Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Brief Summary

The Osprey (Pandion haliaetus) is a fish-eating hawk found along coastlines and around marshes, lakes, and rivers almost worldwide. Ospreys are often seen flying over water searching for prey, then hovering and plunging feet first to capture a fish in their talons (fish are normally carried head first and belly down). Bald Eagles may sometimes chase them and force them to drop their catch. During migration, Ospreys may be seen far from water, even over deserts. Migrants travel singly, not in flocks.

The Osprey's diet consists almost entirely of fish, generally in the range of 10 to 30 cm in length. Rarely, small mammals, birds, or reptiles may be eaten.

Ospreys breed in the New World over most of North America south to Guatemala; in the Old World, they breed from the British Isles, Scandinavia, northern Russia, and northern Siberia south (at least locally) through much of Eurasia and most of Africa and Australia to South Africa, the Himalayas, Tasmania, New Caledonia, and the Solomon Islands. They winter from the southern United States south through Middle America, the West Indies, and South America (including the Galapagos Islands) to southern Chile, northern Argentina, and Uruguay; in the Old World, Ospreys winter from the Mediterranean, Black, and Caspian Seas, India, and eastern China south through the remainder of the breeding range.

The Osprey's courtship display includes the pair circling high together; the male may fly high and then dive repeatedly in the vicinity of the nest site, often carrying a fish or stick. The nest is usually constructed at the top of a large tree (often with a dead or broken top) not far from water. Utility poles or other structures, including nesting platforms erected by humans expressly for Ospreys, may also be used. They may nest on the ground on small islands and on cliffs or giant cacti in western Mexico. The nest site is typically very open to the sky. The bulky nest, built by both sexes, is made of sticks and lined with smaller materials. Nests may be reused for many years, with material added each year. Typical clutch size is 3 (range 2 to 4). The eggs, which are creamy white with brown blotches, are incubated by both parents (but mainly the female) for around 38 days. When the young first hatch, the female remains with them most of the time, sheltering them from sun and rain, and the male brings fish back to the nest, which the female feeds the young. Age at first flight is around 51 to 54 days.

In the mid-20th century, Osprey populations in the United States and elsewhere plummeted as a result of accumulations of the pesticide DDT in the food chain, which prevented the formation of normal eggshells (DDT can interfere with normal calcium absorption, resulting in thin eggshells). With the reduction in use of DDT and other conservation efforts, populations of Ospreys and some other affected species have rebounded.

(Kaufman 1996; AOU 1998; Dunn and Alderfer 2011)

  • American Ornithologists' Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists' Union, Washington, D.C.
  • Dunn, J.L. and J. Alderfer. 2011. National Geographic Field Guide to the Birds of North America. National Geographic Society, Washington, D.C.
  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 55-58 cm, envergure 145-170 cm, poids 1,1-2 kg.

L’espèce est entièrement dépendante d’une provision suffisante de poissons de taille moyenne qu’elle pêche près de la surface d’eaux claires. Elle est assez adaptable pour ses sites de reproduction, les oiseaux continentaux et nordiques s’installant sur des arbres tandis que les méditerranéens préfèrent les flancs de falaise.

Le Balbuzard se nourrit de poissons qu’il capture lors d’une plongée peu profonde (moins de 1 mètre), les serres étant projetées en avant au dernier moment. L’angle d’attaque est d’habitude entre 45° et la verticale, mais peut être pratiquement horizontal. Dans ce cas, l’oiseau se pose à la surface lors de la capture, ou bien il prend le poisson en continuant son vol au ras de l’eau. De nombreuses adaptations morphologiques sont liées à cette méthode de pêche : les pattes et les doigts sont grands et puissants, les ongles sont fortement courbés et tous d’égale longueur, le dessous des doigts est couvert de courtes épines, le plumage est dense, serré et huileux.

L’espèce est solitaire mais, en dehors de la saison de reproduction, peut se concentrer sur les sites de pêche les plus riches. Elle est monogame (rares cas de bigamie) et la fidélité à l’aire et au partenaire est supposée forte. Les couples se forment dès la 2e année et les oiseaux construisent des ébauches de nid, mais la reproduction ne commence pas avant la 3e année. Le mâle revient au printemps quelques jours avant la femelle et commence à exécuter des parades aériennes. Le maximum d’activité est atteint au retour de la femelle puis décroît rapidement.

L’aire est une forte structure de branchages recouverte de rameaux, de mousses, d’écorce et d’herbe. L’unique ponte de 2 ou 3 œufs (rarement 4) débute dès le mois de mars en Méditerranée, pas avant la mi-avril à l’intérieur des terres. L’incubation dure 34 à 40 jours et les jeunes s’envolent entre la 7e et la 8e semaine après l’éclosion.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Summary

"Pandion haliaetus, commonly called Osprey, is a large, diurnal, fish-eating raptor that is widely distributed with populations seen on every continent except Antartica."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

They are bright white underneath, with dark brown patches at the carpal joints and a mottled dark brown necklace. Other identifying markings include a dark stripe through each eye, and a dark brown back. The feet of this species are pale blue-gray, and the beak is black. Juvenile ospreys resemble adults, but have a somewhat speckled appearance due to buff-colored tips on their dark brown upper-wing and back coverts and a less well-defined necklace. Juveniles also have an orange-red iris, rather than the yellow iris that is typical of adults. Juvenile plumage is replaced by adult plumage by 18 months of age. On average, while not necessarily longer, female ospreys are 20% heavier than males and have a wingspan that is 5 to 10% greater.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Ospreys have a worldwide distribution, wintering or breeding on every continent except Antarctica. Ospreys are not known to breed in South America or Indo-Malasia, but are sometimes found there in the winter. Ospreys are winter breeders in Egypt and some Red Sea islands. Regions where ospreys are particularly abundant include Scandinavia and the Chesapeake Bay region of the United States.

There are four subspecies of ospreys, which are separated by geographic region. Pandion haliaetus carolinensis breeds in North America and the Caribbean, and winters in South America. P. h. haliaetus breeds in the Palearctic region (Europe, north Africa and in Asia, north of the Himalayas) and winters in south Africa, India and the East Indies. P. h. ridgwayi is a non-migratory subspecies. It resides in the Caribbean, with a range that extends from the Bahamas and Cuba to southeast Mexico and Belize. The final subspecies, P. h. leucocephalus is also a non-migratory subspecies. Its range includes Australia and the southwest Pacific.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native ); oceanic islands (Native )

