Articles on this page are available in 3 other languages: Spanish (17), Chinese (Simplified) (1), Dutch (1) (learn more)

Overview

Brief Summary

Merlins are the smallest falcon species in Europe. They eat mostly songbirds, which they follow during the migration. Most of their prey consists of birds such as pipits, larks, wheatears, finches and buntings. By flying rapidly and just above the ground, they surprise these small birds. They fly the last few meters like a nistle thrush, perhaps as extra camouflage. Sometimes, merlins chase their prey long enough to tire them out so they no longer can escape.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Falco columbarius

A medium-sized (10-13 ½ inches) falcon, the Merlin is most easily identified by its size, brown-streaked breast, and black tail bands. Other field marks include dark “moustaches” on the face, dark eyes, and yellow legs. Male Merlins have slate-gray backs, while females are larger and have dark brown backs. The Merlin is widely distributed across the Northern Hemisphere. In North America, three distinct populations of Merlin occur: a darker-plumaged subspecies inhabiting the Pacific Northwest, a paler-plumaged subspecies inhabiting the northern Great Plains, and an intermediate subspecies breeding primarily in Alaska and Canada. The first two subspecies are mostly non-migratory, while the third subspecies migrates south to the western United States, the Gulf and Atlantic coasts of the eastern U.S., and south into the tropics as far as northern South America. In the Old World, this species breeds from Iceland across to Siberia, wintering as far south as North Africa and tropical Asia. Merlins breed in open areas, including forest edges, tundra, coasts, and islands. This species utilizes similar habitats in winter as in summer, but may also enter urban areas if prey is available. Merlins primarily eat small birds, which they capture either from the ground or in the air. Due to this species’ preference for open habitat, Merlins may be most easily seen perching in prominent locations or while flying in pursuit of prey. Merlins may also hunt small shorebirds, flying close to the ground in order to surprise its prey. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Merlins are found throughout the Northern Hemisphere. In North America they are found from eastern Canada and Alaska, south throughout Mexico. Merlins spend the winter in the southern United States, Mexico, Central America, northern South America, and the Caribbean Islands.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); neotropical (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Merlins are found throughout the Northern Hemisphere. There are nine recognized subspecies worldwide, with three in North America: F. c. columbarius, F. c. suckleyi, and F. c. richardsoni.

Falco columbarius columbarius summers in eastern Canada, southward to Michigan and westward to the eastern border of the Great Plains. This subspecies winters in the Gulf States, eastern Mexico, northern Venezuela, Ecuador, and the West Indies.

The summer range of Falco columbarius richardsoni includes the interior of western North America. This subspecies winters in southern California, northern Mexico, and southern Texas.

Falco columbarius suckleyi is found in the northwestern coastal regions from northern California to Sitka, Alaska.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); neotropical (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Holarctic distribution. BREEDS: from northward tree limit in Alaska, Canada, and Eurasia southward to southern Alaska, Oregon, Idaho, South Dakota, northern Great Lakes region, New York, Maine, Nova Scotia, British Isles, and central Russia. NORTHERN WINTER: southern British Columbia and western and southern U.S. south to Venezuela and Peru, and in Europe, extreme northern Africa, and China. Holarctic distribution.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Male merlins have slaty blue, purplish, or dark umber-brown upper parts, streaked with black from the crown to shoulders and back. The tail is barred by dark umber-brown or blackish bands and is tipped in white. The underparts are cream to a rich buff with heavy longitudinally streaks of dark umber-brown or black coloration, except for the throat which is an unmarked white. The sides of the head are buff with fine darker streakings. The forehead and line above the eye is white. The beak is bluish horn; the cere and feet are chromo yellow; the claws are black; and the iris is deep brown.

Females and young are similiar to males in their markings, but differ from males in coloration. The upperparts are dark brown. The neck is streaked with lighter brown and the tail is banded in yellow bars with a white tip.

Falco_columbarius_bendirei (Bendire's merlins): Lighter in the upper parts than Falco_columbarius_columbarius. The tail is black with three white bars.

Falco_columbarius_columbarius (American merlins): (see description of Falco_columbarius). In males, the cere and feet turn reddish with age.

Falco_columbarius_richardsoni (Richardson's merlins): Lighter overall coloration and the tail is marked by five dark and six white bands.

Falco_columbarius_suckleyi (Black pigeon hawks): Darker in overall coloration than Falco_columbarius_columbarius. The throat of males is streaked with black markings, while the lower body parts are brownish-black with chestnut and white markings. The lower parts of young males and females are heavily marked with dusky coloration and the spotting is either faint or absent from the wings.

Range length: 25 to 33 cm.

Range wingspan: 60 to 68 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

Average mass: 195 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Male merlins have slaty blue, purplish, or dark umber-brown upper parts, streaked with black from the crown to shoulders and back. The tail is barred by dark umber-brown or blackish bands and is tipped in white. The underparts are cream to a rich buff with heavy longitudinally streaks of dark umber-brown or black coloration, except for the throat which is an unmarked white. The sides of the head are buff with fine darker streakings. The forehead and line above the eye is white. The beak is bluish horn; the cere and feet are chromo yellow; the claws are black; and the iris is deep brown.

