Overview

Distribution

The gyrfalcon (Falco rusticolus) is an arctic dwelling species with a holarctic distribution. It is rarely found south of 60 degrees. The majority of the breeding range is found north of 60 degrees while in parts of Eastern Canada it can be found breeding to 55 degrees, mainly along sea coasts. Although gyrfalcons are non-migratory, they will disperse from the breeding range during the winter season, very rarely reaching the northern limit of the United States (Poole 1987; Wheeler and Clark 1995; Cade 1982).

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Holarctic. BREEDS: in Alaska (see Johnson and Herter [1989] for details), northern Canada, Greenland, Iceland, northern Scandinavia, northern Russia, and northern Siberia. WINTERS: south to mid-Europe, Japan, southern Canada, and irregularly to the northern coterminous U.S.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Mountains and tundra of n Palearctic region and n North America.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The world's largest falcon is polymorphic, being recognized in three color phases: white, grey, and dark. The dark phase is dark grey, almost black, in some individuals and groups of this morph are found in northern Canada. The white morph is generally found in Greenland, and is usually almost pure white with some markings usually on the wings. The grey morph is an intermediate and found throughout the range, typically two tones of grey are found on the body, most easily beind seen on the flight feathers versus the rest of the wing. This species is sexually dimorphic and thus has a wide ranging weight. Males weigh 800-1300g, averaging 53cm total length and females weigh 1400-2100g, averaging 56cm total length. The shape of the gyrfalcon is characteristically the same as most falcons. This includes long pointed wings (unlike the rounded wings of buteos), long tail and a notched bill. It also however, differs from other falcons by large size, shorter wings that only extend 2/3 down the tail when perched (compared with other falcons where the wings extend all the way to the tail), and broader wings. Adults characteristically have yellow ceres, eye-rings and legs while juveniles display these features in a blue color. As in all falcons, the eyes appear black. This species may perhaps only be confused with the Northern Goshawk (Accipiter gentilis) which inhabits dense forests, or the Peregrine Falcon (Falco peregrinus) which is somewhat smaller with a dark slaty-blue-black "helmet" and a lighter underside(Wheeler and Clark 1995; Cade 1982).

Range mass: 800 to 2100 g.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 64 cm

Weight: 2100 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The gyrfalcon is typically found in northern latitudes away from the boreal forest. Although some individuals have been recorded nesting in trees, the majority of individuals of this species nest in the arctic tundra. Nesting habitat is usually among tall cliffs while the hunting and foraging areas are more diverse. Foraging areas may include coastal areas and beaches that are used heavily by waterfowl, stooping off cliffs at unsuspecting prey such as small birds beneath them, or on the open tundra where tail chases on ptarmigan and larger mammals is common.

Habitat fragmentation is currently not a threat to this species, due mainly to the short growing season and climate of the area. Since cliff faces are not disturbed and the tundra is not highly altered nor farmed, habitat for this species seems to be stable.

Winter can force this species to move regionally to feed. While in more southern climates, they prefer agricultural fields which remind them of their northern breeding grounds, typically perching low to the ground on fence posts (Pletz, E. 2000 personal communication; Poole 1987).

Terrestrial Biomes: tundra

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Primarily open country in the Arctic, including tundra, open coniferous forest, mountainous regions, and rocky seacoasts; generally in coastal areas in winter (AOU 1983, National Geographic Society 1983).

Usually nests on cliff ledges, ideally beneath sheltering overhang; sometimes nests in trees or on man-made structures. Nest generally is a scrape on a rock ledge or an abandoned hawk or raven nest. May nest on same cliffs as does peregrine. May compete successfully with peregrine for nest sites. May change nest site in successive years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Overwinters as far north as available prey allows. Many individuals, especially those from the high arctic, migrate south for winter (especially juveniles and prebreeders); migrant females arrive on breeding areas mid-February to early March (Cade 1982). Satellite telemetry has documented migrations between Alaska and eastern Asia (Britten et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Unlike eagles which use their large size to rob meals, and peregrine falcons which use gravity to gain tremendous speed, the gyrfalcon uses raw power to capture prey, usually in a tail chase. Usually low coursing flights are used in open habitat (no trees for concealment) where gyrfalcons will strike prey both in the air or on the ground . The majority of prey (by biomass) that consitutes the diet consists of ptarmigan (Lagopus sp.), Arctic ground squirrel (Spermophilus parryii) and Arctic hares (Lepus arcticus). Other prey includes other small mammals (mice and voles) as well as other birds (ducks, sparrows, buntings)

While hunting, this falcon uses keen eyesight to spot potential prey, as almost all animals in the north are cryptically colored to avoid detection. When potential prey is spotted a chase usually occurs where more than likely the prey will be knocked to the ground in a powerful blow from the talons and then pounced upon. Gyrfalcons are powerful enough to have sustained flight while hunting and occasionally wear their prey out until capture is easy. During nesting, the gyrfalcon will also cache meals with large prey such as Arctic hares between feedings. Rock doves (Columba livia), or pigeons as they are commonly known, although not native are preyed upon heavily in major centers by gyrfalcons during winter months (Lange and Dekker 1999; Stelfox and Fisher 1998; Cade 1982; Poole 1987).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Diet mostly consists of birds (especially ptarmigans which make up 85-95% of their diet by weight, although other birds of prey, ducks, auks, gulls, and terns are locally important). Small mammals are important in some areas and to young birds (Cade 1982). Primary prey in central Canadian arctic: rock ptarmigan, arctic ground squirrel, and arctic hare (Poole and Boag 1988). Takes most prey from the ground rather than from the air. See Palmer (1988) for many details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Falco rusticolus preys on:
Asio flammeus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Estimated number of breeding pairs in Canada in the early 1990s was 1500-3000 (Kirk et al. 1995). See Palmer (1988) for population estimates for various regions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Distance between nest sites was 3-38 km in northern Alaska; average of 10.4 km for inland sites in Greenland, minimum of 15 km for coastal sites in Greenland. Hunted up to 12-15 km from aerie in interior Alaska (see Palmer 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
162 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Gyrfalcons nest in the remote northern portions of the world. Until recently, little was known about nesting sites, incubation times, fledging dates, or reproductive behavior. Although much has been discovered recently, many other aspects of the reproductive cycle have yet to be determined.

