Articles on this page are available in 1 other language: Spanish (18) (learn more)

Overview

Distribution

Range

S Mexico to n Argentina and Brazil.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

King vultures are found in the southern part of Mexico and throughout Central and South America to northern Argentina.

Biogeographic Regions: neotropical (Native )

  • del Hoyo, J., A. Elliot, J. Sargutal, et. al. 1994. Handbook of the Birds of the World, Volume 2. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The most noticeable difference between king vultures and other vultures is that they are largely covered with white plumage. Their wings are mostly white with black tips. The ruff, flight and tail feathers are gray to black; the black areas have an almost opalescent sheen. Their wingspan is between 180 to 198 cm (71 to 78 inches), and from head to tail they are about 71 to 81 cm (28 to 32 inches). An adult can weigh from 3 kg (6.6lbs) up to more than 4.5 kg (9.9lbs). Their bare head, neck, beak and muttle are red, orange and yellow, with very striking eyes that are straw, white or silver in color. Their beaks have a hooked tip and cutting edges, which are very strong. Their feet are gray. These birds are very striking, especially since most other vultures are all black. There are no differences between the males and females of this species. When they are young, king vultures are covered with white downy feathers.

Range mass: 3000 to 4500 g.

Range length: 71 to 81 cm.

Range wingspan: 180 to 198 cm.

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

King vultures generally live in undisturbed forest in the lowland tropics. They have been found in savannas and grasslands also, but usually only when there are forests nearby. They can be found at elevations up to 1200 m. Little is known about king vultures in the wild, but it is believed that they live in the emergent layer of the forest, which is the top most part of the trees above the canopy. Their hard to reach preferred habitat could be why we do not know much about them.

Range elevation: 1200 (high) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest

  • De Roy, T. 1998. King of the Jungle. International Wildlife, 28: 52-57.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

King vultures are scavengers. Their only source of food is dead animals. King vultures are not known to kill any animals, not even ones that are obviously sick or ready to die. Unlike other New World vultures (family Cathartidae), king vultures arguably have no sense of smell. They will fly high in the sky watching and waiting for other smaller vultures to get excited about a find, they then swoop down out of the sky to the carrion. They usually end up stealing the carcass from the vulture that found it in the first place. They have more powerful beaks than other vultures, and are able to break through the tough hides of the carrion. It is often necessary for king vultures to make the initial tear through the hide so that other vultures, with less powerful beaks, can feed. Each New World vulture species has a unique part of a carcass that they specialize in eating. King vultures eat the skin and harder parts of tissue from the dead animals.

Animal Foods: carrion

Primary Diet: carnivore (Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

King vultures, as well as other members of the family Cathartidae, play an important role in their ecosystem. These birds are usually the first to find dead animals and immediately begin to dispose of the rotting remains. As are all scavengers, these birds are important in keeping their environment free of dead, decomposing animals; this may also help reduce possible sources of disease.

Ecosystem Impact: biodegradation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

King vultures and other members of the family Cathartidae do not seem to have many anti-predation adaptations. Their nests are vulnerable to animals that prey opportunistically on young and eggs (such as snakes (suborder Serpentes)). Adults are vulnerable while eating. If a large cat (family Felidae) comes to a carcass and the vulture is full of food then it may have a hard time getting off of the ground and away from danger. They are also vulnerable to attack if they are injured or ill.

There is some controversy, but it is believed that the nest sites of these birds are very smelly for the purpose of scaring off potential predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Sarcoramphus papa is prey of:
Serpentes
Felidae

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

King vultures, as well as all vultures in the family Cathartidae, lack a voice box (a syrinx and the muscles that make it work). They are not completely silent though, they do make very low croaking sounds. They also make noises during breeding, and give warning sounds if anything approaches their nests.

Communication Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

The King Vulture lays one egg, which is creamy white and takes 53-58 days to hatch. At times both parents incubate the egg while at other times it is just the female. Not much is known about why this behavior takes place. They do wander away from the nest as they get older, which might be a defense from being eaten. Apparently they begin to acquire their adult plumage around 18 months which grow slowly and takes about four years to fully grow in. The young remain with their parents for that period of time.

(honoluluzoo.org/king_vulture.htm; Stiles, F. Gary and Alexander, F. Skutch,1989; Del Hoyo, Elliot, Sargutal, et al., 1994)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is not very much information about king vultures in the wild, including their lifespan. However, there is at least one pair of birds in Paris that have been studied in captivity for over 30 years.