Females and young are similiar to males in their markings, but differ from males in coloration. The upperparts are dark brown. The neck is streaked with lighter brown and the tail is banded in yellow bars with a white tip.

Falco columbarius bendirei (Bendire's merlins): Lighter in the upper parts than Falco columbarius columbarius. The tail is black with three white bars.

Falco columbarius columbarius (American merlins): (see description of Falco columbarius). In males, the cere and feet turn reddish with age.

Falco columbarius richardsoni (Richardson's merlins): Lighter overall coloration and the tail is marked by five dark and six white bands.

Falco columbarius suckleyi (Black pigeon hawks): Darker in overall coloration than Falco columbarius columbarius. The throat of males is streaked with black markings, while the lower body parts are brownish-black with chestnut and white markings. The lower parts of young males and females are heavily marked with dusky coloration and the spotting is either faint or absent from the wings.

Range length: 25 to 33 cm.

Range wingspan: 60 to 68 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

Average mass: 195 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 31 cm

Weight: 244 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from American kestrel, prairie falcon, and peregrine falcon in lacking a strong facial pattern. Differs from kestrel also in lacking russet back and tail. Only about half as big as a gyrfalcon (average length 31 cm vs. 51-64 cm).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Merlins favor open country, preferring grasslands, seashores, sand dunes, marshlands, steppes, and deserts. They breed in coniferous forests of the Northern Hemisphere.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; desert or dune ; savanna or grassland ; chaparral

Aquatic Biomes: coastal

Wetlands: marsh

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Merlins favor open country, preferring grasslands, seashores, sand dunes, marshlands, steppes, and deserts. Merlins rarely live in forested areas throughout much of their range, but frequently breed in coniferous forests of the Northern Hemisphere.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; desert or dune ; savanna or grassland ; chaparral

Aquatic Biomes: coastal

Wetlands: marsh

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 10.496 - 12.384
  Nitrate (umol/L): 4.976 - 7.963
  Salinity (PPS): 33.823 - 35.166
  Oxygen (ml/l): 6.242 - 6.362
  Phosphate (umol/l): 0.313 - 0.536
  Silicate (umol/l): 2.607 - 4.330

Graphical representation

Temperature range (°C): 10.496 - 12.384

Nitrate (umol/L): 4.976 - 7.963

Salinity (PPS): 33.823 - 35.166

Oxygen (ml/l): 6.242 - 6.362

Phosphate (umol/l): 0.313 - 0.536

Silicate (umol/l): 2.607 - 4.330
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: NONBREEDING: a wide variety of habitats including marshes, deserts, seacoasts, near coastal lakes and lagoons, open woodlands, fields, etc. May roost in conifers in winter.

BREEDING: In southeastern Montana, breeding males appeared to prefer patchy shrub/grassland habitats for hunting (Becker and Sieg 1987). Urban-breeding Merlins in Saskatchewan avoided hunting in agricultural areas where prey abundance was low (Sodhi and Oliphant 1992).

Nests in conifer woodland or wooded prairie (e.g., groves of deciduous trees along rivers), including planted shelterbelts; often near water; in towns in some areas (e.g. Alberta, Manitoba, Saskatchewan). Nests in trees in abandoned crow, magpie, hawk, or squirrel nest; also in natural tree cavity or abandoned woodpecker hole, on bare cliff ledge, or scrape on ground (arctic, heather moor of U.K.). Not infrequently returns to same nesting area in successive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Most boreal birds of all ages migrate; in southern breeding range, sometimes resident or migration shorter (Palmer 1988). Northward migrants reach northern U.S. and northern Eurasia in April-May, males generally before females. Migrates southward for northern winter; migration begins in north in late August, peaks in central latitudes of U.S. September-October; migrants reach southwestern Ecuador October-November (Palmer 1988). In Puerto Rico, begins to arrive in October, departs by end of April (Rodriguez-Duran and Lewis 1985). Migrants may cross large bodies of water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Merlins prey mainly on small birds of the ground and low vegetation, including larks (Alaudidae), sparrows (Passeridae and Emberizidae), finches (Fringillidae) and ptarmigans and grouse (Tetraoninae). Some small mammals, lizards, snakes, insects, and - in North America - dragonflies, also make up a portion of the diet. The relative proportions are about 80% birds, 5% mammals, and 15% insects.

Animal Foods: birds; mammals; insects

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Merlins prey mainly on small birds of the ground and low vegetation, including larks (Alaudidae), sparrows (Passeridae and Emberizidae), finches (Fringillidae) and ptarmigans and grouse (Tetraoninae). Some small mammals, lizards, snakes, insects, and - in North America - dragonflies, also make up a portion of the diet. The relative proportions are about 80% birds, 5% mammals, and 15% insects.