Males begin defending nesting territory in mid-winter, about the end of January, while females generally arrive at nesting sites near the beginning of March. Pair bonding occurs for about 6 weeks and subsequently the eggs are usually laid near the end of April.

Gyrfalcons do not construct their own stick nests in trees (although old common raven (Corvus corax) stick nests in trees are sometimes used), and usually find suitable nesting sites on cliff faces where there is a shelf with an overhang. Nest sites are used year after year and accumulate prey remain piles, while the rocks turn white from excessive guano.

The clutch can be from 2-7 eggs, however,the average size is 4, which is typically incubated by the female with some assistance from the male. Incubation has recently been determined to be 35 days and all birds in the clutch hatch within a 24-36 hour period.

Due to cold climate, chicks are covered in heavy down and are left to thermoregulate themselves after only 10 days as the female leaves the nest to join the male in hunting duties for the growing family (Cade 1982).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pair-bonds form over 6-8 weeks before egg laying (April-early May or into June). Clutch size most commonly is 3-4. Incubation lasts about 5 weeks (but 44 days also reported), mainly by female, which broods young 10 days, then aids in food provision until fledging at 7-8 weeks (late June to mid-Aug. in Beaufort Sea area). Young are dependent for another month or more. First breeds probably at 2 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Falco rusticolus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTATACCTACTCTTCGGAGCATGAGCAGGCATAGTCGGCACTGCCCTTAGCCTCCTTATTCGAACAGAACTTGGCCAACCAGGGACTCTCCTAGGAGATGACCAAATCTACAATGTCATTGTCACCGCCCATGCCTTCGTAATAATCTTTTTCATAGTCATACCCATTATGATCGGAGGATTTGGAAACTGACTAGTCCCCCTTATAATTGGAGCCCCAGACATAGCATTCCCCCGCATAAACAACATGAGTTTCTGACTGCTCCCCCCATCCTTTCTACTACTCCTAGCATCTTCCACAGTAGAAGCGGGAGTTGGAACAGGATGAACCGTATACCCCCCCTTAGCAGGCAACCTAGCCCATGCCGGTGCTTCAGTAGACCTCGCCATTTTCTCCCTACACCTTGCAGGTGTATCTTCCATCTTAGGGGCAATCAACTTTATCACAACAGCCATTAACATAAAACCACCCGCCCTATCACAATATCAAACCCCACTATTCGTATGATCCGTACTTATCACCGCCGTACTCCTGCTTCTCTCACTTCCAGTTCTAGCTGCTGGCATCACCATACTACTAACCGACCGAAACCTAAACACTACATTCTTCGACCCCGCCGGAGGAGGAGACCCCATTCTCTATCAACACTTATTCTGATTCTTCGGCCACCCAGAAGTTTACATCCTAATCCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Falco rusticolus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

In Canada, the gyrfalcon is not recorded as endangered, threatened, or species of special concern. Population estimates are currently thought to be under 50 000 birds total, with many of these being sub-adults and not sexually mature. Also, population levels have stayed fairly constant with little flucuation over the long term. This is perhaps due to the fact that habitat loss is not a major concern due to low human interaction in the north, the fact that there is no hunting season on these birds, and pesticides levels have been lower in these non-migrators.

In the United States this species has been given no special status as it is only a vagrant visitor and does not breed in the mainland USA. This species does however, nest in Alaska where populations seem to be stable.

Poaching, mainly in the form of capturing and selling birds to falconers is still a major concern. Due to tight restrictions on exporting in Canada, this does not occur very often or at least is not detected very often. Also, due to its habitat and its remoteness, these birds are not regularly captured.

Raptor monitoring, through surveys and banding is becoming more prevalent, however, do to their remoteness, not all areas are covered in as great of detail. This is due to the fact that birds of prey are good indicators to overall ecosystem health. By monitoring these large birds, we can determine if the ecosystem is on a downward slide early and try to restore it.(Poole and Bromley 1985;)

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix i

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B,N4N : N4B: Apparently Secure - Breeding, N4N: Apparently Secure - Nonbreeding

United States

Rounded National Status Rank: N3B,N3N : N3B: Vulnerable - Breeding, N3N: Vulnerable - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large (Holarctic) range; populations apparently are stable in most areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.110,000 individuals (Rich et al. 2004), while the population in Russia has been estimated at c.10,000-100,000 breeding pairs (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Uncommon over most of its range with no evidence of a downward trend in numbers over most of its range in recent years. In Canada, populations are healthy and reproducing successfully, and still occupy original range (Bromley, 1987 COSEWIC report); stable in Northwest Territories and Yukon (see Kirk et al. 1995). Some decline and local extirpation has occurred within historical times in Scandinavia and adjacent Russia (Cade 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no reported negative impacts by the gyrfalcon on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Falconry is one of the oldest sports dating back some 4000 years, the majority practiced in the middle east. The white phase of the gyrfalcon, historically was hunted only by royality, and even today is still considered the "bird of kings". In North America, collecting wild raptors is illegal, but they are captured for trade in portions of their range in the Old World. McLean (1984) reports the demand to be high from the middle east, while Trefry (2000, personal communication) suggests few gyrfalcons are bred in captivity. Unfortunately, many are captured illegally and sold on the black market.

Another economic aspect of this bird is its rarity to birdwatchers, many of whom are willing to travel to watch, study and photograph this bird. These travellers must be transported, fed, and sheltered, all of which have economics spinoffs to the communities where these birds are found.