Average lifespan

Status: captivity:
40 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 40 years (captivity) Observations: There is one unverified report of these animals living up to 40 years in captivity (http://www.demogr.mpg.de/longevityrecords).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The courting ritual of Sarcoramphus papa has only been observed in captivity; it is quite an elaborate show. While mating they are known to be very loud, making unique wheezing and snorting sounds. Like most other members of their family, king vultures are most likely monogamous.

King vultures are solitary birds and do not nest in big colonies. They usually breed during the dry season. King vultures do not build nests, rather they lay their eggs in hollows of rotting logs or stumps or crevices in trees. They usually lay only one egg which is incubated by both parents. Juveniles begin to show adult plumage after 18 months.

Breeding season: Mainly in the dry season

Average eggs per season: 1.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average time to hatching: 57 days.

Both male and female king vultures participate in incubation. Young are altricial. Both parents care for the young at times, while at other times, it is just the mother.

Most birds of prey carry their food to their young in their claws, but New World Vultures (family Cathartidae) have a large crop that enables them to carry quite a bit of food in the gut. They then regurgitate the food to feed their young. Young chicks are fed directly from the parent’s beak, but as they get older, the parents regurgitate the food onto the ground for the young to eat.

Parental Investment: no parental involvement; altricial ; pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female)

  • Sibley, D. 2001. The Sibley Guide to Bird Life & Behavior. New York: Alfred A. Knopf, Inc.
  • De Roy, T. 1998. King of the Jungle. International Wildlife, 28: 52-57.
  • Stiles, F., A. Skutch. 1989. A guide to the Birds of Costa Rica. Comstock Publishing Associates.
  • del Hoyo, J., A. Elliot, J. Sargutal, et. al. 1994. Handbook of the Birds of the World, Volume 2. Barcelona: Lynx Edicions.
  • Chaffee Zoo, Date Unknown. "King Vulture" (On-line). Accessed 03/01/04 at http://www.chaffeezoo.org/zoo/animals/kingVulture.html.
  • Honolulu Zoo, 2004. "King Vulture" (On-line). Accessed 03/01/04 at http://www.honoluluzoo.org/king_vulture.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sarcoramphus papa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGACATTCATCAACCGATGATTATTCTCAACCAACCACAAAGACATTGGCACCCTGTACTTAATCTTTGGCGCATGAGCTGGCATGGTCGGCACAGCTCTTAGCCTACTCATTCGTGCCGAACTTGGACAGCCCGGAACCCTCTTAGGCGATGACCAAATCTACAACGTAATTGTTACCGCTCACGCCTTCGTAATAATTTTCTTCATAGTAATGCCCATCATAATTGGGGGATTTGGAAACTGACTGGTCCCACTTATAATTGGTGCCCCCGACATAGCATTCCCACGTATAAACAACATAAGCTTCTGACTACTTCCCCCCTCCTTCTTACTCCTACTGGCCTCCTCTACAGTAGAGGCGGGAGCAGGTACAGGATGAACCGTGTACCCTCCATTAGCCGGCAACCTTGCCCACGCTGGGGCATCAGTAGACCTAGCTATCTTCTCCCTCCACCTAGCTGGTGTGTCATCCATCCTGGGCGCAATCAACTTCATCACAACCGCTATCAACATAAAACCACCAGCTCTCTCACAATACCAGACTCCTCTATTCGTGTGGTCTGTCCTCATCACCGCAGTACTACTACTTCTCTCACTCCCAGTCCTCGCTGCTGGAATCACCATGCTGCTAACAGACCGAAACCTAAACACTACATTCTTTGACCCTGCTGGAGGAGGTGATCCTGTACTATACCAACACCTCTTCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sarcoramphus papa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be small, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

King vultures are rarely seen in large numbers and several have been sited in a areas where they were previously thought not to exist. It is apparent, however, that human encroachment and habitat loss have had an adverse affect on king vultures. They are listed as Appendix III by CITES.

CITES: appendix iii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimated the population to number fewer than 50,000 individuals (A. Panjabi in litt. 2008). Ferguson-Lees et al. (2001) suggest it is likely to number 1,000-10,000 individuals, roughly equating to 670-6,700 mature individuals.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of king vultures on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

As a result of their unique beauty and size, king vultures are an attraction at zoos.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

King vulture

For the Asian species formerly known by the same name, see Red-headed vulture.

The king vulture (Sarcoramphus papa) is a large bird found in Central and South America. It is a member of the New World vulture family Cathartidae. This vulture lives predominantly in tropical lowland forests stretching from southern Mexico to northern Argentina. It is the only surviving member of the genus Sarcoramphus, although fossil members are known.