Other Geographic Terms: holarctic ; cosmopolitan

  • Poole, A. 1989. Ospreys: A Natural and Unnatural History. New York: Cambridge University Press.
  • Steidl, R. 1991. Differential reproductive success of ospreys in New Jersey. The Journal of Wildlife Management, 55: 266-271.
  • Bruun, B., S. Baha el Din. 1999. Common Birds of Egypt. Cairo, Egypt: The American University in Cairo Press.
  • Porter, R., D. Cottridge. 2001. A photographic guide to birds of Egypt and the Middle East. Cairo, Egypt: The American University in Cairo Press.
  • Poole, A. 1994. Family Pandionidae (Osprey). Pp. 42-50 in J Del Hoyo, A Elliott, J Sargatal, eds. Handbook of the Birds of the World, Vol. 2. Barcelona: Lynx Edicions.
  • Poole, A., R. Bierregaard, M. Martell. 2002. Osprey (Pandion haliaetus). A Poole, F Gill, eds. The Birds of North America, Vol. 683. Philadelphia, PA: The Birds of North America, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Ospreys breed throughout much of the world (not in South America). In the New World, they nest from northwestern Alaska across boreal Canada to Labrador and Newfoundland, and south to Baja California, northwestern mainland Mexico, Yucatan Peninsula, Belize, U.S. Gulf Coast, Florida, and the West Indies. During the northern winter, ospreys in the New World range from California, the U.S. Gulf Coast, and Bermuda south through Central America to South America. In the U.S., primary wintering areas include central California, southern Texas, the Gulf coast, and southern Florida, though the winter range also includes other areas in the southern and southeastern U.S. and various inland sites (Root 1988). The species is also widespread in the Old World (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Distribution size (in km2): 31500000. Global range: Holarctic, Australasia, Southern Hemisphere. Indian subcontinent range: North East Afghanistan (Nuristan), East Gilgit to Assam valley, South Assam hills, Bangladesh, Peninsula to Sri lanka, Maldives, Lakshadweep, Andamans, Nicobars, West Himalayas."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Endemic Distribution

Not endemic
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Ospreys have a worldwide distribution. They live on every continent except Antarctica. Ospreys do not breed in South America or Indo-Malasia, but they sometimes live there in the winter. Large populations of ospreys are found in Scandinavia and the Chesapeake Bay region of the United States. There are four subspecies of ospreys, which are found in different regions of the world.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native ); oceanic islands (Native )

Other Geographic Terms: holarctic ; cosmopolitan

  • Poole, A. 1989. Ospreys: A Natural and Unnatural History. New York: Cambridge University Press.
  • Steidl, R. 1991. Differential reproductive success of ospreys in New Jersey. The Journal of Wildlife Management, 55: 266-271.
  • Bruun, B., S. Baha el Din. 1999. Common Birds of Egypt. Cairo, Egypt: The American University in Cairo Press.
  • Porter, R., D. Cottridge. 2001. A photographic guide to birds of Egypt and the Middle East. Cairo, Egypt: The American University in Cairo Press.
  • Poole, A. 1994. Family Pandionidae (Osprey). Pp. 42-50 in J Del Hoyo, A Elliott, J Sargatal, eds. Handbook of the Birds of the World, Vol. 2. Barcelona: Lynx Edicions.
  • Poole, A., R. Bierregaard, M. Martell. 2002. Osprey (Pandion haliaetus). A Poole, F Gill, eds. The Birds of North America, Vol. 683. Philadelphia, PA: The Birds of North America, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The osprey is nearly worldwide in distribution. It breeds in temperate
and tropical regions of all continents except South America. In North
America the subspecies carolinensis breeds from northwest Alaska and
northern Yukon to central Labrador and Newfoundland and south to Baja
California, central Arizona, southern Texas, the Gulf Coast, and
southern Florida [5,28]. They are migratory throughout most of their
range, wintering in Central and South America as far south as Argentina
and Chile [4,25]. Populations in southern Florida, Baja California, and
the Pacific coast of Mexico are year-round residents [25]. The
distributions of the other three subspecies are as follows [4]:

P. h. haliaetus - occurs from the Palearctic (Europe, the northwest
coast of Africa, and Asia north of the Himalayas).
P. h. ridgwayii - occurs in the Caribbean
P. h. cristatus - occurs in Australia, New Guinea, and nearby South
Pacific islands.
  • 4. Cadman, Michael D.; Eagles, Paul F. J.; Helleiner, Frederick M. 1987. Atlas of the breeding birds of Ontario. University of Waterloo Press. 617 p. [20129]
  • 5. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 25. Prevost, Yves A. 1983. Osprey distribution and subspecies taxonomy. In: Bird, David M.; Seymour, Norman R.; Gerrard, Jon M., eds. Biology and management of bald eagles and ospreys. Raptor Research Foundation, Inc.: 157-186. [20134]
  • 28. Burns, Timothy S. 1974. Wildlife situation report and management plan for the American osprey. Coordinating Guidelines for Wildlife Habitat Management No. 1. Hamilton, MT: U.S. Department of Agriculture, Forest Service, Northern Region, Bitterroot National Forest. 6 p. [20008]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
ID LA ME MD MA MI MN MS MO MT
NV NH NJ NM NY NC OH OK OR PA
RI SC SD TN TX UT VT VA WA WI WY


AB BC MB NB NF NT NS ON PE PQ
SK YT

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Subspecies and Distribution:


    * haliaetus (Linnaeus, 1758) - Scandinavia E to Japan and S to Mediterranean, Red Sea and Cape Verde Is; winters S to S Africa, India, W Indonesia and Philippines. * carolinensis (Gmelin, 1788) - Labrador W to Alaska and S to Florida and Arizona; winters S to Peru and S Brazil. * ridgwayi Maynard, 1887 - Caribbean, including Bahamas, Cuba and Belize. * cristatus (Vieillot, 1816) - Australia E to New Caledonia, and N through New Guinea to Java and Sulawesi.


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Ospreys are large birds of prey (55 to 58 cm long), with a wingspan ranging from 145 to 170 cm. Their long wings have a characteristic bend at the carpal ("wrist") joints. They are bright white underneath, with dark brown patches at the carpal joints and a mottled dark brown necklace. Other identifying markings include a dark stripe through each eye, and a dark brown back. The feet of this species are pale blue-gray, and the beak is black. Juvenile ospreys resemble adults, but have a somewhat speckled appearance due to buff-colored tips on their dark brown upper-wing and back coverts and a less well-defined necklace. Juveniles also have an orange-red iris, rather than the yellow iris that is typical of adults. Juvenile plumage is replaced by adult plumage by 18 months of age.

On average, while not necessarily longer, female ospreys are 20% heavier than males and have a wingspan that is 5 to 10% greater. In North America, for example, male ospreys range in mass from 1200 to 1600 g, whereas females range from 1600 to 2000 g. Female ospreys also often have darker plumage and a more defined necklace than their male counterparts.

Ospreys display morphological variation by region. Tropical and subtropical individuals tend to be smaller than individuals that breed at higher latitudes. The four subspecies of ospreys show some variation in size and color. Pandion haliaetis haliaetus and P.h. carolinensis are the largest and darkest subspecies. P.h.ridgwayi is approximately the same size as carolinensis, but is paler on the head and breast. P.h. cristatus is the smallest subspecies, with a dark necklace and pale crown.

Ospreys have several morphological adaptations to their unique fish-eating lifestyle. These adaptations include relatively long legs for a raptor, spiny footpads called spicules, long, sharp, curved claws, and a reversible outer toe to aid in gripping slippery fish. In addition, ospreys have dense oily plumage and efficient nasal valves that prevent water from entering the nostrils when the bird dives to catch a fish.