To a small extent, these birds are hunted for food and feathers used for clothing or ceremonial purposes by native Inuit. This number is small and they are not hunted exclusively, only opprotunistically and are spiritually significant to the native people of the north (Holt 1999, personal communication; McLean 1984; Trefry 2000, personal communication)

  • McLean, B. 1984. Gyrfalcon nesting survey in a southern Baffin Island, May-June 1984. Report prepared for the Baffin Regional Inuit Association and the Baffin Regional Council.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gyrfalcon

For other uses, see Gyrfalcon (disambiguation).

The gyrfalcon (/ˈɜrfɔːlkən/ or /ˈɜrfælkən/), also spelled gerfalconFalco rusticolus—is the largest of the falcon species. The gyrfalcon breeds on Arctic coasts and the islands of North America, Europe, and Asia. It is mainly a resident there also, but some gyrfalcons disperse more widely after the breeding season, or in winter. Individual vagrancy can take birds for long distances. The gyrfalcon is dispersed throughout much of the Northern Hemisphere, with populations in Northern America, Greenland, and Northern Europe. Its plumage varies with location, with birds being coloured from all-white to dark brown. For centuries, gyrfalcon has been a precious hunting bird, highly valued among the Vikings. It is the national symbol of Iceland.

The bird's common name comes from French gerfaucon; in medieval Latin it is gyrofalco. The first part of the word may come from Old High German gîr (cf. modern German Geier) for "vulture", referring to its size compared to other falcons; or from the Latin gȳrus for "circle" or "curved path"—from the species' circling as it searches for prey, distinct from the hunting of other falcons in its range.[nb 1] The male gyrfalcon is called a gyrkin in falconry. The scientific name is composed of the Latin term for a falcon, Falco, and for a countryside-dweller, rusticolus.

Description[edit]

The gyrfalcon is a very large falcon, being about the same size as the largest buteos (buzzard hawks). Males are 48 to 61 cm (19 to 24 in) long, weigh 805 to 1350 g (1.8 to 3 lbs) and have a wingspan from 110 to 130 cm (43 to 51 in). Females are bulkier and larger, at 51 to 65 cm (20 to 26 in) long, 124 to 160 cm (49 to 64 in) wingspan, and of 1180 to 2100 g (2.6 to 4.6 lbs) weight. Among standard measurements, the wing chord is 34.5 to 41 cm (13.6 to 16.1 in), the tail is 19.5 to 29 cm (7.7 to 11.4 in), the culmen is 2 to 2.8 cm (0.79 to 1.10 in) and the tarsus is 4.9 to 7.5 cm (1.9 to 3.0 in).[2] The gyrfalcon is larger than the peregrine falcon (which it is known to hunt) and differs from the buzzard in general structure, being unmistakably a falcon with pointed wings, and broader-winged and longer-tailed than the Peregrine.

The gyrfalcon is a very polymorphic species, so its plumage varies greatly. The archetypal morphs are called "white", "silver", "brown", and "black", though they can be coloured on a spectrum that begins with all-white and ends with very dark. The brown form of the gyrfalcon is distinguished from the Peregrine by the cream streaking on the nape and crown and by the absence of a well-defined malar stripe and cap. The black morph has its underside strongly spotted black, rather than finely barred as in the Peregrine. White form gyrfalcons are unmistakable, as they are the only predominantly white falcons. Silver gyrfalcons resemble a light grey lanner falcon of larger size. There is no difference in colouring between males and females; and juveniles are darker and browner than the corresponding adults.

The black color seems to be sex-linked and to occur mostly in females; it proved difficult for breeders to get males darker than the dark side of slate grey. A color variety that arose in captive breeding is "black chick".[3]

Systematics and evolution[edit]

A hybrid White gyrfalcon × saker hybrid

The gyrfalcon is a member of the hierofalcon complex. In this group, there is ample evidence for hybridisation and incomplete lineage sorting which confounds analyses of DNA sequence data to a massive extent. The radiation of the entire living diversity of hierofalcons took place in approximately the Eemian Stage at the start of the Late Pleistocene. It represents lineages that expanded into the Holarctic and adapted to local conditions; this is in contrast to less northerly populations of northeastern Africa (where the radiation probably originated) which evolved into the saker falcon. Gyrfalcons hybridize not infrequently with sakers in the Altai Mountains and this gene flow seems to be the origin of the Altai falcon.[4][5][6][7]

There is some correlation between locality and colour morph. Greenland gyrfalcons are lightest, with white plumage flecked with grey on the back and wings being most common. Other subpopulations have varying amounts of the darker morphs: the Icelandic birds tend towards pale, whereas the Eurasian populations are considerably darker and typically incorporate no white birds. Natural separation into regional subspecies is prevented by gyrfalcons' habit of flying long distances whilst exchanging alleles between subpopulations; thus, the allele distributions for the color polymorphism form clines and in darker birds[nb 2] of unknown origin, theoretically any allele combination might be present. For instance, a mating of a pair of captive gyrfalcons is documented to have produced a clutch of 4 young: one white, one silver, one brown, and one black. Molecular work suggests that plumage color is associated with the melanocortin 1 receptor gene (MC1R), where a nonsynonymous point substitution was perfectly associated with the white/melanic polymorphism.[8]

Adult F. r. islandus at Dimmuborgir near Lake Myvatn (Iceland)

In general, geographic variation follows Bergmann's Rule for size and the demands of crypsis for plumage coloration. Several subspecies have been named according to perceived differences between populations[nb 3][9][10] but none of these are consistent and thus no living subspecies are accepted today. Perhaps the Icelandic population described as Falco rusticolus islandus is the most distinct. The predominantly white Arctic forms are parapatric and seamlessly grade into the subarctic populations, whereas the birds of Iceland have presumably less gene flow with their neighbors and indeed show less variation in plumage colors and often look quite similar to a large, washed-out peregrine falcon (although their habitus is different). Comprehensive phylogeographic studies to determine the proper status of the Icelandic population have yet to be determined.[9][11]