Large and predominantly white, the king vulture has gray to black ruff, flight, and tail feathers. The head and neck are bald, with the skin color varying, including yellow, orange, blue, purple, and red. The king vulture has a very noticeable yellow fleshy caruncle on its beak. This vulture is a scavenger and it often makes the initial cut into a fresh carcass. It also displaces smaller New World vulture species from a carcass. King vultures have been known to live for up to 30 years in captivity.

King vultures were popular figures in the Mayan codices as well as in local folklore and medicine. Although currently listed as least concern by the IUCN, they are decreasing in number, due primarily to habitat loss.

Taxonomy and systematics[edit]

The king vulture was originally described by Carl Linnaeus in 1758 in the tenth edition of his Systema Naturae as Vultur papa,[2] the type specimen originally collected in Surinam.[3] It was reassigned to the genus Sarcoramphus in 1805 by French zoologist André Marie Constant Duméril. The generic name is a New Latin compound formed from the Greek words σάρξ (sarx, "flesh", the combining form of which is σαρκο-) and ῥάμφος (rhamphos, "crooked beak of bird of prey").[4] The genus name is often misspelled as Sarcorhamphus, improperly retaining the Greek rough breathing despite agglutination with the previous word-element. The bird was also assigned to the genus Gyparchus by Constantin Wilhelm Lambert Gloger in 1841, but this classification is not used in modern literature since Sarcoramphus has priority as the earlier name.[5] The species name is derived from Latin word papa "bishop", alluding the bird's plumage resembling the clothing of one.[6] The king vulture's closest living relative is the Andean condor, Vultur gryphus.[7] Some authors have even put these species in a separate subfamily from the other New World vultures, though most authors consider this subdivision unnecessary.[7]

There are two theories on how the king vulture earned the "king" part of its common name. The first is that the name is a reference to its habit of displacing smaller vultures from a carcass and eating its fill while they wait.[8] An alternative theory reports that the name is derived from Mayan legends, in which the bird was a king who served as a messenger between humans and the gods.[9] This bird was also known as the "white crow" by the Spanish in Paraguay.[10] It was called cozcacuauhtli in Nahuatl, derived from cozcatl "collar" and cuauhtli "bird of prey".[11]

The exact systematic placement of the king vulture and the remaining six species of New World vultures remains unclear.[12] Though both are similar in appearance and have similar ecological roles, the New World and Old World vultures evolved from different ancestors in different parts of the world. Just how different the two are is currently under debate, with some earlier authorities suggesting that the New World vultures are more closely related to storks.[13] More recent authorities maintain their overall position in the order Falconiformes along with the Old World vultures[14] or place them in their own order, Cathartiformes.[15] The South American Classification Committee has removed the New World vultures from Ciconiiformes and instead placed them in Incertae sedis, but notes that a move to Falconiformes or Cathartiformes is possible.[12] Like other New World vultures, the king vulture has a diploid chromosome number of 80.[16]

Fossil record and evolution[edit]

The genus Sarcoramphus, which today contains only the king vulture, had a wider distribution in the past. The Kern vulture (Sarcoramphus kernense), lived in southwestern North America during the mid-Pliocene (Piacenzian), some 3.5–2.5 million years ago). It was a little-known component of the Blancan/Delmontian faunal stages. The only material is a broken distal humerus fossil, found at Pozo Creek, Kern County, California. As per Loye H. Miller's original description, "[c]ompared with [S. papa] the type conforms in general form and curvature except for its greater size and robustness."[17] The large span in time between the existence of the two species suggests that the Kern vulture might be distinct, but as the fossil is somewhat damaged and rather non-diagnostic, even assignment to this genus is not completely certain.[18] During the Late Pleistocene, another species probably assignable to the genus, Sarcoramphus fisheri, occurred in Peru.[19] A supposed king vulture relative from Quaternary cave deposits on Cuba turned out to be bones of the eagle-sized hawk Buteogallus borrasi (formerly in Titanohierax).[20]

Little can be said of the evolutionary history of the genus, mainly because remains of other Neogene New World vultures are usually younger or even more fragmentary. The teratorns held sway over the ecological niche of the extant group especially in North America. The Kern vulture seems to slightly precede the main bout of the Great American Interchange, and it is notable that the living diversity of New World vultures seems to have originated in Central America.[17] The Kern vulture would therefore represent a northwards divergence possibly sister to the S. fisheriS. papa lineage. The fossil record, though scant, supports the theory that the ancestral king vultures and South American condors separated at least some 5 mya.[21]

Bartram's "painted vulture"[edit]

Eleazar Albin's 1734 drawing which has sometimes been identified as a "painted vulture"