Animal Foods: birds; mammals; insects

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Bulk of diet usually consists of small to medium-sized birds, often flocking species. Large flying insects (e.g., dragonflies) may be important for young learning to hunt. Also eats toads, reptiles, and mammals (including bats in the West Indies). Uses inconspicuous perches and searching flights when hunting. May cache prey in various seasons. Prey requirements for adults and young during 120-day breeding/rearing period: several hundred sparrow-size birds (see Palmer 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Falco columbarius preys on:
Dicrostonyx
Microtus
Bombycilla cedrorum
Dendroica palmarum

Based on studies in:
Russia (Tundra)

This list may not be complete but is based on published studies.
  • V. I. Osmolovskaya, Geographical distribution of raptors in Kazakhstan plains and their importance for pest control, Tr. Acad. Sci. USSR Inst. Geogr. 41:5-77 (1948). (In Russian.)
  • T. Dunaeva and V. Kucheruk, Material on the ecology of the terrestrial vertebrates of the tundra of south Yamal, Bull. Soc. Nat. Moscou (N.S., Zool. Sect.) 4(19):1-80 (1941).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Estimated number of breeding pairs in Canada in the early 1990s was 10,000-100,000 (Kirk et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

At Saskatoon, Saskatchewan, breeding density was 25.4 pairs/100 sq km, the highest recorded for this species (Sodhi et al. 1992). Hunting range sizes (May-July) in Saskatoon varied from about 2-14 sq km (average 6-7 sq km) in residents to 0.6-64 sq km (average 9 sq km in females, 34 sq km in males) in immigrants; neighboring hunting ranges overlapped by 0-77% (Sodhi and Oliphant 1992).

In Montana, nestling-period home range of 3 telemetered males was 13-28 sq km; moved up to 8-9 km from nest site (Becker and Sieg 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Preyed on emerging bats around sunset in Puerto Rico (Rodriguez-Duran and Lewis 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
143 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Status: wild:
143 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12.7 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males arrive to the breeding area before the females, usually returning to the same general area year after year. Nesting pairs don't necessarily use the same actual site each year. In open country and grassland, nests are generally scrapes located in dense vegetation. In regions of sand dunes, dune grasses may be used to create a nest. Even in wooded areas, nests may be scrapes, but empty crow nests are preferred. During the nesting period, Falco_columbarius become highly aggressive towards other raptors and crows in the area. This aggressive behavior towards other predatory birds is beneficial to other woodland song and ground birds in the nesting range; since Falco_columbarius hunts only in open country, thereby leaving the woodland birds relatively free from predators during the mating season. Normally the nest contains four to six eggs measuring 1.5 x 1.22 inches. The eggs are laid at two-day intervals. The coloration of the round oval eggs are variations of light buff white almost obscured by a regular pattern of rich chestnut-brown, purple and chocolate blotchings.

The eggs are laid in early April to early May in the southern ranges and in late May through June in the North. The female is the main incubator, although the male does share in the duties. The incubation period lasts 25-32 days. At the end of the incubation period, the eggs hatch in intervals.

Quills appear on the young after fourteen days, and by eighteen days the down is almost completely covered with feathers, except in the head region. Flight is achieved at 25-30 days after hatching.

Upon leaving the nest, the young remain nearby for several weeks until they are mature enough to migrate southward. Within a week's time of leaving the nest, the young are capable of distance flights, and at two weeks' time, they begin to catch insects. By six weeks the young are skilled in catching small birds, and shortly afterwards, they migrate southward from the breeding area. The success rate among the the young is exceptionally high, often three birds per nest survive to continue breeding.

Falco_columbarius: Breeds throughout northern Europe, Asia and North America.

Falco_columbarius bendirei: Breeds in northwestern Alaska to northern Saskatchewan and into northern California.

Falco_columbarius columbarius: Breeds in eastern Canada to the eastern border of the Great Plains and southwards into Nova Scotia and northern Michigan.

Falco_columbarius richardsoni: Breeding range is located in the Great Plains from southern Alberta and Saskatchewan to northern Montana and North Dakota.

Falco_columbarius suckleyi: Breeding occurs only in western British Columbia and perhaps on Vancouver Island.

Breeding interval: Merlins breed once yearly.

Breeding season: Merlins breed from April to July, depending on the latitude.

Range eggs per season: 4 to 6.

Range time to hatching: 25 to 32 days.

Average time to independence: 6 weeks.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Males arrive to the breeding area before the females, usually returning to the same general area year after year. Nesting pairs don't necessarily use the same actual site each year. In open country and grassland, nests are generally scrapes located in dense vegetation. In regions of sand dunes, dune grasses may be used to create a nest. Even in wooded areas, nests may be scrapes, but empty crow nests are preferred. During the nesting period, Falco columbarius become highly aggressive towards other raptors and crows in the area. This aggressive behavior towards other predatory birds is beneficial to other woodland song and ground birds in the nesting range; since Falco columbarius hunts only in open country, thereby leaving the woodland birds relatively free from predators during the mating season. Normally the nest contains four to six eggs measuring 1.5 x 1.22 inches. The eggs are laid at two-day intervals. The coloration of the round oval eggs are variations of light buff white almost obscured by a regular pattern of rich chestnut-brown, purple and chocolate blotchings.

The eggs are laid in early April to early May in the southern ranges and in late May through June in the North. The female is the main incubator, although the male does share in the duties. The incubation period lasts 25-32 days. At the end of the incubation period, the eggs hatch in intervals.

Quills appear on the young after fourteen days, and by eighteen days the down is almost completely covered with feathers, except in the head region. Flight is achieved at 25-30 days after hatching.