Range mass: 1200 to 2000 g.

Range length: 55 to 58 cm.

Range wingspan: 145 to 170 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger; sexes colored or patterned differently

  • Snyder, N., H. Snyder. 1991. Birds of Prey: Natural History and Conservation of North American Raptors. Stillwater, MN: Voyageur Press, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Adults have white head with black stripe through eye reaching to sides of neck, golden to brown coloured irises, black bill, deep glossy brown upperparts, white breast that has a distinctive broad mottled brown band or necklace visible at rest and in flight, white underparts and underwing coverts, black carpal patches, and white feet with black talons. They have short tails and long, pointed wings typically angled at carpals, with four long finger-like feathers and a shorter fifth feather. Feet large with scaly soles and a reversible toe. Sexes similar. Males are slimmer than females, have narrower wings, paler breast band, and more uniformly pale underwing coverts. Juveniles similar to adults except for more darkly streaked head, organge-red iris, less well-defined necklace, buff coloured tips on their dark brown upperwing and back coverts, and barring on the underwings and flight feathers."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Ospreys are large birds of prey (55 to 58 cm long), with a wingspan from 145 to 170 cm. Their long wings have are bent at the carpal ("wrist") joints. They are bright white underneath, with dark brown patches at the carpal joints and a speckled dark brown necklace. They have a dark stripe through each eye, and a dark brown back. Ospreys have light blue-gray feet, yellow eyes and a black beak. Juvenile ospreys look a lot like adults, but their dark feathers have light colored tips that make them look speckled on their backs and wings. They also have orange eyes. Ospreys begin to look like adults when they are about 18 months old.

Female ospreys are usually bigger than males. They have a bigger wingspan (5 to 10% longer than males) and are heavier. In North America, male ospreys weigh 1200 to 1600 g and females weigh 1600 to 2000 g. Female also usually have darker feathers than males.

Ospreys in different regions of the world look a little different from one another. For example, ospreys that live in tropical regions are smaller than ospreys that breed farther north or south from the equator. There are four subspecies of ospreys. Each of these lives in a different region of the world and looks a little different.

Ospreys have several adaptations for hunting fish. They have long legs for reaching into the water and dense, oily plumage that keeps them from getting waterlogged. They also have special valves that keep water out of their nostrils when they dive for fish. Osprey feet are specially adapted for holding on to slippery fish. They have spiny footpads called spicules, long, sharp claws, and a toe that can be turned backward to keep fish from escaping..

Range mass: 1200 to 2000 g.

Range length: 55 to 58 cm.

Range wingspan: 145 to 170 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger; sexes colored or patterned differently

  • Snyder, N., H. Snyder. 1991. Birds of Prey: Natural History and Conservation of North American Raptors. Stillwater, MN: Voyageur Press, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 64 cm

Weight: 1568 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 50–66 cm. Wingspan: 127–180 cm. Weight: 0.9–2.1 kg.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ospreys are large birds of prey (55 to 58 cm long), with a wingspan ranging from 145 to 170 cm. Their long wings have a characteristic bend at the carpal (""wrist"") joints.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from other hawks in having all of the following characteristics: white belly, dark wrist patches, and a white head with a prominent dark eye streak. Other hawks do not habitually plunge feet-first into water to obtain prey.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

SubSpecies Varieties Races

"a) Pandion haliaetus haliaetus (Linnaeus, 1758) - Scandinavia East to Japan and South to Mediterranean, Red Sea and Cape Verde Is; winters South to South Africa, India, West Indonesia and Philippines. b) Pandion haliaetus carolinensis (Gmelin, 1788) - Labrador west to Alaska and south to Florida and Arizona; winters south to Peru and South Brazil. This subspecies is larger in size, darker bodied and has a paler breast than nominate haliaetus. c) Pandion haliaetus ridgwayi Maynard, 1887 - Caribbean, including Bahamas, Cuba and Belize. This non-migratory subspecies has a a weak eye mask and very pale head and breast compared to nominate haliaetus. d) Pandion haliaetus cristatus (Vieillot, 1816) - Australia east to New Caledonia, and north through New Guinea to Java and Sulawesi. This non-migratory subspecies is the smallest and most distinctive subspecies."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

They are bright white underneath, with dark brown patches at the carpal joints and a mottled dark brown necklace. Other identifying markings include a dark stripe through each eye, and a dark brown back. The feet of this species are pale blue-gray, and the beak is black. Juvenile ospreys resemble adults, but have a somewhat speckled appearance due to buff-colored tips on their dark brown upper-wing and back coverts and a less well-defined necklace. Juveniles also have an orange-red iris, rather than the yellow iris that is typical of adults. Juvenile plumage is replaced by adult plumage by 18 months of age. On average, while not necessarily longer, female ospreys are 20% heavier than males and have a wingspan that is 5 to 10% greater.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Baja California Desert Habitat

This taxon is found in the Baja California Desert ecoregion, located on most of the western side of the Baja Peninsula, containing varied habitats such as mountains, plains and coastal dunes. This desert is one of the largest and best preserved in Mexico, and due to its isolation, contains a high level of species richness and endemism. A series of ophiolytes  (formations of gabrum, ultramafic rocks, and volcanic lava) surround the most prominent orographic feature: The San Andres mountain range. Overall, the climate is arid with variable temperature. The isolated nature of the peninsula, and its proximity to the sea, maintains a measure of humidity, and creates a stable diurnal temperature.

The predominant vegetation associations are composed of xeric scrub, which have been subdivided in diverse categories according to dominant species and the ecological conditions in which they occur. Thick-stemmed trees and shrubs, growing on rocky volcanic soils, cover the highest parts of the mountain ranges. Dominant plant species are Ambrosia camphorata, Common Stork's-bill (Erodium cicutarium), and Astragalus prorifer.  The Boojumtree (Fouquieria columnaris) can be also found at elevations up to 1200m. Many species of cacti are present. Dominant species within the Baja California Desert vary with elevation. Epiphytes such as Small Ballmoss (Tillandsia recurvata) and Cudbear (Rocella tinctoria) grow in low elevation, humid areas, and account for a majority of the perennial vegetation. Areas previously submerged under the sea (in the Miocene era) are now covered by highly saline and alkaline-tolerant species, such as Ambrosia magdalenae, El Vizcaino Agave (Agave vizcainoensis), Datilillo (Yucca valida), Pitaya Agria (Stenocereus gummosus), and Porter's Muhly (Muhlenbergia porteri). Dune vegetation includes Creosote Bush (Larrea tridentata), Barclay's Saltbush (Atriplex barclayana), Rush Milkweed (Asclepias subulata) and Nicolletia trifida.