A "painted vulture" ("Sarcoramphus sacra" or "S. papa sacra") is described in William Bartram's notes of his travels in Florida during the 1770s. This bird's description matches the appearance of the king vulture except that it had a white, not black, tail.[22] Bartram describes the bird as being relatively common and even claimed to have collected one.[22] However, no other naturalists record the painted vulture in Florida and sixty years after the sighting its validity began to be questioned, leading to what John Cassin described as the most inviting problem in North American ornithology.[22] An independent account and painting was made of a similar bird by Eleazar Albin in 1734.[23]

While most early ornithologists defended Bartram's honesty, Joel Asaph Allen argued that the painted vulture was mythical and that Bartram mixed elements of different species to create this bird.[22] Allen pointed out that the birds' behavior, as recorded by Bartram, is in complete agreement with the caracara's.[22] For example, Bartram observed the birds following wildfires to scavenge for burned insects and box turtles. Such behavior is typical of caracaras, but the larger and shorter-legged king vultures are not well adapted for walking. The northern crested caracara (Caracara cheriway) was believed to be common and conspicuous in Bartram's days, but it is notably absent from Bartram's notes if the painted vulture is accepted as a Sarcoramphus.[22] However, Francis Harper argued that the bird could, as in the 1930s, have been rare in the area Bartram visited and could have been missed.[22]

Harper noticed that Bartram's notes were considerably altered and expanded in the printed edition, and the detail of the white tail appeared in print for the first time in this revised account. Harper believed that Bartram could have tried to fill in details of the bird from memory and got the tail coloration wrong.[22] Harper and several other researchers have attempted to prove the former existence of a king vulture relative in Florida at this late date, suggesting that the population was in the process of extinction and finally disappeared during a cold spell.[22][24] Additionally, William McAtee, noting the tendency of birds to form Floridian subspecies, suggested that the white tail could be a sign that the painted vulture was a subspecies of the king vulture.[25]

Description[edit]

Soaring in Piaui, Brazil
Side view of the head (Weltvogelpark Walsrode)

Excluding the two species of condors, the king vulture is the largest of the New World vultures. Its overall length ranges from 67–81 centimeters (27–32 in) and its wingspan is 1.2–2 meters (4–6.6 ft). Its weight ranges from 2.7–4.5 kilograms (6–10 lb).[9][26] An imposing bird, the adult king vulture has predominantly white plumage, which has a slight rose-yellow tinge to it.[27] In stark contrast, the wing coverts, flight feathers and tail are dark grey to black, as is the prominent thick neck ruff.[3] The head and neck are devoid of feathers, the skin shades of red and purple on the head, vivid orange on the neck and yellow on the throat.[28] On the head, the skin is wrinkled and folded, and there is a highly noticeable irregular golden crest attached on the cere above its orange and black bill;[3] this caruncle does not fully form until the bird’s fourth year.[29]

The king vulture has the largest skull and braincase, and strongest bill of the New World vultures.[18] This bill has a hooked tip and a sharp cutting edge.[6] The bird has broad wings and a short, broad, and square tail.[27] The irises of its eyes are white and bordered by bright red sclera.[3] Unlike some New World vultures, the king vulture lacks eyelashes.[30] It also has gray legs and long, thick claws.[27]

The vulture is minimally sexually dimorphic, with no difference in plumage and little in size between males and females.[3] The juvenile vulture has a dark bill and eyes, and a downy, gray neck that soon begins to turn the orange of an adult. Younger vultures are a slate gray overall, and, while they look similar to the adult by the third year, they do not completely molt into adult plumage until they are around five or six years of age.[27] Jack Eitniear of the Center for the Study of Tropical Birds in San Antonio, Texas reviewed the plumage of birds in captivity of various ages and found that ventral feathers were the first to begin turning white from two years of age onwards, followed by wing feathers, until the full adult plumage was achieved. The final immature stages being a scattered black feathers in the otherwise white lesser wing coverts.[31]

The vulture's head and neck are featherless as an adaptation for hygiene, though there are black bristles on parts of the head; this lack of feathers prevents bacteria from the carrion it eats from ruining its feathers and exposes the skin to the sterilizing effects of the sun.[6][32]

Dark-plumaged immature birds may be confused with turkey vultures, but soar with flat wings, while the pale plumaged adults could feasibly be confused with the wood stork,[33] although the latter's long neck and legs allow for easy recognition from afar.[34]

Distribution and habitat[edit]

A view from above over a wooded ravine at Braulio Carrillo National Park, Costa Rica