Upon leaving the nest, the young remain nearby for several weeks until they are mature enough to migrate southward. Within a week's time of leaving the nest, the young are capable of distance flights, and at two weeks' time, they begin to catch insects. By six weeks the young are skilled in catching small birds, and shortly afterwards, they migrate southward from the breeding area. The success rate among the the young is exceptionally high, often three birds per nest survive to continue breeding.

Falco columbarius: Breeds throughout northern Europe, Asia and North America.

Falco columbarius bendirei: Breeds in northwestern Alaska to northern Saskatchewan and into northern California.

Falco columbarius columbarius: Breeds in eastern Canada to the eastern border of the Great Plains and southwards into Nova Scotia and northern Michigan.

Falco columbarius richardsoni: Breeding range is located in the Great Plains from southern Alberta and Saskatchewan to northern Montana and North Dakota.

Falco columbarius suckleyi: Breeding occurs only in western British Columbia and perhaps on Vancouver Island.

Breeding interval: Merlins breed once yearly.

Breeding season: Merlins breed from April to July, depending on the latitude.

Range eggs per season: 4 to 6.

Range time to hatching: 25 to 32 days.

Average time to independence: 6 weeks.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Laying generally is completed in southeastern Montana by May 20, which is the peak date in Saskatchewan, where clutches were initiated between mid-April and late May (Sodhi et al. 1992); clutches were completed by late May in Denali Park, Alaska. Clutch size is 2-7 (average 3-5). Incubation, primarily by the female, lasts 31-32 days (male brings food). Young fledge in 25-35 days, remain dependent on parents for food 2-5 more weeks (young remained in vicinity of nest 7-19 days after fledging in southeastern Montana, Becker and Sieg 1985). First breeds at 1-2 years (occasionally 1 year). Yearling male may help nesting pair (James and Oliphant 1986). See Sodhi et al. (1992) for information on an expanding Saskatchewan population characterized by very high reproductive success.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Falco columbarius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCCAACCCACAAAGACATTGGCACCCTGTACCTACTCTTCGGAGCATGAGCAGGTATAGCCGGCACTGCCCTCAGCCTCCTCATTCGAGCAGAACTTGGACAGCCAGGAACTCTCCTGGGAGACGACCAAATCTACAATGTCATCGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCCATCATGATTGGGGGATTTGGAAACTGATTAGTCCCCCTTATAATTGGAGCCCCAGACATAGCATTCCCCCGCATAAACAACATGAGCTTCTGACTACTCCCTCCATCCTTCCTACTGCTCCTAGCATCTTCCACAGTAGAAGCTGGAGTCGGAACAGGATGAACCGTATACCCCCCCTTAGCAGGCAACCTAGCCCATGCTGGTGCCTCAGTAGACCTGGCCATCTTCTCCCTACATCTCGCAGGTGTATCCTCCATCTTAGGGGCGATCAACTTCATCACGACAGCCATTAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCACTATTCGTATGATCCGTACTCATCACCGCCGTCCTCTTACTACTCTCACTTCCAGTCCTAGCCGCCGGCATCACCATATTACTAACAGACCGAAACCTGAACACTACATTCTTCGACCCCGCCGGAGGAGGGGATCCAATTCTCTACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATTCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Falco columbarius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Merlins are widely distributed but are not common anywhere in their range. With expanding human development, the breeding habitats and hunting grounds of these falcons are being destroyed rapidly. This species is listed as threatened in the state of Michigan.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be fluctuating, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Falco columbarius is widely distributed, but nowhere common. With expanding human development, the breeding habitats and hunting grounds of these falcons are being destroyed rapidly. This species is listed as threatened in the state of Michigan.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: threatened

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4N,N5B : N4N: Apparently Secure - Nonbreeding, N5B: Secure - Breeding

United States

Rounded National Status Rank: N4B,N4N : N4B: Apparently Secure - Breeding, N4N: Apparently Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread (Holarctic) distribution; increasing population trends in areas formerly negatively impacted by pesticide pollution; still threatened in some areas by habitat loss; organochlorine use in Central and South America poses a threat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Pesticides contributed to a decline, particularly in Europe, in productivity recorded in a 20-year period prior to the early 1970s (Trimble 1974). Primary threats include habitat loss and continued use of organochlorine biocides in Central and South America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: In the U.S., many EOs occur on federally owned land; however EOs may change year to year.

Needs: Limit pesticide use to levels that do not affect reproduction. Protect habitat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The diet of merlins consists mainly of small birds, including many small birds which are a benefit to agriculture and forestry. In the northern part of their breeding range merlins sometimes attack small domestic poultry, but these attacks are rare.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Merlins occasionally prey on agricultural insect pests, such as Orthoptera. They are also widely used in falconry. Considered a lady's gaming bird, merlins are relatively easy to train for small game hunting and are usually returned to the wild after a season.

Positive Impacts: pet trade ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

The diet of Falco columbarius consists mainly of small birds, including many small birds which benefit agriculture and forestry. In the northern the breeding range, Falco columbarius individuals sometimes attack small domestic poultry; however, these attacks are quite rare.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Merlins occasionally prey on agricultural insect pests, such as grasshoppers and crickets. These small falcons are also widely used in falconry. Considered a lady's gaming bird, Falco columbarius is relatively easy to train for small game hunting and usually returned to the wild after a season.