There are a number of reptilian taxa found in the Baja California Desert including the endemic Baja California Brush Lizard (Urosaurus lahtelai). The Baja California Legless Lizard (Anniella geronimensis EN) is also endemic to the ecoregion, and is restricted to a narrow strip around 87 kilometres (km) long, ranging from about six km north of Colonia Guerrero, southerly to a point south of Punta Baja at the northern edge of Bahia El Rosario. This legless lizard extends to at most four km inland in the Arroyo Socorro, but otherwise found only in the coastal zone; A. geronimensis also occurs on Isla San Gerónimo. Also found here is the San Lucan Leaf-toed Gecko (Phyllodactylus unctus NT), a species not endemic to the ecoregion, but restricted to the southern Baja Peninsula and the Gulf of California islands of Partida Sur, Gallo, Espiritu Santo, Ballena, Gallina and Cerralvo.

There are only a few amphibians found in the ecoregion. Anuran taxa occurring here include: California Chorus Frog (Pseudacris cadaverina); Pacific Chorus Frog (Pseudacris regilla); and Canyon Treefrog (Hyla arenicolor). Also found here is the Plateau Toad (Anaxyrus compactilis), an endemic to the lower central Mexican Plateau and Baja California Desert; another toad occurring in the ecoregion is the Western Toad (Anaxyrus boreas NT). The Channel Islands Slender Salamander (Batrachoseps pacificus) was earlier thought to occur in this ecoregion, but genetic data shows that this taxon is strictly endemic to the Channel Islands of California.

Endemic mammals include San Quintín Kangaroo Rat (Dipodomys gravipes CR), and Baja California Rock Squirrel (Spermophilus atricapillus EN). Other mammals that are classified as special status are the Lesser Long-nosed Bat (Leptonycteris yerbabuenae VU). Some shallow coastal saltwater lagoons protruding into the Baja California Desert along the Pacific Ocean provide key breeding habitat for the Grey Whale (Eschrichtius robustus CR). One of the largest such breeding waters is the remote San Ignacio Lagoon, extending many kilometres inland and rarely exceeding fifteen metres in depth.

Important sites for avian conservation include the Ojo de Liebre lagoon, along the Pacific coast, which is home to millions of overwintering ducks and geese. Bird species in the Baja California Desert include such notable raptor taxa as Golden Eagle (Aquila chrysaetos), Peregrine Falcon (Falco peregrinus), Southern Crested Caracara (Caracara plancus), Osprey (Pandion haliaeutus), and Burrowing Owl (Athene cunicularia).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Ospreys have a wide distribution because they are able to live almost anywhere where there are safe nest sites and shallow water with abundant fish. Nests are generally found within 3 to 5 km of a water body such as a salt marsh, mangrove (Rhizophora) swamp, cypress (Taxodium) swamp, lake, bog, reservoir or river. The frequency with which each of these habitat types is used varies by geographic region.

Ospreys choose structures that can support a bulky nest, and that are safe from ground-based predators. Nest sites can be safe from predators either by being difficult for a predator to climb (e.g. on a cliff) or by being over water or on a small island. Over-water nest sites that are often used by ospreys include buoys and channel markers, dead trees and artificial nest platforms. Ospreys have also been known to nest on various man-made structures, such as power poles, duck blinds, communication towers, buildings and even billboards. In many cases, nests that are built on artificial structures such as nest platforms and power poles are more stable and fledge more chicks per breeding season than nests on naturally-occuring structures.

Habitat Regions: temperate ; tropical ; terrestrial ; saltwater or marine ; freshwater

Terrestrial Biomes: forest ; rainforest ; mountains

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Wetlands: marsh ; swamp

Other Habitat Features: suburban ; riparian ; estuarine

  • Ewins, P. 1996. The use of artificial nest sites by an increasing population of ospreys in the Canadian Great Lakes Basin. Pp. 109-124 in D Bird, D Varland, J Negro, eds. Raptors in Human Landscapes. Sand Diego: Academic Press Limited.
  • Henny, C., J. Kaiser. 1996. Osprey population increase along the Willamette River, Oregon, and the Role of Utility Structures, 1976-93. Pp. 97-108 in D Bird, D Varland, J Negro, eds. Raptors in Human Landscapes. San Diego: Academic Press Limited.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology

Behaviour Individuals in the tropics and subtropics are resident, but others migrate to the lower latitudes of the Amazon Basin, South America’s northern coast, or West Africa in the non-breeding season (del Hoyo et al. 1994). Migrants begin moving to lower latitudes in August and arrive by October, returning in March and April (Ferguson-Lees and Christie 2001). Birds are generally solitary and usually migrate alone, but may congregate in small groups at roosts or plentiful food sources (del Hoyo et al. 1994, Ferguson-Lees and Christie 2001). The species migrates on broad fronts and is not dependent on land bridges during migration (Snow and Perrins 1998, Ferguson-Lees and Christie 2001); birds readily cross bodies of water using flapping flight, but can soar easily over land. It is entirely diurnal (Brown et al. 1982). Habitat It inhabits the areas around shallow waters, being sufficiently tolerant of human settlement to persist in suburban and sometimes urban environments (del Hoyo et al. 1994). Diet Almost its entire diet consists of live fish (del Hoyo et al. 1994). Breeding site Birds usually build large nests high in exposed trees (del Hoyo et al. 1994). Management information Reintroduction has helped populations to recover across parts of its range (del Hoyo et al. 1994).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Ospreys occur primarily along rivers, lakes, reservoirs, and seacoasts. They often cross land between bodies of water. They typically build large stick nests on living or dead trees and also use numerous man-made structures such as utility poles, wharf pilings, windmills, microwave towers, chimneys, and channel markers (Henny, in Palmer 1988, Campbell et al. 1990). Nests are usually near or above water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"A. Global: Habitat systems: Terrestrial; Freshwater; Marine. Forest Dependency: Low. Altitude: 0 - 1000 m. Altitudinal limits: (max) 4100 m. General Habitats: Forest - Subtropical/Tropical Mangrove Vegetation Above High Tide Level; Wetlands (inland) - Permanent Rivers/Streams/Creeks (includes waterfalls), Bogs, Marshes, Swamps, Fens, Peatlands, Permanent Freshwater Lakes (over 8ha); Marine Neritic - Subtidal Rock and Rocky Reefs, Subtidal Loose Rock/pebble/gravel, Subtidal Sandy, Subtidal Sandy-Mud, Macroalgal/Kelp, Seagrass (Submerged), Estuaries; Marine Coastal/Supratidal - Coastal Brackish/Saline Lagoons/Marine Lakes; Artificial/Aquatic - Water Storage Areas (over 8ha), Aquaculture Ponds, Canals and Drainage Channels, Ditches. Breeding Habitats: Artificial landscapes (aquatic) - Aquaculture ponds, Canals, drainage ditches, ditches, Water storage areas (>8ha); Forest - Subtropical/tropical mangrove; Marine coastal - Brackish/saline lagoons; Marine neritic - Coastal inshore water, Estuarine water; Inland Wetlands - Bogs, marshes, swamps, fens, peatlands, Freshwater lakes (>8 ha) - permanent, Rivers, streams, creeks - permanent. B. Indian subcontinent: In winters found near coastal waters and large inland water bodies including rivers, irrigation tanks and jheels"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ospreys have a wide distribution because they are able to live almost anywhere that has safe nest sites and shallow water with lots of fish. Nests are usually found within 3 to 5 km of a water body such as a salt marsh, mangrove (Rhizophora) swamp, cypress (Taxodium) swamp, lake, bog, reservoir or river.