A population genetic study,[10] however, identified the Iceland population as genetically unique relative to other sampled populations in both eastern and western Greenland, Canada, Alaska and Norway. Further, within Greenland, differing levels of gene flow between western and eastern sampling locations was identified with apparent asymmetric dispersal in western Greenland from north to south. This dispersal bias is in agreement with the distribution of plumage colour variants with white gyrfalcons in much higher proportion in north Greenland.[10] Although further work is required to determine the ecological factors contributing to these distributions relative to plumage differences, a study using demographic data suggested that plumage color distribution in Greenland may be influenced by nesting chronology with white individuals and pairs laying eggs earlier in the breeding season and producing more offspring.[12]

A paleosubspecies, Falco rusticolus swarthi, existed during the Late Pleistocene (125,000 to 13,000 years ago). Fossils found in Little Box Elder Cave (Converse County, Wyoming), Dark Canyon Cave (Eddy County, New Mexico), and McKittrick, California were initially described as Falco swarthi ("Swarth falcon" or more properly "Swarth's gyrfalcon") on account of their distinct size. They have meanwhile proven to be largely inseparable from those of living gyrfalcons, except for being somewhat larger.[13][14][15][16]

Swarth's gyrfalcon was on the upper end of the present gyrfalcon's size range, strong females even surpassing it.[14] It seems to have had some adaptations to the temperate semiarid climate that predominated in its range during the last ice age. Ecologically more similar to the Siberian populations of today (which are generally composed of smaller birds) or to the prairie falcon, this population of temperate steppe habitat must have preyed on landbirds and mammals rather than the water—and on the seabirds which make up much of the American gyrfalcon's diet today.

Ecology[edit]

The gyrfalcon was originally thought to be a bird of tundra and mountains only; however, in June 2011 it was revealed that it spends considerable periods during the winter on sea ice far from land.[17] It feeds only on birds and mammals, the latter of which it takes more regularly than many other Falco species. Like other hierofalcons, it usually hunts in a horizontal pursuit, rather than with the peregrine's speedy stoop from a height. Most prey is killed on the ground, whether they are captured there or, if the victim is a flying bird, forced to the ground. The diet is to some extent opportunistic, but a majority of breeding birds mostly rely on Lagopus grouse and avian marine species on coastal habitats. Avian prey can range in size from redpolls to geese and can include gulls, corvids, smaller passerines, waders, and other raptors (up to the size of Buteos). Mammalian prey can range in size from shrews to marmots (sometimes thrice the weight of the assaulting falcon), and often includes lemmings, voles, ground squirrels, and hares. They are rarely observed eating carrion.

Breeding[edit]

The gyrfalcon almost invariably nests on cliff faces. Breeding pairs do not build their own nests, and often use a bare cliff ledge or the abandoned nest of other birds, particularly golden eagles and common ravens. The clutch can range from 1 to 5 eggs, but is usually 2 to 4. The average size of an egg is 58.46×45 mm (2.31×1.8 in); the average weight is 62 g (2.2 oz). The incubation period averages 35 days, with the chicks hatching at a weight of around 52 g (1.8 oz). The nestlings are brooded usually for 10 to 15 days and leave the nest at 7 to 8 weeks. At 3 to 4 months of age, the immature gyrfalcons become independent of their parents, though they may associate with their siblings through the following winter.

The only natural predator of gyrfalcons are golden eagles and even they rarely engage with these formidable falcons. Gyrfalcons have been recorded as aggressively harassing animals that come near their nests, although common ravens are the only predators known to successfully pick off Gyrfalcon eggs and hatchlings. Even brown bears have been reportedly dive-bombed. Humans, whether accidentally (automobile collisions or poisoning of carrion to kill mammalian scavengers) or intentionally (through hunting), are the leading cause of death for gyrfalcons. Gyrfalcons that survive into adulthood can live up to 20 years of age.

As F. rusticolus has such a wide range, it is not considered a threatened species by the IUCN.[1] It is not much affected by habitat destruction, but pollution, for instance by pesticides, depressed its numbers in the mid-20th century, and until 1994 it was considered "Near Threatened". Improving environmental standards in developed countries have allowed the birds to make a comeback, and today they are not considered rare or endangered.[1]

Interaction with humans[edit]

Tame gerfalcon striking grey heron (1920), Louis Agassiz Fuertes.

The gyrfalcon has long associated with humans, who have found them useful primarily for hunting and the art of falconry. It is today the official bird of Canada's Northwest Territories. The white falcon in the crest of the Icelandic Republic's coat of arms is a variety of Gyrfalcon.

In the medieval era, the gyrfalcon was considered a royal bird. The geographer and historian Ibn Said al-Maghribi (d. 1286) described certain northern Atlantic islands west of Ireland where these falcons would be brought from, and how the Egyptian Sultan paid 1,000 dinars for each gyrfalcon (or, if it arrived dead, 500 dinars).[18] Due to its rarity and the difficulties involved in obtaining it, in European falconry the gyrfalcon was reserved for kings and nobles; very rarely was a man of lesser rank seen with a gyrfalcon on his fist.[19]

In the 12th century AD China, swan-hunting with gyrfalcons (海东青 hǎidōngqīng in Chinese) obtained from the Jurchen tribes became fashionable among the Khitan nobility. When demand for gyrfalcons exceeded supply, the Liao Emperor imposed a tax payment-in-kind of gyrfalcons on the Jurchen; under the last Liao emperor, tax collectors were entitled to use force to procure sufficient gyrfalcons. This was one cause of the Jurchen rebellion, whose leader Wányán Āgǔdǎ annihilated the Liao empire in 1125, and established the Jīn Dynasty in its stead.[20]

Most historians agree that Coat of Arms of Ukraine, the medieval symbol, was not intended as depicting a trident, but most likely a stylized falcon. Depictions of a flying falcon with a cross above its head have been found in Old Ladoga, the first seat of Kievan Rurik dynasty,[21] of Scandinavian lineage.[22] Such a falcon, along with a cross are also featured on the coins of Olaf Guthfrithsson, Viking konung.[21] Falconry for centuries has been a royal sport in Europe. The gyrfalcon (known also as the Norwegian falcon) was considered a royal bird and is mentioned (ukr.: кречет) in one of the earliest epics of Ruthenia, the 12th century poem The Tale of Igor's Campaign.

