Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

Grey-headed albatrosses normally breed every two years; if a chick is successfully reared the parents will not breed the following year. The nest is made of a cone of mud lined with grasses and all albatrosses lay only one egg. The egg is laid in mid-October and hatches during December. The male performs almost all of the incubation, which he carries out for the first 70 days. The chick takes three to four days to chip out of the egg and is then guarded for approximately three weeks. Most young depart from their natal nest the following May. The youngest recorded breeding bird was seven, and these birds can live to at least 36 years old (3). This albatross feeds while on the sea surface and, even during breeding seasons when restricted by parental duties, undertakes marathon feeding trips, travelling up to 13,000 km on a single feeding flight (3) (6). The diet consists of fish, squid and crustaceans; although young seem to be fed mainly lampreys by their parents (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This medium-sized albatross possesses a distinctive combination of a grey head and neck, black bill, dark grey back and tail and a white breast. The underwing is white, but with black on the leading edge. One of the grey-headed albatross' most distinguishing features is its black bill, which has bright yellow ridges along the top and bottom edges, ending in a pink tip (5). Additionally, a white crescent exists behind the eye. Juveniles have a predominantly black bill and head, a darker nape than adults, indistinct white eyebrows and virtually no white on the underwing (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Thalassarche chrysostoma has a circumpolar distribution over cold subantarctic and Antarctic waters (ACAP 2009). It breeds on South Georgia (Georgias del Sur), Islas Diego Ramirez and Ildefonso (Chile), Prince Edward and Marion Islands (South Africa), Crozet Islands, Kerguelen Islands (French Southern Territories), Campbell Island (New Zealand) and Macquarie Island (Australia). The annual breeding population is c.95,000 pairs, equivalent to a total population of c.250,000 mature individuals in this biennially breeding bird (Croxall and Gales 1998, Brooke 2004). Approximately half the global population occurs on South Georgia (ACAP 2009). Its range at sea while breeding lies largely within or south of the Antarctic Polar Frontal Zone (Prince et al. 1998, Phillips et al. 2004). During the non-breeding season South Georgia birds have been recorded making one or more global circumnavigations, the fastest in just 46 days (Croxall et al. 2005). All New Zealand banded birds have been recovered west of New Zealand in Australian zone (G. Taylor in litt. 2008). At South Georgia, the population is estimated to have declined by 25% between 1977 and 2004 (Poncet et al. 2006; R. Phillips verbally 2012), while on Campbell Island the population underwent major declines prior to 1997 but has apparently since stabilised (W. Misiak in litt. 2013). Population trends are unknown for Chile, Iles Kerguelen and Iles Crozet (representing around one third of the global population), and increasing on Marion Island (ACAP 2012). Very rapid overall declines appear to be taking place even if it is assumed colonies without trend information have remained stable.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Circumpolar high s latitudes; ranges s oceans north to 35°S.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The grey-headed albatross breeds on sub-Antarctic islands along with black-browed albatross (6). The main populations are in the South Atlantic Sector of the Southern Ocean (3), but there are colonies in Diego Ramirez and Islas Ildefonso south of Chile, South Georgia in the South Atlantic, Prince Edward, Crozet and Kerguelen groups in the South Indian Ocean, Macquarie Island south of Australia, and Campbell Island south of New Zealand (5). Found in colder waters during the summer, this species moves northward into the subtropics during the southern winter. These birds have been recorded to circumnavigate the globe, sometimes twice, when they are not breeding (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is a biennial breeder, although 5.4% and 1% of successful breeders on Marion Island and Bird Island respectively, attempt to breed annually. Birds return to colonies between late September and early October, laying occurs in October and chicks hatch by December. Chicks fledge from April to May, returning to breeding colonies at the earliest at three years of age but generally at six or seven years old. First breeding can begin as early as seven years, but the average age on Campbell Island is 13.5 years old and the modal age on South Georgia is 12 years old. It feeds by surface-seizing but can also dive up to depths of six metres (ACAP 2009). Substantial segregation in foraging areas is apparent for male and female Grey-headed Albatross during incubation at South Georgia, with males travelling on average further than females (Phillips et al. 2004). At Iles Kerguelen, Campbell Island and South Georgia (Islas Georgias del Sur), the species is principally an oceanic forager, concentrating in the Antarctic Polar Frontal Zone and associated oceanic upwellings. However, in years of low availability, chick-rearing birds from South Georgia (Islas Georgias del Sur) forage mainly in Antarctic shelf-slope waters around the South Shetland Islands and the Antarctic Peninsula. Prey biogeography also indicates some neritic foraging around Iles Kerguelen and Campbell Island during chick rearing (ACAP 2009). On Marion Island, incubating birds foraged in the Sub-tropical Frontal Zone and the Subantarctic Zone in association with what are most likely eddies. In contrast, during chick rearing, foraging was concentrated in the Subantarctic and Polar Frontal Zones to the south-west of the island, also in association with eddies (Nel et al. 2000, Nel et al. 2001). Habitat Breeding It breeds on steep slopes or cliffs, generally with tussock-grass. Diet Its diet is variable with locality and year (ACAP 2009). It feeds mainly on cephalopods and fish, but crustaceans, carrion and lampreys are locally important (Prince 1980, Cherel et al. 2002, Xavier et al. 2003, Arata et al. 2004). It actively scavenges longline baits.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 436 specimens in 1 taxon.
Water temperature and chemistry ranges based on 430 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.207 - 15.091
  Nitrate (umol/L): 1.697 - 28.640
  Salinity (PPS): 32.635 - 35.132
  Oxygen (ml/l): 5.810 - 8.188
  Phosphate (umol/l): 0.358 - 1.965
  Silicate (umol/l): 1.974 - 65.072