Ospreys need structures that can support their big nests, and that are safe from climbing predators, like Procyon lotor. In order to be safe from predators, ospreys usually build their nests in places that are difficult for predators to reach, like on the side of a cliff, or over water or on a small island. Over-water nests are built on structures like buoys, channel markers, dead trees and special platforms that people build for ospreys. Ospreys also nest on other man-made structures that are very high, like power poles, radio and TV towers, buildings and even billboards.

Habitat Regions: temperate ; tropical ; terrestrial ; saltwater or marine ; freshwater

Terrestrial Biomes: forest ; rainforest ; mountains

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Wetlands: marsh ; swamp

Other Habitat Features: suburban ; riparian ; estuarine

  • Ewins, P. 1996. The use of artificial nest sites by an increasing population of ospreys in the Canadian Great Lakes Basin. Pp. 109-124 in D Bird, D Varland, J Negro, eds. Raptors in Human Landscapes. Sand Diego: Academic Press Limited.
  • Henny, C., J. Kaiser. 1996. Osprey population increase along the Willamette River, Oregon, and the Role of Utility Structures, 1976-93. Pp. 97-108 in D Bird, D Varland, J Negro, eds. Raptors in Human Landscapes. San Diego: Academic Press Limited.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, snag, tree

Ospreys typically nest at the extreme tip of a tree or snag with little
or no overhead cover [17]. They prefer tall snags that provide good
visibility and security [5]. Ospreys also prefer to nest over water for
protection against climbing predators. Islands free of mammalian
predators allow safe nesting in low trees and even on the ground.
Swamps also provide safe nesting [24].
  • 5. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 17. Mathisen, John E. 1968. Identification of bald eagle and osprey nests in Minnesota. Loon. 40(4): 113-114. [13996]
  • 24. Poole, Alan F. 1989. Ospreys: a natural and unnatural history. Cambridge; New York: Cambridge University Press. 246 p. [20133]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the term: cacti

Ospreys occupy a wide range of habitats near water, primarily lakes,
rivers, and coastal waters with adequate supplies of fish [4]. Their
nests are generally built within 6 to 7 miles (9.6-11.2 km) of large
lakes or rivers with slow-moving water [14,30]. Flattened portions of
partially broken off snags, trees, rocks, dirt pinnacles, cacti, and
numerous man-made structures such as utility poles and duck blinds are
used for nests [14,28,30]. The nests consist of a large interwoven pile
of sticks lined with some soft material such as cedar bark or moss
[28,30]. The area around the nest is generally open, giving the birds
clear access when landing. Ponderosa pine in the western United States,
tupelo (Nyssa sylvatica) in the eastern United States, and mangroves
(Rhizophora spp.) in the subtropics are all favored as nest trees for
this reason [24].
  • 4. Cadman, Michael D.; Eagles, Paul F. J.; Helleiner, Frederick M. 1987. Atlas of the breeding birds of Ontario. University of Waterloo Press. 617 p. [20129]
  • 24. Poole, Alan F. 1989. Ospreys: a natural and unnatural history. Cambridge; New York: Cambridge University Press. 246 p. [20133]
  • 28. Burns, Timothy S. 1974. Wildlife situation report and management plan for the American osprey. Coordinating Guidelines for Wildlife Habitat Management No. 1. Hamilton, MT: U.S. Department of Agriculture, Forest Service, Northern Region, Bitterroot National Forest. 6 p. [20008]
  • 30. Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Forest and Range Experiment Station. 439 p. [10237]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the term: association

Ospreys occur in a variety of plant communities in association with
riparian habitat including shrublands, grasslands, swamps, and
coniferous and deciduous forests [14,24,30]. In Minnesota, ospreys nest
most frequently in lowland communities such as those dominated by black
spruce (Picea mariana) and tamarack (Larix laricina) [17]. In
California, ospreys are primarily associated with ponderosa pine (Pinus
ponderosa) and mixed-conifer types [30].

REFERENCES :
NO-ENTRY
  • 17. Mathisen, John E. 1968. Identification of bald eagle and osprey nests in Minnesota. Loon. 40(4): 113-114. [13996]
  • 24. Poole, Alan F. 1989. Ospreys: a natural and unnatural history. Cambridge; New York: Cambridge University Press. 246 p. [20133]
  • 30. Verner, Jared; Boss, Allan S., tech. coords. 1980. California wildlife and their habitats: western Sierra Nevada. Gen. Tech. Rep. PSW-37. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Forest and Range Experiment Station. 439 p. [10237]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the terms: hardwood, swamp

1 Jack pine
5 Balsam fir
12 Black spruce
13 Black spruce - tamarack
15 Red pine
16 Aspen
17 Pin cherry
18 Paper birch
19 Gray birch - red maple
20 White pine - northern red oak - red maple
21 Eastern white pine
22 White pine - hemlock
23 Eastern hemlock
24 Hemlock - yellow birch
25 Sugar maple - beech - yellow birch
26 Sugar maple - basswood
27 Sugar maple
28 Black cherry - maple
35 Paper birch - red spruce - balsam fir
37 Northern white-cedar
38 Tamarack
39 Black ash - American elm - red maple
40 Post oak - blackjack oak
42 Bur oak
43 Bear oak
44 Chestnut oak
45 Pitch pine
46 Eastern redcedar
50 Black locust
51 White pine - chestnut oak
52 White oak - black oak - northern red oak
53 White oak
55 Northern red oak
57 Yellow-poplar
58 Yellow-poplar - eastern hemlock
59 Yellow-poplar - white oak - northern red oak
60 Beech - sugar maple
61 River birch - sycamore
62 Silver maple - American elm
63 Cottonwood
64 Sassafras - persimmon
65 Pin oak - sweetgum
69 Sand pine
70 Longleaf pine
71 Longleaf pine - scrub oak
73 Southern redcedar
75 Shortleaf pine
76 Shortleaf pine - oak
78 Virginia pine - oak
79 Virginia pine
80 Loblolly pine - shortleaf pine
81 Loblolly pine
83 Longleaf pine - slash pine
84 Slash pine
85 Slash pine - hardwood
88 Willow oak - water oak - diamondleaf oak
89 Live oak
91 Swamp chestnut oak - cherrybark oak
92 Sweetgum - willow oak
93 Sugarberry - American elm - green ash
94 Sycamore - sweetgum - American elm
95 Black willow
107 White spruce
108 Red maple
98 Pond pine
96 Overcup oak - water hickory
101 Baldcypress
111 South Florida slash pine
109 Hawthorn
110 Black oak
201 White spruce
202 White spruce - paper birch
203 Balsam poplar
204 Black spruce
208 Whitebark pine
209 Bristlecone pine
210 Interior Douglas-fir
211 White fir
212 Western larch
213 Grand fir
215 Western white pine
216 Blue spruce
217 Aspen
218 Lodgepole pine
219 Limber pine
221 Red alder
222 Black cottonwood - willow
223 Sitka spruce
224 Western hemlock
225 Western hemlock - Sitka spruce
226 Coastal true fir - hemlock
227 Western redcedar - western hemlock
228 Western redcedar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the terms: bog, shrub