Gyrfalcons are today expensive to buy, and thus owners and breeders may keep them secret to avoid theft. They can and often do fly long distances, and falconers may fit a radio-tracker to aid recovery.[citation needed] Wild gyrfalcons are not much exposed to disease, and as a result have immune systems that are naive to many avian pathogens found around human environments. As a result, many gyrfalcons taken from the wild quickly die of disease.[23]

Falcons are known to be very susceptible to avian influenza. Therefore an experiment was done with hybrid gyr-saker falcons, which found that 5 falcons vaccinated with a commercial H5N2 influenza vaccine survived infection with a highly pathogenic H5N1 strain, whereas 5 unvaccinated falcons died. Since both wild and captive gyrfalcons are valuable (for wildlife conservation and falconry, respectively), this means they can be protected from bird flu by vaccination.[24]

Notes[edit]

  1. ^ In Scandinavian languages, it is generally named after its use in falconry, whereas the modern Dutch name giervalk is peculiarly ambiguous: Gier means "vulture", whereas gieren means changing the yaw angle to circle in the air.
  2. ^ The allele combination producing the white morph seems to be recessive.
  3. ^ Falco rusticolus candicans from northern Greenland and adjacent North America which is often very white; F. r. obsoletus from the southern Greenland into subarctic North America which is much darker, often brown or black; and F. r. islandus (Iceland), F. r. rusticolus (Scandinavia including the species' type locality, Sweden), as well as F. r. intermedius and F. r. grebnitzkii (Siberia), which all tend towards more or less dark "silver" coloration.

References[edit]

  1. ^ a b c BirdLife International (2012). "Falco rusticolus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Gyrfalcon — Birds of North America Online. Bna.birds.cornell.edu (2008-10-27). Retrieved on 2013-03-09.
  3. ^ Black Gyrs. Falconscanada.com. Retrieved on 2011-12-18.
  4. ^ Helbig, A.J.; Seibold, I.; Bednarek, W.; Brüning, H.; Gaucher, P.; Ristow, D.; Scharlau, W.; Schmidl, D. & Wink, Michael (1994) Phylogenetic relationships among falcon species (genus Falco) according to DNA sequence variation of the cytochrome b gene. In: Meyburg, B.-U. & Chancellor, R.D. (eds.): Raptor conservation today: 593–599
  5. ^ Wink, Michael; Seibold, I.; Lotfikhah, F. & Bednarek, W. (1998) Molecular systematics of holarctic raptors (Order Falconiformes). In: Chancellor, R.D., Meyburg, B.-U. & Ferrero, J.J. (eds.): Holarctic Birds of Prey: 29–48. Adenex & WWGBP.
  6. ^ Wink, Michael; Sauer-Gürth, Hedi; Ellis, David & Kenward, Robert (2004) Phylogenetic relationships in the Hierofalco complex (Saker-, Gyr-, Lanner-, Laggar Falcon). In: Chancellor, R.D. & Meyburg, B.-U. (eds.): Raptors Worldwide: 499–504. WWGBP, Berlin.
  7. ^ Nittinger, F.; Haring, E.; Pinsker, W.; Wink, Michael & Gamauf, A. (2005). "Out of Africa? Phylogenetic relationships between Falco biarmicus and other hierofalcons (Aves Falconidae)". Journal of Zoological Systematics and Evolutionary Research 43 (4): 321–331. doi:10.1111/j.1439-0469.2005.00326.x. 
  8. ^ Johnson, Jeff A.; Ambers, Angie D.; Burnham, Kurt K. (2012). "Genetics of plumage color in the Gyrfalcon (Falco rusticolus): analysis of the melanocortin-1 receptor gene". Journal of Heredity 103 (3): 315–321. doi:10.1093/jhered/ess023. PMID 22504110. 
  9. ^ a b Snow, David W.; Perrins, Christopher M.; Doherty, Paul & Cramp, Stanley (1998): The complete birds of the western Palaearctic on CD-ROM. Oxford University Press. ISBN 0-19-268579-1
  10. ^ a b c Johnson, Jeff A.; Burnham, Kurt K.; Burnham, William A.; Mindell, David P. (2007). "Genetic structure among continental and island populations of Gyrfalcons". Molecular Ecology 16 (15): 3145–3160. doi:10.1111/j.1365-294X.2007.03373.x. PMID 17651193. 
  11. ^ White, Clayton M. (1994): 58. Gyrfalcon. In: del Hoyo, Josep; Elliott, Andrew & Sargatal, Jordi (editors): Handbook of the Birds of the World, Volume 2 (New World Vultures to Guineafowl): 274, plate 28. Lynx Edicions, Barcelona. ISBN 84-87334-15-6
  12. ^ Johnson, Jeff A.; Burnham, Kurt K. (2013). "Timing of breeding and offspring number covary with plumage colour among Gyrfalcons Falco rusticolus". Ibis 155 (1): 177–188. doi:10.1111/j.1474-919X.2012.01276.x. 
  13. ^ Miller, Loye H. (1927). "The Falcons of the McKittrick Pleistocene". Condor 29 (3): 150–152. doi:10.2307/1363081. 
  14. ^ a b Miller, Loye H. (1935). "A Second Avifauna from the McKittrick Pleistocene". Condor 37 (2): 72–79. doi:10.2307/1363879. 
  15. ^ Howard, Hildegarde (1971). "Quaternary Avian Remains from Dark Canyon Cave, New Mexico". Condor 73 (2): 237–240. doi:10.2307/1365844. 
  16. ^ Emslie, Steven D. (1985). "The late Pleistocene (Rancholabrean) avifauna of Little Box Elder Cave, Wyoming". Rocky Mountain Geology 23 (2): 63–82. 
  17. ^ Burnham, Kurt K.; Newton, Ian (2011). "Seasonal movements of Gyrfalcons Falco rusticolus include extensive periods at sea". Ibis 153 (3): 468. doi:10.1111/j.1474-919X.2011.01141.x. 
  18. ^ Ibn Said al-Maghribi: Geographia (Arabic). Sh.rewayat2.com. Retrieved on 2011-12-18.
  19. ^ Berners, Juliana (1486) The Boke of St. Albans. St. Albans Press, London.
  20. ^ Beijing Municipal Administration of Cultural Heritage (2006) Contest for the Southern Capital between the Liao, Song and Jin Dynasties. Version of 2006-07-19. Retrieved 2007-08-13.
  21. ^ a b Coat of arms of Rurik found in Ladoga. (Russian)
  22. ^ Rurik (Norse leader) Britannica Online Encyclopedia
  23. ^ Gyr Genetics. Falconscanada.com. Retrieved on 2011-12-18.
  24. ^ Lierz, Michael; Hafez M. Hafez, Robert Klopfleisch, Dörte Lüschow, Christine Prusas, Jens P. Teifke, Miriam Rudolf, Christian Grund, Donata Kalthoff, Thomas Mettenleiter, Martin Beer, and Timm Harder (November 2007). "Protection and Virus Shedding of Falcons Vaccinated against Highly Pathogenic Avian Influenza A Virus (H5N1)". Emerging Infectious Diseases (Centers for Disease Control) 13 (11): 1667–74. doi:10.3201/eid1311.070705. PMC 3375792. PMID 18217549. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Gyrfalcon

