting seabirds breeding at Prince Edward Island, Summer 2001/02". African Journal of Marine Science (25): 441–451. 
  • Taylor, G. A. (2000). "Action plan for seabird conservation in New Zealand. Wellington: Department of Conservation". Threatened Species Occasional Publication (16). 
  • Xavier, J. C.; Croxall, J. P.; Trathan, P. N.; Wood, A. G. (2003). "Feeding strategies and diets of breeding grey-headed and wandering albatrosses at South Georgia". Marine Biology (143): 221–232. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!