K001 Spruce - cedar - hemlock forest
K002 Cedar - hemlock - Douglas-fir forest
K003 Silver fir - Douglas-fir forest
K004 Fir - hemlock forest
K005 Mixed conifer forest
K008 Lodgepole pine - subalpine forest
K009 Pine - cypress forest
K010 Ponderosa shrub forest
K011 Western ponderosa pine
K012 Douglas-fir forest
K013 Cedar - hemlock - pine forest
K014 Grand fir - Douglas-fir forest
K015 Western spruce - fir forest
K016 Eastern ponderosa forest
K018 Pine - Douglas-fir forest
K019 Arizona pine forest
K020 Spruce - fir - Douglas-fir forest
K021 Southwestern spruce - fir forest
K022 Great Basin pine forest
K023 Juniper - pinyon woodland
K025 Alder - ash forest
K026 Oregon oakwoods
K029 California mixed evergreen forest
K030 California oakwoods
K031 Oak - juniper woodlands
K032 Transition between K031 and K037
K047 Fescue - oatgrass
K049 Tule marshes
K050 Fescue - wheatgrass
K051 Wheatgrass - bluegrass
K053 Grama - galleta steppe
K054 Grama - tobosa prairie
K063 Foothills prairie
K064 Grama - needlegrass - wheatgrass
K065 Grama - buffalograss
K066 Wheatgrass - needlegrass
K067 Wheatgrass - bluestem - needlegrass
K068 Wheatgrass - grama - buffalograss
K069 Bluestem - grama prairie
K070 Sandsage - bluestem prairie
K071 Shinnery
K072 Sea oats prairie
K073 Northern cordgrass prairie
K074 Bluestem prairie
K075 Nebraska Sandhills prairie
K076 Blackland prairie
K077 Bluestem - sacahuista prairie
K078 Southern cordgrass prairie
K079 Palmetto prairie
K080 Marl - everglades
K081 Oak savanna
K082 Mosaic of K074 and K100
K083 Cedar glades
K084 Cross Timbers
K085 Mesquite - buffalograss
K086 Juniper - oak savanna
K087 Mesquite - oak savanna
K088 Fayette prairie
K089 Black Belt
K090 Live oak - sea oats
K091 Cypress savanna
K092 Everglades
K093 Great Lakes spruce - fir forest
K094 Conifer bog
K096 Northeastern spruce - fir forest
K097 Southeastern spruce - fir forest
K098 Northern floodplain forest
K099 Maple - basswood forest
K100 Oak - hickory forest
K101 Elm - ash forest
K102 Beech - maple forest
K103 Mixed mesophytic forest
K104 Appalachian oak forest
K105 Mangrove
K106 Northern hardwoods
K107 Northern hardwoods - fir forest
K108 Northern hardwoods - spruce forest
K109 Transition between K104 and K106
K110 Northeastern oak - pine forest
K111 Oak - hickory - pine forest
K112 Southern mixed forest
K113 Southern floodplain forest
K116 Subtropical pine forest

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES39 Prairie
FRES41 Wet grasslands
FRES42 Annual grasslands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 12.466 - 12.466
  Nitrate (umol/L): 3.089 - 3.089
  Salinity (PPS): 31.538 - 31.538
  Oxygen (ml/l): 6.346 - 6.346
  Phosphate (umol/l): 0.565 - 0.565
  Silicate (umol/l): 9.560 - 9.560
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ospreys have a wide distribution because they are able to live almost anywhere where there are safe nest sites and shallow water with abundant fish. Nests are generally found within 3 to 5 km of a water body such as a salt marsh, mangrove (Rhizophora) swamp, cypress (Taxodium) swamp, lake, bog, reservoir or river. The frequency with which each of these habitat types is used varies by geographic region. Ospreys choose structures that can support a bulky nest, and that are safe from ground-based predators. Nest sites can be safe from predators either by being difficult for a predator to climb (e.g. on a cliff) or by being over water or on a small island. Over-water nest sites that are often used by ospreys include buoys and channel markers, dead trees and artificial nest platforms. Ospreys have also been known to nest on various man-made structures, such as power poles, duck blinds, communication towers, buildings and even billboards.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Breeding populations in northern North America are migratory. They arrive in northern breeding areas March-May, begin southward migration in August, and are generally gone from the north by September-November

In Costa Rica, migration occurs mainly September-October and March-April (Stiles and Skutch 1989). Eastern and midwestern populations winter in northern South America, Caribbean, Central America, U.S.; western populations winter in Mexico, Central America, and northwestern South America (Ewins and Houston 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Full migrant. Resident and breeding populations of this species found in the Himalayas. In winter, a widespread visitor to the entire Indian Union."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Ospreys are unusual among raptors for being piscivores. Their diet consists almost exclusively of fish (≥99% of prey items). They are generally opportunistic, and will eat whatever fish species are accessible to them – either in shallow waters, or near the surface of deeper waters. Studies in North America have documented more than 80 different prey species of ospreys. However, 2 or 3 common species may dominate the diet of local ospreys in a given area.

Ospreys hunt for fish on the wing (less often from a perch), flapping and gliding 10 to 40 meters above the water. When an osprey spots a fish, it hovers briefly, then dives toward the surface of the water. Just before hitting the water, the osprey swings its legs forward and bends its wings back, plunging feet-first into the water. The osprey uses strong, almost horizontal wing beats to lift itself and its prey from the water. Once airborne, the osprey rearranges the fish in its feet, carrying it with one foot in front of the other so that the fish is facing forward. This position presumably makes the fish more aerodynamic, and easier to carry. The osprey then takes the fish to a perch, often near the nest, to eat. Osprey generally eat fish beginning with the head and working toward the tail. A male who is also providing food for a mate and offspring during the breeding season will typically consume at least part of the fish before delivering the remainder to the female. Ospreys do not cache fish. If a fish is larger than an osprey (and his mate and offspring if breeding) can consume, the fish is discarded, carried around with the osprey, or left in the nest. Ospreys do not generally need to drink water. Fish flesh supplies sufficient amounts of water to meet their requirements.

Ospreys catch fish on 24 to 74% of their dives. This success rate is affected by individual ability, weather and tide. Some studies have shown that ospreys are most successful hunting at midtide and when the weather is calm.

Though the vast majority of osprey prey items are live fish, ospreys have been observed to eat other foods on occasion. These include birds, snakes, voles, squirrels, muskrats (Ondatra zibethicus), salamanders, conchs, and even a small alligator (Alligator mississippiensis). Reports of ospreys feeding on carrion are rare. However, they have been observed eating dead white-tailed deer (Odocoileus virginianus) and opossum (Didelphis virginiana).