The king vulture inhabits an estimated 14 million km2 (5.4 million mi2) between southern Mexico and northern Argentina.[35] In South America, it does not live west of the Andes,[29] except in western Ecuador,[36] north-western Colombia and far north-western Venezuela.[37] It primarily inhabits undisturbed tropical lowland forests as well as savannas and grasslands with these forests nearby.[38] It is often seen near swamps or marshy places in the forests.[10] This bird is often the most numerous or only vulture present in primary lowland forests in its range, but in the Amazon rainforest it is typically outnumbered by the greater yellow-headed vulture, while typically outnumbered by the lesser yellow-headed, turkey and American black vulture in more open habitats.[39] King vultures generally do not live above 1500 m (5000 ft), although are found in places at 2500 m (8000 ft) altitude east of the Andes, and have been rarely recorded up to 3300 m (10000 ft)[26] They inhabit the emergent forest level, or above the canopy.[3] Pleistocene remains have been recovered from Buenos Aires Province in central Argentina, over 700 km (450 mi) south of its current range, giving rise to speculation on the habitat there at the time which had not been thought to be suitable.[40]

Ecology and behavior[edit]

Flying.

The king vulture soars for hours effortlessly, only flapping its wings infrequently.[34][41] While in flight, its wings are held flat with slightly raised tips, and from a distance the vulture can appear to be headless while in flight.[42] Its wing beats are deep and strong.[27] Birds have been observed engaging in tandem flight on two occasions in Venezuela by naturalist Marsha Schlee, who has proposed it could be a part of courtship behaviour.[43]

Despite its size and gaudy coloration, this vulture is quite inconspicuous when it is perched in trees.[42] While perched, it holds its head lowered and thrust forward.[26] It is non-migratory and, unlike the turkey, lesser yellow-headed and American black vulture, it generally lives alone or in small family groups.[44] Groups of up to 12 birds have been observed bathing and drinking in a pool above a waterfall in Belize.[45] One or two birds generally descend to feed at a carcass, although occasionally up to ten or so may gather if there is significant amount of food.[3] King vultures have lived up to 30 years in captivity, though their lifespan in the wild is unknown.[9] This vulture uses urohidrosis, defecating on its legs, to lower its body temperature. Despite its bill and large size, it is relatively unaggressive at a kill.[3] The king vulture lacks a voice box, although it can make low croaking noises and wheezing sounds in courtship, and bill-snapping noises when threatened.[26] Its only natural predators are snakes, which will prey upon the vulture's eggs and young, and large cats such as jaguars, which may surprise and kill an adult vulture at a carcass.[46]

Diet[edit]

The king vulture eats anything from cattle carcasses to beached fish and dead lizards. Principally a carrion eater, there are isolated reports of it killing and eating injured animals, newborn calves and small lizards.[26]

Although it locates food by vision, the role smell has in how it specifically finds carrion has been debated. Consensus has been that it does not detect odours, and instead follows the smaller turkey and greater yellow-headed vultures, which do have a sense of smell, to a carcass,[3][47] but a 1991 study demonstrated that the king vulture could find carrion in the forest without the aid of other vultures, suggesting that it locates food using an olfactory sense.[48] The king vulture primarily eats carrion found in the forest, though it is known to venture onto nearby savannas in search of food. Once it has found a carcass, the king vulture displaces the other vultures because of its large size and strong bill.[3] However, when it is at the same kill as the larger Andean condor, the king vulture always defers to it.[49] Using its bill to tear, it makes the initial cut in a fresh carcass. This allows the smaller, weaker-beaked vultures, which can not open the hide of a carcass, access to the carcass after the king vulture has fed.[3] The vulture’s tongue is rasp-like, which allows it to pull flesh off of the carcass’s bones.[32] Generally, it only eats the skin and harder parts of the tissue of its meal.[46] The king vulture has also been recorded eating fallen fruit of the moriche palm when carrion is scarce in Bolívar state, Venezuela.[50]

Breeding[edit]

Adult at the Berlin Zoo

The reproductive behaviour of the king vulture in the wild is poorly known, and much knowledge has been gained from observing birds in captivity,[51] particularly at the Paris Menagerie.[52] An adult king vulture sexually matures when it is about four or five years old, with females maturing slightly earlier than males.[53] The birds mainly breed during the dry season.[46] King vultures mate for life and generally lay a single unmarked white egg in its nest in a hollow in a tree.[27] To ward off potential predators, the vultures keep their nests foul-smelling.[51] Both parents incubate the egg for the 52 to 58 days before it hatches. If the egg is lost, it will often be replaced after about six weeks. The parents share incubating and brooding duties until the chick is about a week old, after which they often stand guard rather than brood. The young are semi-altricial—they are helpless when born but are covered in downy feathers (truly altricial birds are born naked), and their eyes are open at birth. Developing quickly, the chicks are fully alert by their second day, and able to beg and wriggle around the nest, and preen themselves and peck by their third day. They start growing their second coat of white down by day 10, and stand on their toes by day 20. From one to three months of age, chicks walk around and explore the vicinity of the nest, and take their first flights at about three months of age.[52]