Positive Impacts: pet trade ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Merlin (bird)

The Merlin (Falco columbarius) is a small species of falcon from the Northern Hemisphere. A bird of prey once known colloquially as a pigeon hawk in North America,[2] the Merlin breeds in the northern Holarctic; some migrate to subtropical and northern tropical regions in winter.

Contents

European and North American variants [edit]

Some regard the North American and Eurasian (F. columbarius) populations as two distinct species. The first modern taxonomist to describe the Merlin was Carl Linnaeus, a Swede who reported his type specimen came from America. Thirteen years after Linnaeus's description Marmaduke Tunstall recognized the Eurasian birds as a distinct taxon aesalon in his Ornithologica Britannica. If two species of Merlins are recognized, the Old World birds would thus bear the scientific name F. aesalon.[3][4]

Description [edit]

Juvenile, F. c. columbarius

The Merlin is 24–33 cm (9.4–13 in) long with a 50–73 cm (20–29 in) wingspan.[5] Compared to most other small falcons, it is more robust and heavily built. Males average at about 165 g (5.8 oz) and females are typically about 230 g (8.1 oz). There is considerable variation, however, throughout the birds' range and—in particular in migratory populations—over the course of a year. Thus, adult males may weigh 125–210 g (4.4–7.4 oz), and females 190–300 g (6.7–11 oz).[5] Each wing measures 18.2–23.8 cm (7.2–9.4 in), the tail measures 12.7–18.5 cm (5.0–7.3 in) and the tarsus measures 3.7 cm (1.5 in).[5] Such sexual dimorphism is common among raptors; it allows males and females to hunt different prey animals and decreases the territory size needed to feed a mated pair.[3][6]

The male Merlin has a blue-grey back, ranging from almost black to silver-grey in different subspecies. Its underparts are buff- to orange-tinted and more or less heavily streaked with black to reddish brown. The female and immature are brownish-grey to dark brown above, and whitish buff spotted with brown below. Besides a weak whitish supercilium and the faint dark malar stripe—which are barely recognizable in both the palest and the darkest birds—the face of the Merlin is less strongly patterned than in most other falcons. Nestlings are covered in pale buff down feathers, shading to whitish on the belly.[6]

Upperside pattern of male (presumably F. c./a. pallidus) wintering in Little Rann of Kutch, Gujerat, India

The remiges are blackish, and the tail usually has some 3–4 wide blackish bands, too. Very light males only have faint and narrow medium-grey bands, while in the darkest birds the bands are very wide, so that the tail appears to have narrow lighter bands instead. In all of them, however, the tail tip is black with a narrow white band at the very end, a pattern possibly plesiomorphic for all falcons. Altogether, the tail pattern is quite distinct though, resembling only that of the Aplomado Falcon (F. berigora) and (in light Merlins) some typical kestrels. The eye and beak are dark, the latter with a yellow cere. The feet are also yellow, with black claws.[6]

Light American males may resemble the American Kestrel (F. sparverius, not a typical kestrel), but merlin males have a grey back and tail rather than the reddish-brown of the kestrels. Light European males can be distinguished from kestrels by their mainly brown wings. In the north of South Asia, wintering males may be confused with the Red-necked Falcon (F. chicquera) if they fly away from the observer and the head (red on top in F. chicquera) and underside (finely barred with black in F. chicquera) are not visible.[6]

Systematics [edit]

The relationships of the Merlin are not resolved to satisfaction. In size, shape and coloration, it is fairly distinct among living falcons. The Red-necked Falcon is sometimes considered more closely related to the Merlin than other falcons, but this seems to be a coincidence due to similar hunting habits; it could not be confirmed in more recent studies. Indeed, the Merlin seems to represent a lineage distinct from other living falcons since at least the Early Pleistocene, some 5 Ma (million years ago). As suggested by biogeography and DNA sequence data, it might be part of an ancient non-monophyletic radiation of Falcos from Europe to North America, alongside the ancestors of forms such as the American Kestrel (F. sparvierus), and the Aplomado Falcon (F. femoralis) and its relatives. A relationship with the Red-necked Falcon (F. chicquera) was once proposed based on their phenetic similarity, but this is not considered likely today.[7][3][4][8][9]

European subspecies aesalon. Adult male (front) and female (behind)

In that regard, it is interesting to note a fossil falcon from the Early Blancan (4.3–4.8 Ma)[10] Rexroad Formation of Kansas. Known from an almost complete right coracoid (specimen UMMP V29107) and some tarsometatarsus, tibiotarsus and humerus pieces (V27159, V57508-V57510, V57513-V57514), this prehistoric falcon was slightly smaller than a Merlin and apparently a bit more stout-footed, but otherwise quite similar. It was part of the Fox Canyon and Rexroad Local Faunas, and may have been the ancestor of the living Merlins or its close relative. With its age quite certainly pre-dating the split between the Eurasian and North American Merlins, it agrees with the idea of the Merlin lineage originating in North America, or rather the colonization thereof. After adapting to its ecological niche, ancient Merlins would have spread to Eurasia again, with gene flow being interrupted as the Beringia and Greenland regions became icebound in the Quaternary glaciation.[11][7][4]