Animal Foods: birds; mammals; amphibians; reptiles; fish; carrion ; mollusks

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Ospreys eat almost exclusively fishes (see Palmer 1988 for detailed account of food). Species composition of diet may vary greatly from one area to another. Sometimes ospreys eat rodents, birds, other small vertebrates, or crustaceans.

Ospreys capture prey with a feet-first plunge into shallow water, usually by flight hunting, sometimes from perch. Rarely they have been photographed capturing two fishes at once, one in each foot.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Carnivore. 99% of its diet consists of fish. Occassionally, it may feed on amphibians, small reptiles, other birds and small mammals like rodents and rabbits."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Ospreys are unusual among raptors for being piscivores. Their diet consists almost entirely of fish (≥99% of prey items). They are opportunistic, and will eat whatever fish species they can catch – either in shallow waters, or near the surface of deeper waters. North American ospreys are known to eat more than 80 different species of fish.

Ospreys hunt for fish while flapping and gliding 10 to 40 meters above the water. When an osprey spots a fish, it hovers briefly, then dives toward the water. Just before hitting the water, the osprey swings its legs forward and bends its wings back, plunging feet-first into the water. The osprey uses strong wing beats to lift itself and the fish out of the water. Once airborne again, the osprey rearranges the fish in its feet, carrying it with one foot in front of the other so that the fish is facing forward. This position probably makes the fish easier to fly with. The osprey then takes the fish to a perch to eat.

Ospreys generally eat fish starting at the head and working toward the tail. A male who is also hunting food for a mate and chicks during the breeding season will usually eat at least part of the fish before delivering the rest to the female. Ospreys do not usually need to drink water. They get enough water from the fish that they eat.

Ospreys successfully catch fish on 24 to 74% of their dives. Ospreys are usually more successful at mid-tide and when the weather is calm.

Though ospreys eat mostly fish, they have occasionally been seen eating other things, including Aves, Serpentes, voles, Sciuridae, muskrats (Ondatra zibethicus), salamanders, Strombus, and even a small alligator (Alligator mississippiensis). Reports of ospreys feeding on carrion are rare. However, they have been observed eating dead white-tailed deer (Odocoileus virginianus) and opossum (Didelphis virginiana).

Animal Foods: birds; mammals; amphibians; reptiles; fish; carrion ; mollusks

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The osprey diet consists almost entirely of fish, but they will
occasionally eat frogs, snakes, ducks, crows, and small mammals
[5,6,28,29]. Ospreys can penetrate only about 3 feet (1 m) below the
water surface. Therefore, they generally catch only surface fish or
those that frequent shallow flats and shorelines. Ospreys are
opportunists. If fish are abundant, accessible, and the right size they
seldom go unconsumed [24]. Poole [24] found that along the southern
coast of New England, about one-half of the fish ospreys eat during the
breeding season are winter flounder (Pseudopleuonectes americanus).
White herring (Alosa spp.) and Menhaden (Brevoortia tyrannus) each
supply another 20 percent of the diet. Inland ospreys are likely to eat
the same species of fish throughout the breeding season, but coastal
populations change prey regularly in response to the seasonal migration
of marine fish [24]. Ospreys in western North America often eat
suckers, carp, bullhead (Ictalurus spp.), and perch (Perca flavescens)
when nesting near warm shallow lakes or reservoirs but eat trout when
nesting near deeper, colder waters [24,29].
  • 5. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 6. DuBois, Kristi; Becker, Dale; Thornbrugh, Joe. 1987. Identification of Montana's birds of prey. Montana Outdoors. 18(6): 11-31. [3606]
  • 24. Poole, Alan F. 1989. Ospreys: a natural and unnatural history. Cambridge; New York: Cambridge University Press. 246 p. [20133]
  • 28. Burns, Timothy S. 1974. Wildlife situation report and management plan for the American osprey. Coordinating Guidelines for Wildlife Habitat Management No. 1. Hamilton, MT: U.S. Department of Agriculture, Forest Service, Northern Region, Bitterroot National Forest. 6 p. [20008]
  • 29. Van Daele, Lawrence J.; Van Daele, Hilary A. 1982. Factors affecting the productivity of ospreys nesting in west-central Idaho. Condor. 84: 292-299. [15143]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ospreys are unusual among raptors for being piscivores. Their diet consists almost exclusively of fish (≥99% of prey items). They are generally opportunistic, and will eat whatever fish species are accessible to them – either in shallow waters, or near the surface of deeper waters. Studies in North America have documented more than 80 different prey species of ospreys. However, 2 or 3 common species may dominate the diet of local ospreys in a given area.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

While ospreys provide food for some species (see Predation), it is unlikely that they represent a significant portion of the diet of any species. Ospreys do prey on fish, and are likely have some effect on local fish populations. Like most predators, ospreys are host to many different species of parasites, including feather mites. They are not parasitic or mutualistic with any other species.

Ospreys nests are used by many species of birds other than ospreys. Smaller cavity-nesting species, such as common grackles, tree swallows, barn swallows, European starlings and house sparrows build nests within osprey nests. Other larger species will usurp osprey nests for their own use in the spring before the resident ospreys return. In North America, these species include great blue herons, Canada geese, bald eagles, Red-tailed hawks, Great horned owls, herring gulls and common ravens.

Ospreys in some areas, particularly boreal and other northern forested regions, may have historically been dependant on beavers for creation of habitat. Beavers create osprey habitat by building dams, which create shallow ponds for fishing and dead trees appropriate for building nests.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ospreys are vulnerable to predation from aerial predators, such as owls and eagles . In North America, Bald eagles and great horned owls are known predators of osprey nestlings and (occasionally) adults. The speckled appearance of osprey chicks camouflages them in the nest and may be an adaptation to minimize predation by diurnal avian predators like the bald eagle.

Raccoons, snakes and other climbing animals are suspected predators of osprey eggs and nestlings. Selection by such terrestrial predators may explain why the majority of osprey nests in many area, for example in the Chesapeake Bay region of the U.S., are built over water. Crocodilians may prey on wintering ospreys. Nile crocodiles (Crocodylus niloticus) sometimes kill ospreys bathing and roosting near water in Africa.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

While ospreys provide food for some species, they are probably not the main food source for any species. Because ospreys prey on fish, they probably have a small effect on local fish populations. Like most predators, ospreys are host to many different species of parasites, including feather mites.

Ospreys nests are used by many other species of birds. Smaller cavity-nesting species, such as Quiscalus quiscula, Tachycineta bicolor, Hirundo rustica, sturnus vulgaris and Passer domesticus build nests inside osprey nests. Other larger species take over osprey nests for their own use in the spring before the resident ospreys return. In North America, these species include Ardea herodias, Branta canadensis, Haliaeetus leucocephalus, Buteo jamaicensis, Bubo virginianus, Larus argentatus and Corvus corax.