Conservation[edit]

This bird is a species of least concern to the IUCN,[1] with an estimated range of 14 million km2 (5.4 million mi2) and between 10,000 and 100,000 wild individuals. However, there is evidence that suggests a decline in population, though it is not significant enough to cause it to be listed.[35] This decline is due primarily to habitat destruction and poaching.[44] Although distinctive, its habit of perching in tall trees and flying at altitude render it difficult to monitor.[3]

Relationship with humans[edit]

Cozcacuauhtli from the Codex Laud

The king vulture is one of the most common species of birds represented in the Mayan codices.[54] Its glyph is easily distinguishable by the knob on the bird’s beak and by the concentric circles that make up the bird’s eyes.[54] Sometimes the bird is portrayed as a god with a human body and a bird head.[54] According to Mayan mythology, this god often carried messages between humans and the other gods.[46] It is also used to represent Cozcacuauhtli, the thirteenth day of the month in the Mayan calendar (13 Reed).[54] An ocellated turkey (Meleagris ocellata) was also considered to be the bird depicted, but the hooked bill and wattle point to the raptor.[11]

The bird’s blood and feathers were also used to cure diseases.[32] The king vulture is also a popular subject on the stamps of the countries within its range. It appeared on a stamp for El Salvador in 1963, Belize in 1978, Guatemala in 1979, Honduras in 1997, Bolivia in 1998, and Nicaragua in 1999.[55]

Because of its large size and beauty, the king vulture is an attraction at zoos around the world. The king vulture is one of several bird species with an AZA studbook, which is kept by Shelly Collinsworth of the Fort Worth Zoo.[56]

References[edit]