Subspecies [edit]

That the Merlin has a long-standing presence on both sides of the Atlantic is evidenced by the degree of genetic distinctness between Eurasian and North American populations. Arguably, they might be considered distinct species, with gene flow having ceased at least a million years ago, but probably more.[4]

By and large, color variation in either group independently follows Gloger's Rule. The Pacific temperate rain forest subspecies suckleyi's males are almost uniformly black on the upperside and have heavy black blotches on the belly, whereas those of the lightest subspecies, pallidus, have little non-dilute melanin altogether, with grey upperside and reddish underside pattern.[3]

Presumably Coastal Forest Merlin (F. c. suckelyi), Potter Marsh, Anchorage (Alaska, USA)

American group[3]

Canada and northernmost USA east of Rocky Mountains, except Great Plains. Migratory, winters in S North America, Central America, the Caribbean, and N South America from the Guyanas to the northern Andes foothills. Rarely winters in the northern USA.[2][12]
Great Plains from Alberta to Wyoming. Resident (some winter dispersal).
Pacific coast of North America, from S Alaska to N Washington state. Resident (some altitudinal movements).

Eurasian group[3]

  • Falco columbarius/aesalon aesalon Tunstall, 1771
Northern Eurasia from British Isles through Scandinavia to central Siberia. Population of northern Britain shows evidence of gene flow from subaesalon. British Isles population resident, rest migratory; winters in Europe and the Mediterranean region to about Iran.
Male (presumably F. c./a. pallidus) wintering in Little Rann of Kutch (Gujerat, India)
Iceland and Faroe Islands. Latter population has some gene flow with aesalon. Resident (some winter dispersal).
  • Falco columbarius/aesalon pallidus (Sushkin, 1900)
Asian steppes between Aral Sea and Altay Mountains. Migratory, winters in S Central Asia and N South Asia.
  • Falco columbarius/aesalon insignis (Clark, 1907)
Siberia between Yenisei and Kolyma Rivers. Migratory, winters in continental East Asia.
  • Falco columbarius/aesalon lymani Bangs, 1913
Mountains of eastern Kazakhstan and surrounding countries. Short-distance migrant.
  • Falco columbarius/aesalon pacificus (Stegmann, 1929)
Russian Far East to Sakhalin. Migratory, winters in Japan, Korea and nearby.

Ecology [edit]

Merlins inhabit fairly open country, such as willow or birch scrub, shrubland, but also taiga forest, parks, grassland such as steppe and prairies, or moorland. They are not very habitat-specific and can be found from sea level to the treeline. In general, they prefer a mix of low and medium-height vegetation with some trees, and avoid dense forests as well as treeless arid regions. During migration however, they will utilize almost any habitat.[3]

Most of its populations are migratory, wintering in warmer regions. Northern European birds move to southern Europe and North Africa, and North American populations to the southern USA to northern South America. In the milder maritime parts of its breeding range, such as Great Britain, the Pacific Northwest and western Iceland, as well as in Central Asia, it will merely desert higher ground and move to coasts and lowland during winter. The migration to the breeding grounds starts in late February, with most birds passing through the USA, Central Europe and southern Russia in March and April, and the last stragglers arriving in the breeding range towards the end of May. Migration to winter quarters at least in Eurasia peaks in August/September, while e.g. in Ohio, just south of the breeding range, F. c. columbarius is typically recorded as a southbound migrant as late as September/October.[3][12]

In Europe, Merlins will roost communally in winter, often with Hen Harriers (Circus cyaneus). In North America, communal roosting is rare, and Merlins are well known for fiercely attacking any birds of prey that they encounter, even adult eagles.

F. c. columbarius hunting a Northern Blue Jay (Cyanocitta cristata bromia), Mount Auburn Cemetery, Massachusetts (USA)

Merlins rely on speed and agility to hunt their prey. They often hunt by flying fast and low, typically less than 1 metre above the ground, using trees and large shrubs to take prey by surprise. But they actually capture most prey in the air, and will "tail-chase" startled birds. Throughout its native range, the Merlin is one of the most able aerial predators of small to mid-sized birds, more versatile if anything than the larger hobbies (which prefer to attack in mid-air) and the more nimble sparrowhawks (which usually go for birds resting or sleeping in dense growth). Breeding pairs will frequently hunt cooperatively, with one bird flushing the prey toward its mate.[13][3]

The Merlin will readily take prey that is flushed by other causes, and can for example be seen tagging along Sharp-shinned Hawks (Accipiter striatus) to catch birds that escape from this ambush predator into the open air. It is quite unafraid, and will readily attack anything that moves conspicuously. Merlins have even been observed trying to "catch" automobiles and trains, and to feed on captive birds such as those snared in the mist nets used by ornithologists. Even under adverse conditions, one in 20 targets is usually caught, and under good conditions almost every other attack will be successful. Sometimes, Merlins cache food to eat it later.[14][3]