The gyrfalcon (pronounced /ˈdʒɜrfɔːlkən/ or /ˈdʒɜrfælkən/) or Falco rusticolus, also spelled gerfalcon, is the largest of all falcon species. The Gyrfalcon breeds on Arctic coasts and islands of North America, Europe and Asia. It is mainly resident, but some Gyrfalcons disperse more widely after the breeding season, or in winter[1].

The bird's common name comes from French gerfaucon, and in medieval Latin is rendered as gyrofalco. The first part of the word may come from Old High German gîr (cf. modern German Geier), "vulture", referring to its size compared to other falcons, or the Latin gȳrus ("circle", "curved path") from the species' circling as it searches for prey, unlike the other falcons in its range[2]. The male gyrfalcon is called a gyrkin in falconry.

Its scientific name is composed of the Latin terms for a falcon, Falco, and for someone who lives in the countryside, rusticolus.

Contents

Description

This species is a very large falcon, about the same size as the largest buteos. Males are 48 to 61 cm (19 to 24 in) long, weigh 805 to 1350 g (1.8 to 3 lbs) and have a wingspan from 110 to 130 cm (43 to 51 in). Females are rather bulkier and larger at 51 to 65 cm (20 to 26 in) long, a weight of 1180 to 2100 g (2.6 to 4.6 lbs) and have a wingspan ranging from 124 to 160 cm (49 to 64 in). In dimensions, gyrfalcons lie between a large Peregrine Falcon and a hawk in general structure; they are unmistakably falcons with pointed wings, but are stockier, broader-winged, and longer-tailed than the Peregrine.

Plumage is very variable in this highly polymorphic species: the archetypal morphs are called "white", "silver", "brown" and "black" though coloration spans a continuous spectrum from nearly all-white birds to very dark ones. The brown form of the Gyrfalcon is distinguished from the Peregrine by the cream streaking on the nape and crown and by the absence of a well-defined malar stripe and cap. The black morph has its underside strongly spotted black, not finely barred as in the Peregrine. White form Gyrfalcons are unmistakable, as they are the only predominantly white falcons. Silver birds resemble a light, grey Lanner Falcon of huge size.

There is no difference in colouring between males and females; juveniles are darker and browner than corresponding adults on average.

Systematics and evolution

A hybrid white gyrfalcon × saker falcon.

The Gyrfalcon is a member of the close-knit hierofalcon complex. In this group, there is ample evidence for rampant hybridization and incomplete lineage sorting which confounds analyses of DNA sequence data to a massive extent; molecular studies with small sample sizes can simply not be expected to yield reliable conclusions in the entire hierofalcon group. The radiation of the entire living diversity of hierofalcons seems to have taken place in the Eemian Stage at the start of the Late Pleistocene, a mere 130,000-115,000 years ago; the Gyrfalcon seems to represents lineages that expanded into the Holarctic and adapted to local conditions, whereas the inland populations further south, towards northeastern Africa where the radiation probably originated, evolved into the Saker Falcon. Indeed, gyrfalcons hybridize not infrequently with Sakers in the Altai Mountains and this gene flow seems to be the origin of the Altai Falcon.[3]

Subspecies

There is some correlation between locality and the frequency of color morphs. Greenland Gyrfalcons are lightest, with white plumage flecked with grey on the back and wings being most common. Other subpopulations have varying amounts of the darker morphs: the Icelandic birds tend towards pale, and Eurasian ones are considerably darker and not usually have white birds present. Natural separation into regional subspecies is prevented by Gyrfalcons' habit of flying long distances exchanging alleles between subpopulations; thus, the allele distributions for the color polymorphism form clines and in darker birds[4] of unknown origin, theoretically any allele combination might be present. For example, a mating of a pair of captive Gyrfalcons is documented to have produced a clutch of 4 young: one white, one silver, one brown, one black.

In general, geographic variation follows Bergmann's Rule for size and the demands of crypsis for plumage coloration. Several subspecies have been named according to perceived differences between populations[5] but none of these are consistent and thus no living subspecies are accepted today.