  1. ^ a b BirdLife International (2012). "Sarcoramphus papa". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ (Latin) Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). p. 86. "V. naribus carunculatis, vertice colloque denudate" 
  3. ^ a b c d e f g h i j k l Houston, D.C. (1994). "Family Cathartidae (New World vultures)". In del Hoyo, Josep; Elliott, Andrew; Sargatal, Jordi (eds.). Volume 2: New World Vultures to Guineafowl of Handbook of the Birds of the World. Barcelona: Lynx edicions. pp. 24–41. ISBN 84-87334-15-6. 
  4. ^ Liddell, Henry George; Robert Scott (1980). Greek-English Lexicon, Abridged Edition. Oxford: Oxford University Press. ISBN 0-19-910207-4. 
  5. ^ Peterson, Alan P. (23 December 2007). "Richmond Index – Genera Aaptus – Zygodactylus". The Richmond Index. Division of Birds at the National Museum of Natural History. Retrieved 17 January 2008. 
  6. ^ a b c Likoff, Laurie (2007). "King Vulture". The Encyclopedia of Birds. Infobase Publishing. pp. 557–60. ISBN 0-8160-5904-7. 
  7. ^ a b Amadon, Dean (1977). "Notes on the Taxonomy of Vultures" (PDF). The Condor (The Condor, Vol. 79, No. 4) 79 (4): 413–16. doi:10.2307/1367720. JSTOR 1367720. Retrieved 13 March 2009. 
  8. ^ Wood, John George (1862). The illustrated natural history. London: Routledge, Warne and Routledge. pp. 15–17. 
  9. ^ a b c "King Vulture". National Geographic. Retrieved 11 September 2007. 
  10. ^ a b Wood, John George (1862). The illustrated natural history. Oxford University. ISBN 0-19-913383-2. 
  11. ^ a b Diehl, Richard A.; Berlo, Janet Catherine (1989). Mesoamerica after the decline of Teotihuacan, A.D. 700–900, Parts 700–900. pp. 36–37. ISBN 0-88402-175-0. 
  12. ^ a b Remsen, J. V., Jr.; C. D. Cadena; A. Jaramillo; M. Nores; J. F. Pacheco; M. B. Robbins; T. S. Schulenberg; F. G. Stiles; D. F. Stotz & K. J. Zimmer. 2007. A classification of the bird species of South America. South American Classification Committee. Retrieved on 15 October 2007
  13. ^ Sibley, Charles G.; Monroe, Burt L.. (1990). Distribution and Taxonomy of the Birds of the World. Yale University Press. ISBN 0-300-04969-2. Retrieved 11 April 2007. 
  14. ^ Sibley, Charles G., and Ahlquist, Jon E.. 1991. Phylogeny and Classification of Birds: A Study in Molecular Evolution. Yale University Press. ISBN 0-300-04085-7. Retrieved 11 April 2007.
  15. ^ Ericson, Per G. P.; Anderson, Cajsa L.; Britton, Tom; Elżanowski, Andrzej; Johansson, Ulf S.; Kallersjö, Mari; Ohlson, Jan I.; Parsons, Thomas J.; Zuccon, Dario & Mayr, Gerald (2006): Diversification of Neoaves: integration of molecular sequence data and fossils. Biology Letters online: 1–5. doi:10.1098/rsbl.2006.0523 PDF preprint
  16. ^ Tagliarini, Marcella Mergulhão; Pieczarka, Julio Cesar; Nagamachi, Cleusa Yoshiko; Rissino, Jorge; de Oliveira, Edivaldo Herculano C. (2009). "Chromosomal analysis in Cathartidae: distribution of heterochromatic blocks and rDNA, and phylogenetic considerations". Genetica 135 (3): 299–304. doi:10.1007/s10709-008-9278-2. PMID 18504528. 
  17. ^ a b Miller, Loye H. (1931). "Bird Remains from the Kern River Pliocene of California". The Condor 33 (2): 70–72. doi:10.2307/1363312. 
  18. ^ a b Fisher, Harvey L. (1944). "The skulls of the Cathartid vultures". The Condor 46 (6): 272–296. doi:10.2307/1364013. 
  19. ^ Wilbur, Sanford (1983). Vulture Biology and Management. Berkeley: University of California Press. p. 12. ISBN 0-520-04755-9. 
  20. ^ Suárez, William (2001). "A Re-evaluation of Some Fossils Identified as Vultures (Aves: Vulturidae) from Quaternary Cave Deposits of Cuba". Caribbean Journal of Science 37 (1–2): 110–111. 
  21. ^ Wilbur, Sanford (1983). Vulture Biology and Management. Berkeley: University of California Press. p. 6. ISBN 0-520-04755-9. 
  22. ^ a b c d e f g h i Harper, Francis (October 1936). "The Vutlur sacra of William Bartram". Auk (Lancaster, PA: American Ornithologist’s Union) 53 (4): 381–392. doi:10.2307/4078256. Retrieved 2010-11-15. 
  23. ^ Snyder, N. F. R.; Fry, J. T. (2013). "Validity of Bartram's Painted Vulture". Zootaxa 3613 (1). doi:10.11646/zootaxa.3613.1.3.  edit
  24. ^ Day, David (1981): The Doomsday Book of Animals: Ebury, London/Viking, New York. ISBN 0-670-27987-0
  25. ^ McAtee, William Lee (January 1942). "Bartram's Painted Vulture". Auk (Lancaster, PA: American Ornithologist’s Union) 59 (1): 104. doi:10.2307/4079172. Retrieved 15 November 2010. 
  26. ^ a b c d e Ferguson-Lees, James; Christie, David A (2001). Raptors of the World. Houghton Mifflin Company. pp. 88, 315–16. ISBN 978-0-618-12762-7. 