Graphical representation

Temperature range (°C): -1.207 - 15.091

Nitrate (umol/L): 1.697 - 28.640

Salinity (PPS): 32.635 - 35.132

Oxygen (ml/l): 5.810 - 8.188

Phosphate (umol/l): 0.358 - 1.965

Silicate (umol/l): 1.974 - 65.072
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 22004 specimens in 1 taxon.
Water temperature and chemistry ranges based on 21260 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.605 - 18.067
  Nitrate (umol/L): 0.831 - 28.640
  Salinity (PPS): 32.669 - 34.504
  Oxygen (ml/l): 5.443 - 8.188
  Phosphate (umol/l): 0.324 - 2.046
  Silicate (umol/l): 1.074 - 82.197

Graphical representation

Temperature range (°C): -1.605 - 18.067

Nitrate (umol/L): 0.831 - 28.640

Salinity (PPS): 32.669 - 34.504

Oxygen (ml/l): 5.443 - 8.188

Phosphate (umol/l): 0.324 - 2.046

Silicate (umol/l): 1.074 - 82.197
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 436 specimens in 1 taxon.
Water temperature and chemistry ranges based on 430 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.207 - 15.091
  Nitrate (umol/L): 1.697 - 28.640
  Salinity (PPS): 32.635 - 35.132
  Oxygen (ml/l): 5.810 - 8.188
  Phosphate (umol/l): 0.358 - 1.965
  Silicate (umol/l): 1.974 - 65.072

Graphical representation

Temperature range (°C): -1.207 - 15.091

Nitrate (umol/L): 1.697 - 28.640

Salinity (PPS): 32.635 - 35.132

Oxygen (ml/l): 5.810 - 8.188

Phosphate (umol/l): 0.358 - 1.965

Silicate (umol/l): 1.974 - 65.072
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 22004 specimens in 1 taxon.
Water temperature and chemistry ranges based on 21260 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.605 - 18.067
  Nitrate (umol/L): 0.831 - 28.640
  Salinity (PPS): 32.669 - 34.504
  Oxygen (ml/l): 5.443 - 8.188
  Phosphate (umol/l): 0.324 - 2.046
  Silicate (umol/l): 1.074 - 82.197

Graphical representation

Temperature range (°C): -1.605 - 18.067

Nitrate (umol/L): 0.831 - 28.640

Salinity (PPS): 32.669 - 34.504

Oxygen (ml/l): 5.443 - 8.188

Phosphate (umol/l): 0.324 - 2.046

Silicate (umol/l): 1.074 - 82.197
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding takes place on steep slopes, rocky shores or cliffs, ususally in areas of tussock grass (2). Otherwise found over the open ocean far from shore, often travelling vast distances (1) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding Category

Visitor
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 30 years (wild) Observations: These animals have been estimated to live at least up to 30 years in the wild (http://www.demogr.mpg.de/longevityrecords), though detailed studies are lacking.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Thalassarche chrysostoma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Diomedea chrysostoma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACCGATGACTATTTTCAACCAACCATAAAGATATCGGCACACTATACTTAATTTTTGGTGCATGAGCCGGCATAGTCGGAACCGCACTCAGCTTACTTATCCGTGCAGAACTTGGTCAGCCAGGAACCCTCCTGGGAGAC---GACCAAATCTACAATGTAATCGTCACCGCTCATGCCTTCGTAATAATCTTCTTTATAGTAATACCAATCATGATTGGAGGATTTGGAAACTGACTAGTACCACTTATAATTGGTGCACCTGACATAGCATTTCCACGTATAAATAATATAAGCTTCTGATTACTGCCCCCATCCTTCCTCCTCCTACTAGCATCCTCCACAGTAGAAGCAGGAGCAGGTACAGGATGAACTGTGTACCCGCCTCTAGCTGGCAACCTTGCCCACGCAGGGGCTTCAGTAGACCTGGCCATCTTCTCCCTCCACCTAGCAGGTGTTTCATCAATCCTAGGAGCAATTAACTTCATCACAACTGCCATCAATATAAAACCCCCAGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTCATTACTGCCGTCTTACTCTTACTTTCACTACCTGTCCTTGCCGCCGGTATTACTATACTACTAACAGATCGAAACCTAAATACTACATTCTTCGACCCAGCTGGAGGAGGGGACCCAGTCCTATATCAACATCTTTTCTGATTCTTTGGTCACCCAGAAGTCTACATTTTAATTTTACCTGGCTTTGGAATCATCTCGCATGTAGTAACATACTACGCAGGTAAAAAAGAACCGTTCGGCTACATAGGAATAGTATGAGCCATACTCTCCATTGGATTCCTGGGCTTCATCGTATGGGCCCACCATATATTTACAGTAGGAATAGACGTAGACACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Diomedea chrysostoma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A4bd

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Arata, J., Cooper, J., Croxall, J., Gales, R., Phillips, R., Robertson, C., Ryan, P.G., Xavier, J. & Misiak, W.

Justification
This species has been uplisted to Endangered as data from some major colonies, in particular South Georgia (Georgias del Sur), which holds around half the global population, suggest that overall declines are taking place at a very rapid rate over three generations (90 years), even if colonies lacking trend information are assumed to be stable. The major driver of declines is likely to be incidental mortality on longline fisheries.


History
  • 2012
    Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Lower Risk/near threatened (LR/nt)
  • Lower Risk/least concern (LR/lc)