Adult F. r. islandus at Dimmuborgir near Lake Myvatn (Iceland)

Perhaps the Icelandic population described as Falco rusticolus islandus is the most distinct. The predominantly white Arctic forms are parapatric and seamlessly grade into the subarctic populations, whereas the birds of Iceland have presumably less gene flow with their neighbors and indeed show less variation in plumage colors and often look quite similar to a large, washed-out Peregrine Falcon (though their habitus is different). Comprehensive phylogeographic studies are needed to determine the proper status of the Icelandic population.[6]

A recent molecular study [7] , however, identified the Iceland population as unique and genetically differentiated relative to other sampled populations in both eastern and western Greenland, Canada, Alaska and Norway. Further, within Greenland, differing levels of gene flow between western and eastern sampling locations was identified with apparent asymmetric dispersal in western Greenland from north to south. This dispersal bias is in agreement with the distribution of plumage colour variants with white gyrfalcons in much higher proportion in northern Greenland.[7] Further work is required to determine the ecological factors contributing to these distributions relative to plumage differences, and whether renewed subspecies designations are warranted.

There was, however, a paleosubspecies Falco rusticolus swarthi during the Late Pleistocene (125,000 - 13,000 years ago). Fossils found in Little Box Elder Cave (Converse County, Wyoming), Dark Canyon Cave (Eddy County, New Mexico) and McKittrick, California were initially described as Falco swarthi ("Swarth Falcon" or more properly Swarth's Gyrfalcon) on account of their distinct size. They have meanwhile proven to be largely inseparable from those of living gyrfalcons, except for being somewhat larger.[8]

Swarth's Gyrfalcon was on the upper end of the present Gyrfalcon's size range, strong females even surpassing it (Miller 1935). It seems to have had some adaptations to the temperate semiarid climate that predominated in its range during the last ice age. Ecologically more similar to the Siberian populations of today (which are generally small birds however) or the Prairie Falcon, this population of temperate steppe habitat must have preyed on landbirds and mammals rather than the water- and seabirds which make up much of American gyrfalcon's diet today.

Ecology

The Gyrfalcon is a bird of tundra and mountains, with cliffs or a few patches of trees. It feeds only on birds and mammals. Like other hierofalcons, it usually hunts in a horizontal pursuit, rather than the Peregrine's speedy stoop from a height. Most prey is killed on the ground, whether they are captured there or, if the victim is a flying bird, forced to the ground. The diet is to some extent opportunistic, but a majority of breeding birds mostly rely on Lagopus grouse and avian marine species (Dovekies, Thick-billed Murres) on coastal habitats. Avian prey can range in size from redpolls to geese and can include gulls, corvids, smaller passerines, waders and other raptors (up to the size of Buteos). Mammalian prey can range in size from shrews to marmots (sometimes 3 times heavier than the assaulting falcon), and often includes include lemmings, voles, ground squirrels and hares. They only rarely eat carrion.

Reproduction and life history

A Gyrfalcon chick hatched in captivity

The Gyrfalcon almost invariably nests on cliff faces. Breeding pairs do not build their own nests, and often use a bare cliff ledge or the abandoned nest of other birds, particularly Golden Eagles and Common Ravens. The clutch can range from 1 to 5 eggs, but is usually 2 to 4. The average size of an egg is 58.46 x 45 mm (2.31 x 1.8 in) and the average weight is 62 g (2.2 oz). The incubation period averages 35 days, until the 52 g (1.8 oz) chicks hatch. The nestlings are brooded usually for 10 to 15 days and leave the nest at 7 to 8 weeks. At 3 to 4 months of age, the immatures become independent of their parents, though they may associate with their siblings through the following winter.

The only natural predator of gyrfalcons are Golden Eagles and even they rarely engage with these formidable falcons. Gyrfalcons have been recorded as aggressively harassing animals that come near their nests, although Common Ravens are the only predators known to successful pick off Gyrfalcon eggs and hatchlings. Even Brown Bears may be dive-bombed, much to their annoyance. Humans, whether accidentally (automobile collisions or poisoning of carrion to kill mammalian scavengers) or intentionally (through hunting), are the leading cause of death for Gyrfalcons. Gyrfalcons that make it to adulthood can live up to 20 years of age.

As F. rusticolus has such a wide range, it is not considered a threatened species by the IUCN. It is not much affected by habitat destruction, but pollution e.g. by pesticides had depressed its numbers in the mid-20th century, and until 1994 it was considered Near Threatened. Improved environmental standards have allowed the birds to make a comeback, and today they are not rare in most of their range.[9]

Relationship with humans

The Gyrfalcon is the official bird of Canada's Northwest Territories. The White falcon in the crest of the Icelandic Republic's coat of arms is a variety of this species.

According to Persian historian Rashid-al-Din Hamadani's list, gyrfalcon is the symbol of Kayı tribe; one of the 24 tribes belonging to Oghuz Turkic people.[citation needed]

In medieval times, the Gyrfalcon was considered the king's bird. It was highly prized as far away as the Egyptian Sultan's court. The geographer and historian [Ibn Said al-Maghribi] (d. 1286) describes certain northern Atlantic islands west of Ireland where these falcons would be brought from, and how the Egyptian Sultan paid 1,000 dinars for each gyrfalcon, and if it arrived dead, he would pay 500 dinars[10]. Due to its rarity and the difficulties involved in obtaining it, in European falconry the gyrfalcon was generally reserved for kings and nobles. Very seldom was a man of lesser rank seen with a Gyrfalcon on his fist.[11]

Gyrfalcons are very expensive to buy, and thus owners and breeders may keep them secret to avoid theft. They tend to fly long distances, and falconers may fit a radio-tracker to aid recovery.[citation needed]

Wild Gyrfalcons are not much exposed to disease, and as a result have weak immune systems. As a result, many gyrfalcons taken from the wild quickly die of disease. Several generations of captive breeding from the survivors causes selection for a stronger immune system and thus better resistance to disease.[citation needed]

Gyrfalcons and the fall of the Liao Dynasty

In the 12th century AD the Jurchen tribes rebelled against the Chinese Liao Dynasty which was ruled by the Khitan. The primary cause was that the Khitan nobles, among whom swan hunting had become highly fashionable, extorted a big tax of Gyrfalcons (海东青 hǎidōngqīng in Chinese). Especially under the last Liao Emperor Yēlǜ Yánxĭ (耶律延禧), tax collectors were even entitled to use force to procure the demanded quantity of gyrfalcons. The rebellion caught on, and the Jurchen under chieftain Wányán Āgǔdǎ (完颜阿骨打) annihilated the Liao empire in 1125, establishing the Jīn Dynasty in its stead.[12]