  27. ^ a b c d e f Howell, Steve N.G.; Webb, Sophie (1995). A Guide to the Birds of Mexico and Northern Central America. New York: Oxford University Press. p. 176. ISBN 0-19-854012-4. 
  28. ^ Terres, J. K. (1980). The Audubon Society Encyclopedia of North American Birds. New York, NY: Knopf. p. 959. ISBN 0-394-46651-9. 
  29. ^ a b Gurney, John Henry (1864). A descriptive catalogue of the raptorial birds in the Norfolk and Norwich museum. Oxford University. Retrieved 13 March 2009. 
  30. ^ Fisher, Harvey I. (March 1943). "The Pterylosis of the King Vulture" (PDF). Condor (The Condor, Vol. 45, No. 2) 45 (2): 69–73. doi:10.2307/1364380. JSTOR 1364380. Retrieved 13 March 2009. 
  31. ^ Eitniear, Jack Clinton (1996). "Estimating age classes in king vultures (Sarcoramphus papa) using plumage coloration". Journal of Raptor Research 30 (1): 35–38. Retrieved 16 November 2010. 
  32. ^ a b c "Sarcoramphus papa". Who Zoo. Retrieved 11 September 2007. 
  33. ^ Hilty, Stephen L.; Brown, William L.; Brown, Bill (1986). A guide to the birds of Colombia. Princeton, NJ: Princeton University Press. p. 88. ISBN 0-691-08372-X. 
  34. ^ a b Henderson, Carrol L.; Adams, Steve; Skutch, Alexander F. (2010). Birds of Costa Rica: A Field Guide. University of Texas Press. p. 66. ISBN 0-292-71965-5. 
  35. ^ a b "Species factsheet: Sarcoramphus papa". BirdLife International. 2010. Retrieved 11 September 2007. 
  36. ^ Ridgely, Robert; Greenfield, Paul (2001). Birds of Ecuador: Field Guide. Cornell University Press. p. 74. ISBN 0-8014-8721-8. 
  37. ^ Restall, Robin; Rodner, Clemencia; Lentino, Miguel (2006). Birds of Northern South America: An Identification Guide. Vol. 2. Christopher Helm. p. 68. ISBN 0-7136-7243-9. 
  38. ^ Brown, Leslie (1976). Birds of Prey: Their biology and ecology. Hamlyn. p. 59. ISBN 0-600-31306-9. 
  39. ^ Restall, Robin; Rodner, Clemencia; Lentino, Miguel (2006). Birds of Northern South America: An Identification Guide. Vol. 1. Christopher Helm. pp. 80–83. ISBN 0-7136-7242-0. 
  40. ^ Noriega, Jorge I.; Areta, Juan I. (2005). "First record of Sarcoramphus Dumeril 1806 (Ciconiiformes : Vulturidae) from the Pleistocene of Buenos Aires province, Argentina". Journal of South American Earth Sciences 20 (1–2 (SI)): 73–79. doi:10.1016/j.jsames.2005.05.004. Retrieved 10 November 2010. 
  41. ^ Schulenberg, Thomas S. (2007). Birds of Peru. Princeton, NJ: Princeton University Press. p. 84. ISBN 0-691-13023-X. 
  42. ^ a b Ridgely, Robert S.; Gwynne, John A. Jr. (1989). A Guide to the Birds of Panama with Costa Rica, Nicaragua, and Honduras (Second ed.). Princeton, NJ: Princeton University Press. p. 84. ISBN 0-691-02512-6. 
  43. ^ Schlee, Marsha (2001). "First record of tandem flying in the King Vulture (Sarcoramphus papa)". Journal of Raptor Research 35 (3): 263–64. Retrieved 16 November 2010. 
  44. ^ a b Bellinger, Jack (March 25, 1997). "King Vulture AZA Studbook". Archived from the original on November 10, 2006. Retrieved 8 October 2007. 
  45. ^ Baker, Aaron J.; Whitacre, David F.; Aguirre, Oscar (1996). "Observations of king vultures (Sarcoramphus papa) drinking and bathing". Journal of Raptor Research 30 (4): 246–47. 
  46. ^ a b c d Ormiston, D. "Sarcoramphus papa". Animal Diversity Web. Retrieved 11 September 2007. 
  47. ^ Beason, Robert C. (2003). Through a Birds Eye: Exploring Avian Sensory Perception (PDF). University of Nebraska. Retrieved 11 September 2007. 
  48. ^ Lemon, William C (December 1991). "Foraging behavior of a guild of Neotropical vultures" (PDF). Wilson Bulletin 103 (4): 698–702. Retrieved 13 March 2009. 
  49. ^ "Ecology of Condors". Archived from the original on 1 October 2006. Retrieved 5 October 2006. 
  50. ^ Schlee, Marsha (2005). "King vultures (Sarcoramphus papa) forage in moriche and cucurit palm stands". Journal of Raptor Research 39 (4): 458–61. Retrieved 10 November 2010. 
  51. ^ a b de Roy, Tui (1998). "King of the Jungle". International Wildlife (28): 52–57. ISSN 0020-9112. 
  52. ^ a b Schlee, Marsha A. (1994). "Reproductive Biology in King Vultures at the Paris Menagerie". International Zoo Yearbook 33 (33): 159–75. doi:10.1111/j.1748-1090.1994.tb03570.x. 
  53. ^ Grady, Wayne (1997). Vulture: Nature’s Ghastly Gourmet. San Francisco: Sierra Club Books. p. 47. ISBN 0-87156-982-5. 
  54. ^ a b c d Tozzer, Alfred Marston; Glover Morrill Allen (1910). Animal Figures in the Maya Codices. Harvard University. 
  55. ^ "King Vulture". Bird Stamps. Retrieved 17 October 2007. 
  56. ^ "Vulture, King Studbook". AZA website. Silver Spring, MD: Association of Zoos and Aquariums. 2010. Retrieved 15 November 2010.  (subscription required)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!