In particular during the breeding season, most of the prey are smallish birds weighing 10–40 g (0.35–1.4 oz). Almost any such species will be taken, with local preferences for whatever is most abundant—be it larks (Alaudidae), pipits (Anthus) or House Sparrows (Passer domesticus)—and inexperienced yearlings always a favorite. Smaller birds will generally avoid a hunting Merlin if possible. Even in the Cayman Islands (where it only occurs in winter), Bananaquits were noted to die of an apparent heart attack or stroke, without being physically harmed, when a Merlin went at them and they could not escape.[14]

Larger birds (e.g. sandpipers, flickers[15] and even Rock Pigeons[16] as heavy as the Merlin itself) and other animals—insects (especially dragonflies and moths), small mammals (especially bats and voles) and reptiles—complement its diet. These are more important outside the breeding season, when they can make up a considerable part of the Merlin's diet. But for example in Norway, while small birds are certainly the breeding Merlin's staple food, exceptional breeding success seems to require an abundance of Microtus voles.[3]

Corvids are the primary threat to eggs and nestlings. Adult Merlins may be preyed on by larger raptors, especially Peregrine Falcons (F. peregrinus), eagle-owls (e.g., Great Horned Owl, Bubo virginianus), and larger Accipiter hawks (e.g., Northern Goshawk, A. gentilis). In general however, carnivorous birds avoid Merlins due to their aggressiveness and agility.

Reproduction [edit]

Nestlings

Breeding occurs typically in May/June. Though the pairs are monogamous at least for a breeding season, extra-pair copulations have been recorded. Most nest sites have dense vegetative or rocky cover; the Merlin does not build a proper nest of its own. Most will use abandoned corvid (particularly Corvus crow and Pica magpie) or hawk nests which are in conifer or mixed tree stands. In moorland—particularly in the UK—the female will usually make a shallow scrape in dense heather to use as a nest. Others nest in crevices on cliff-faces and on the ground, and some may even use buildings.[3]

Three to six (usually 4 or 5) eggs are laid. The rusty brown eggs average at about 40 mm × 31.5 mm (1.6 in × 1.24 in).[citation needed] The incubation period is 28 to 32 days. Incubation is performed by the female to about 90%; the male instead hunts to feed the family. Hatchlings weigh about 13 g (0.46 oz). The young fledge after another 30 days or so, and are dependent on their parents for up to 4 more weeks. Sometimes first-year Merlins (especially males) will serve as a "nest helper" for an adult pair. More than half—often all or almost all—eggs of a clutch survive to hatching, and at least two-thirds of the hatched young fledge. However, as noted above, in years with little supplementary food only one young in 3 may survive to fledging. The Merlin becomes sexually mature at one year of age and usually attempts to breed right away. The oldest wild bird known as of 2009 was recorded in its 13th winter.[3][17]

Relationship with humans [edit]

A male smyril is featured on this Faroese stamp by Edward Fuglø

In medieval Europe, Merlins were popular in falconry: the Book of St. Albans listed it as " the falcon for a lady ". Today, they are still occasionally trained by falconers for hunting smaller birds, but due to conservation restrictions this is not very common any more.

John James Audubon illustrated the Merlin in the second edition of Birds of America (published in London, 1827–38) as Plate 75, under the title, "Le Petit Caporal – Falco temerarius". The image was engraved and colored by Robert Havell's London workshops. The original watercolor by Audubon was purchased by the New York History Society[verification needed], where it remains as of January 2009.

William Lewin illustrates the Merlin as Plate 22 in volume 1 of his Birds of Great Britain and their Eggs, published 1789 in London.

Status and conservation [edit]

Hunter with trained Merlin, Jandari Lake, Georgia, November 1979

Altogether, the Merlin is not particularly rare, and due to this and its wide range it is considered a Species of Least Concern by the IUCN. Its numbers are—except in the Asian part of its range, where the situation is less well determined—regularly censused. In about every major country it inhabits, many hundreds to many thousands are found, ranging from a "mere" 250-300 pairs in Belarus to perhaps as many as 30,000 pairs of aesalon in European Russia as determined in 1993. It is listed on CITES Appendix II and on a local level protected as other birds of prey; while some countries allow to capture Merlins, e.g. for falconry, international trade requires an export permit.[3][1]

By far the most serious long-term threat to these birds is habitat destruction, especially in their breeding areas. Ground-nesting populations in moorland have a preference for tall heather, and are thus susceptible to overmanagement by burning vast tracts instead of creating a habitat mosaic containing old and new growth. Still, the Merlin is rather euryoecious and will even live in settled areas, provided they have the proper mix of low and high vegetation, as well as sufficient prey (which is usually the case) and nesting sites (which is a common limiting factor).[3]

In North America, the species seems to have been more widespread in the past, or perhaps its range has shifted northwards: F. c. columbarius was an uncommon breeding bird in Ohio before the 20th century, but e.g. in Seneca County, as early as the 1900s even single adults were rarely seen in the breeding season. It is encountered in Ohio as a passage migrant and rarely as a winter guest, though two recent nestings have been confirmed. Changing land-use in Ohio mainly turned forest into agricultural land and thus is not very likely to have rendered the region inhospitable to the Merlin; global warming on the other hand cannot be dismissed as a reason, given that the Merlin is essentially a subarctic species that barely ranges even into temperate climes. Also, it may be that the number of Merlins wintering in the northern USA has increased during the 20th century.[2][3][12]