Footnotes

  1. ^ Individual vagrancy can take birds for long distances. There is a story in the Unauthorized Biography of the Spring and Autumn[verification needed] of a hǎidōngqīng (海东青: Gyrfalcon) that succumbed to an arrow wound in the garden of Chen Hui Gong[verification needed]. Confucius recognized the arrow as one of the Sushen, whose fine stone arrowheads were a famous item of trade and tribute (RAM 2006). Although the Sushen's precise homeland at that time remains unknown, it was in the Manchuria region, no less than c.600 and perhaps more than 1000 km from the Lu capital of Qufu.
  2. ^ The Gyrfalcon's names in other Germanic languages provide few clues to resolve this. In Scandinavian languages, it is generally named after its use in falconry, whereas the modern Dutch name giervalk is peculiarly ambiguous: Gier means "vulture", whereas gieren means changing the yaw angle to circle in the air.
  3. ^ Helbig et al. (1994), Wink et al. (1998), Wink et al. (2004), Nittinger et al. (2005)
  4. ^ The allele combination producing the white morph seems to be recessive.
  5. ^ Falco rusticolus candicans fron northern Greenland and adjacent North America which is often very white; F. r. obsoletus from the southern Greenland into subarctic North America which is much darker, often brown or black; and F. r. islandus (Iceland), F. r. rusticolus (Scandinavia including the species' type locality, Sweden), as well as F. r. intermedius and F. r. grebnitzkii (Siberia), which all tend towards more or less dark "silver" coloration (Snow et al. 1998, Johnson et al. 2007).
  6. ^ White (1994), Snow et al. (1998)
  7. ^ a b Johnson et al. (2007)
  8. ^ Miller (1927, 1935), Howard (1971), Emslie (1985)
  9. ^ BLI (2008)
  10. ^ Ibn Said al-Maghribi: Geographia (Arabic)
  11. ^ Berners (1486)
  12. ^ BMACH (2006)

References

  • Beijing Municipal Administration of Cultural Heritage (BMACH) (2006): Contest for the Southern Capital between the Liao, Song and Jin Dynasties. Version of 2006-JUL-19. Retrieved 2007-AUG-13.
  • Berners, Juliana (1486): The Boke of St. Albans. St. Albans Press, London.
  • BirdLife International (BLI) (2008). Falco rusticolus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 May 2009.
  • Emslie, Steven D. (1985): The late Pleistocene (Rancholabrean) avifauna of Little Box Elder Cave, Wyoming. Rocky Mountain Geology 23(2): 63-82. HTML abstract
  • Helbig, A.J.; Seibold, I.; Bednarek, W.; Brüning, H.; Gaucher, P.; Ristow, D.; Scharlau, W.; Schmidl, D. & Wink, Michael (1994): Phylogenetic relationships among falcon species (genus Falco) according to DNA sequence variation of the cytochrome b gene. In: Meyburg, B.-U. & Chancellor, R.D. (eds.): Raptor conservation today: 593-599. PDF fulltext
  • Howard, Hildegarde (1971): Quaternary Avian Remains from Dark Canyon Cave, New Mexico. Condor 73(2): 237-240. doi:10.2307/1365844 PDF fulltext
  • Johnson, Jeff A.; Burnham, Kurt K.; Burnham, William A.; Mindell, David P. (2007): Genetic structure among continental and island populations of gyrfalcons. Molecular Ecology 16: 3145-3160. doi:10.1111/j.1365-294X.2007.03373.xPDF fulltext
  • Miller, Loye H. (1927): The Falcons of the McKittrick Pleistocene. Condor 29(3): 150-152. doi:10.2307/1363081 PDF fulltext
  • Miller, Loye H. (1935): A Second Avifauna from the McKittrick Pleistocene. Condor 37(2): 72-79. doi:10.2307/1363879 PDF fulltext
  • Nittinger, F.; Haring, E.; Pinsker, W.; Wink, Michael & Gamauf, A. (2005): Out of Africa? Phylogenetic relationships between Falco biarmicus and other hierofalcons (Aves Falconidae). Journal of Zoological Systematics and Evolutionary Research 43(4): 321-331. doi:10.1111/j.1439-0469.2005.00326.x PDF fulltext
  • Royal Alberta Museum (RAM) (2006): Dragon Bytes: Did you know about time's arrows?. Version of October 12, 2006. Retrieved 2007-AUG-13.+
  • Snow, David W.; Perrins, Christopher M.; Doherty, Paul & Cramp, Stanley (1998): The complete birds of the western Palaearctic on CD-ROM. Oxford University Press. ISBN 0192685791
  • White, Clayton M. (1994): 58. Gyrfalcon. In: del Hoyo, Josep; Elliott, Andrew & Sargatal, Jordi (editors): Handbook of Birds of the World, Volume 2 (New World Vultures to Guineafowl): 274, plate 28. Lynx Edicions, Barcelona. ISBN 84-87334-15-6
  • Wink, Michael; Seibold, I.; Lotfikhah, F. & Bednarek, W. (1998): Molecular systematics of holarctic raptors (Order Falconiformes). In: Chancellor, R.D., Meyburg, B.-U. & Ferrero, J.J. (eds.): Holarctic Birds of Prey: 29-48. Adenex & WWGBP. PDF fulltext
  • Wink, Michael; Sauer-Gürth, Hedi; Ellis, David & Kenward, Robert (2004): Phylogenetic relationships in the Hierofalco complex (Saker-, Gyr-, Lanner-, Laggar Falcon). In: Chancellor, R.D. & Meyburg, B.-U. (eds.): Raptors Worldwide: 499-504. WWGBP, Berlin. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: FALCO GYRFALCO is a synonym (Banks and Browning 1995). See Olsen et al. (1989) for a study of relationships within the genus FALCO based on electrophoretic patterns of feather proteins.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!