Articles on this page are available in 1 other language: Spanish (16) (learn more)

Overview

Brief Summary

The Lesser Yellow-headed Vulture, Cathartes burrovianus, also known as the Savannah Vulture, is a species of bird in the New World Vulture family Cathartidae. It was considered to be the same species as the Greater Yellow-headed Vulture until they were split in 1964. It is found in Mexico, Central America, and South America in seasonally wet or flooded lowland grassland, swamps, and heavily degraded former forest. It is a large bird, with a wingspan of 150-165 centimeters (59–65 in). The body plumage is black, and the head and neck, which are featherless, are pale orange with red or blue areas. It lacks a syrinx, so therefore its vocalizations are limited to grunts or low hisses.

The Lesser Yellow-headed Vulture feeds on carrion and locates carcasses by sight and by smell, an ability which is rare in birds. It is dependent on larger vultures, such as the King Vulture, to open the hides of larger animal carcasses as its bill is not strong enough to do this. Like other New World Vultures, the Lesser Yellow-headed Vulture utilizes thermals to stay aloft with minimal effort. It lays its eggs on flat surfaces, such as the floors of caves, or in the hollows of stumps. It feeds its young by regurgitation.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Wikipedia editors and contributors

Supplier: Cyndy Parr

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cathartes burrovianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGACATTCATCAATCGATGATTATTCTCAACCAATCACAAAGACATCGGTACCCTATACTTAATTTTCGGCGCATGAGCTGGCATAGCTGGCACTGCCCTTAGTCTACTAATTCGGGCCGAGCTCGGACAACCCGGAACCCTCTTAGGAGACGACCAAATCTATAACGTAATTGTCACTGCCCATGCCTTCGTGATAATTTTCTTCATAGTAATACCCATCATAATTGGAGGATTTGGAAACTGATTAGTCCCACTTATAATCGGCGCCCCCGACATGGCATTCCCACGAATAAACAACATAAGCTTCTGGCTACTTCCCCCATCCTTCCTACTCCTACTAGCCTCTTCTACAGTAGAAGCTGGAGCGGGCACAGGATGAACCGTATACCCCCCACTAGCTGGCAACCTTGCCCACGCCGGGGCATCGGTAGACCTAGCCATTTTCTCCCTTCACCTAGCTGGGGTATCGTCCATCTTAGGTGCAATCAACTTTATTACAACCGCTATCAACATAAAACCCCCAGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTCATTACTGCAGTACTACTACTCCTCTCACTTCCAGTCCTTGCTGCTGGAATCACTATACTGGTAACAGACCGAAACCTAAACACCACATTCTTTGACCCTGCCGGAGGAGGGGATCCGGTCCTATATCAGCACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTATA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cathartes burrovianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5