Perhaps the most frequent cause of accidental death for individuals is collision with man-made objects, particularly during attacks. This may account for almost half of all premature deaths of Merlins. In the 1960s and 1970s, organochlorine pesticides were responsible for declines—particularly in Canada—due to eggshell thinning and subsequent brood failure, and compromising the immune system of adults. This has since been remedied with restrictions on the use of DDT and similar chemicals, and numbers have rebounded. Overall, Merlin stocks appear globally stable; while they may decline temporarily in places, they will usually increase again eventually, suggesting that this phenomenon is due to the fluctuations of supplementary food stocks discussed above.[3]

Popular culture [edit]

The famous Rolls-Royce Merlin aeroengine is named for this bird.

SpaceX named its Merlin (rocket engine) after the Merlin.

See also [edit]

References [edit]

  1. ^ a b BirdLife International (2012). "Falco columbarius". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b c Henninger, W.F. (1906). "A preliminary list of the birds of Seneca County, Ohio". Wilson Bulletin 18 (2): 47–60. 
  3. ^ a b c d e f g h i j k l m n o p q White, Clayton M. (1994): 44. Merlin. In: del Hoyo, Josep; Elliott, Andrew & Sargatal, Jordi (eds.): Handbook of Birds of the World (Volume 2: New World vultures to Guineafowl): 267, plate 27. Lynx Edicions, Barcelona. ISBN 84-87334-15-6
  4. ^ a b c d Wink, Michael; Seibold, I.; Lotfikhah, F. & Bednarek, W. (1998): Molecular systematics of holarctic raptors (Order Falconiformes). In: Chancellor, R.D., Meyburg, B.-U. & Ferrero, J.J. (eds.): Holarctic Birds of Prey: 29-48. Adenex & WWGBP.
  5. ^ a b c Raptors of the World by Ferguson-Lees, Christie, Franklin, Mead & Burton. Houghton Mifflin (2001), ISBN 0-618-12762-3
  6. ^ a b c d White, Clayton M.; Olsen, Penny D. & Kiff, Lloyd F. (1994): Family Falconidae. In: del Hoyo, Josep; Elliott, Andrew & Sargatal, Jordi (eds.): Handbook of Birds of the World (Volume 2: New World vultures to Guineafowl): 216-275, plates 24-28. Lynx Edicions, Barcelona. ISBN 84-87334-15-6
  7. ^ a b Helbig, A.J.; Seibold, I.; Bednarek, W.; Brüning, H.; Gaucher, P.; Ristow, D.; Scharlau, W.; Schmidl, D. & Wink, Michael (1994): Phylogenetic relationships among falcon species (genus Falco) according to DNA sequence variation of the cytochrome b gene. In: Meyburg, B.-U. & Chancellor, R.D. (eds.): Raptor conservation today, pp. 593-599.
  8. ^ Griffiths, Carole S. (1999). "Phylogeny of the Falconidae inferred from molecular and morphological data". Auk 116 (1): 116–130. doi:10.2307/4089459. 
  9. ^ Groombridge, Jim J.; Jones, Carl G.; Bayes, Michelle K.; van Zyl, Anthony J.; Carrillo, José; Nichols, Richard A. & Bruford, Michael W. (2002). "A molecular phylogeny of African kestrels with reference to divergence across the Indian Ocean". Molecular Phylogenetics and Evolution 25 (2): 267–277. doi:10.1016/S1055-7903(02)00254-3. 
  10. ^ Martin, R.A.; Honey, J.G. & Pelaez-Campomanes, P. (2000). "The Meade Basin Rodent Project; a progress report. Kansas Geologial Survey Open-file Report 2000-61". Paludicola 3 (1): 1–32. 
  11. ^ Feduccia, J. Alan; Ford, Norman L. (1970). "Some birds of prey from the Upper Pliocene of Kansas". Auk 87 (4): 795–797. doi:10.2307/4083714. 
  12. ^ a b c Ohio Ornithological Society (OOS) (2004): Annotated Ohio state checklist. Version of April 2004.
  13. ^ del Hoyo, Josep; Elliott, Andrew & Sargatal, Jordi (eds.): Handbook of Birds of the World (Volume 2: New World vultures to Guineafowl). Lynx Edicions, Barcelona. ISBN 84-87334-15-6
  14. ^ a b Olson, Storrs L.; James, Helen F. & Meister, Charles A. (1981). "Winter field notes and specimen weights of Cayman Island Birds". Bulletin of the British Ornithologists' Club 101 (3): 339–346. 
  15. ^ Merlin. Carolina Raptor Center
  16. ^ Warkentin, Ian G. and Oliphant, Lynn W. (1988). "Seasonal Predation of Large Prey by Merlins". The Wilson Bulletin 100 (1): 137–139. JSTOR 4162530. 
  17. ^ AnAge (2009). Falco columbarius life history data. genomics.senescence.info
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Olsen et al. (1989) for a study of relationships within the genus FALCO based on electrophoretic patterns of feather proteins.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!