Ospreys in some areas, especially northern forested regions, may have historically depended on beavers to create habitat for them. Beavers create osprey habitat by building dams, which create shallow ponds for fishing and dead trees for building nests.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Ospreys are vulnerable to predation from aerial predators, such as owls and eagles . In North America, Bald eagles and great horned owls are known predators of osprey nestlings and (occasionally) adults. The speckled appearance of osprey chicks camouflages them in the nest and may be an adaptation to minimize predation by diurnal avian predators like the bald eagle.

Raccoons, snakes and other climbing animals are probably predators of osprey eggs and nestlings. This is probably why ospreys in many areas build their nests over water. Crocodiles may also prey on wintering ospreys. Crocodylus niloticus sometimes kill ospreys bathing and roosting near water in Africa.

Known Predators:

  • great horned owls (Bubo_virginianus)
  • raccoons (Procyon_lotor)
  • Nile crocodiles (Crocodylus_niloticus)
  • bald eagles (Haliaeetus_leucocephalus)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Crocodiles (Crocodylus spp.) have been known to eat ospreys roosting on
mudbanks, but only owls (mostly great horned owls [Bubo virginianus])
kill adult ospreys with any regularity. Raccoons (Procyon lotor) will
eat osprey eggs and chicks. Predators exert a major impact on the nest
sites ospreys choose. Most climbing predators like raccoons seem
reluctant to swim far, so only aerial predators such as owls reach
overwater nests easily [24].
  • 24. Poole, Alan F. 1989. Ospreys: a natural and unnatural history. Cambridge; New York: Cambridge University Press. 246 p. [20133]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Pandion haliaetus is prey of:
Haliaeetus leucocephalus
Bubo virginianus
Procyon lotor
Crocodylus niloticus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Pandion haliaetus preys on:
Istiophoridae
Anguilliformes
Tetraodontidae
Austromenidia
Umbrina
Sciaena
Polynemus
Actinopterygii
Mollusca
Amphibia
Reptilia
Aves
Mammalia
Fulica americana

Based on studies in:
USA: New York, Long Island (Marine)
Peru (Coastal)

This list may not be complete but is based on published studies.
  • G. M. Woodwell, Toxic substances and ecological cycles, Sci. Am. 216(3):24-31, from pp. 26-27 (March 1967).
  • H. W. Koepcke and M. Koepcke, Sobre el proceso de transformacion de la materia organica en las playas arenosas marinas del Peru. Publ. Univ. Nac. Mayer San Marcos, Zoologie Serie A, No. 8, from p. 24 (1952).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Global population unknown. Nesting numbers in the conterminous U.S. have been estimated at 8,000 pairs (Henny 1983). Estimated number of breeding pairs in Canada in the early 1990s was estimated at 10,000-12,000 (Kirk et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"500,000 mature individuals (2009)"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Raccoons can be a major source of nesting failure in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: cover, short-term effects

Information was not found in the literature on habitat related fire
effects of the osprey; however, fires will presumably create and destroy
snags used by ospreys. Additionally, the short-term effects of a
riparian fire may affect the osprey's food supply. Removal of
streamside vegetation increases the risk of streambank erosion, reduces
available habitat and raises stream temperatures, all of which could
potentially reduce fish populations in the stream. However, the
long-term effect of fire on fish populations could be benefical. The
thinning and removal of conifers along streams by fire and stimulation
of deciduous vegetation promotes cover, provides shading, and allows
development of terrestrial insects important in the diet of fish [31].
  • 31. Wright, Henry A.; Bailey, Arthur W. 1982. Fire ecology: United States and southern Canada. New York: John Wiley & Sons. 501 p. [2620]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

Courtship - Ospreys generally arrive on their breeding grounds in late
March or early April. Pair bonding persists from one year to the next,
and the same nest site may be used for many years [26]. Most ospreys
are monogamous; occasionally they breed as a polygynous trio (one male
breeding concurrently with two females) [24].

Age at first reproduction - Ospreys generally first breed when they are
between 3 and 4 years old [24,28]. Juveniles spend about 17 months on
the wintering gounds. At around 2 years of age they return to the
nesting grounds but do not breed until the following year [28]. Age at
first reproduction varies not only among individual ospreys but among
populations, apparently in relation to the availability of nest sites
and other resources. For example, birds along the eastern shore of
Chesapeake Bay do not start breeding until they are 5 to 7 years old due
to the lack of nest sites [24].

Clutch/incubation/fledging - Most migratory ospreys lay two to four eggs
from late April to early May and incubate them for 5 to 6 weeks [24,28].
An average of 1.1 to 1.3 young per active nest are fledged per year
[28]. Young fledge when they are about 2 months old [4,28]. They
return to the nest for feeding and roosting for another week, and can be
found nearby for sometime after that [4]. Most resident ospreys lay
their clutch in winter. In southern Florida, for example, ospreys lay
from early December until late February [24].

Life span - On average, out of 100 fledged young, 37 will be alive 4
years after fledging, 17 will be alive 8 years after fledging, and only
six to eight will be alive 12 years after fledging. The greatest
longevity recorded is 25 years [24].
  • 4. Cadman, Michael D.; Eagles, Paul F. J.; Helleiner, Frederick M. 1987. Atlas of the breeding birds of Ontario. University of Waterloo Press. 617 p. [20129]
  • 24. Poole, Alan F. 1989. Ospreys: a natural and unnatural history. Cambridge; New York: Cambridge University Press. 246 p. [20133]
  • 26. Ryser, Fred A. 1985. Birds of the Great Basin. Reno, NV: University of Nevada Press. 604 p. [20135]
  • 28. Burns, Timothy S. 1974. Wildlife situation report and management plan for the American osprey. Coordinating Guidelines for Wildlife Habitat Management No. 1. Hamilton, MT: U.S. Department of Agriculture, Forest Service, Northern Region, Bitterroot National Forest. 6 p. [20008]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Ospreys use several different vocalizations to communicate with one another. Up to five different calls have been recognized by researchers. These calls are nearly always associated with a visual display, such as a characteristic flight or posture. Vocalizations are used for begging, alarm, courtship, and nest defense. One notable display is the “sky-dance,” which is an elaborate aerial display performed by males during courtship and early incubation. During this display, a male carrying a fish or nest material gives a screaming call while simultaneously performing short undulating flights separated by periods of hovering. Alarm calls are often given when a potential predator or disturbance such as a boat or human approaches the nest. These calls are usually accompanied by erect posturing and diving flight.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

"Usually glides just above the water surface, scanning to find fish and sometimes spotted hovering at points where it detects movement. Plunges into water with its wings closed, often getting completely submerged, when it catches sight of prey which it catches in its talons, carries to a nearby rock to tear and feed on. Calls rarely heard in wintering grounds but believed to be a clear kai, kai, kai."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Ospreys use up to five different calls to communicate with each other. They also use visual displays, like special flight displays or specific body positions to communicate. Often calls and visual displays are used together. Calls are used to for begging, alarm, courtship, and nest defense. Alarm calls are often given when a potential predator or disturbance such as a boat or human approaches the nest. Ospreys giving alarm calls usually stand very erect on the nest, or dive at the disturbance.

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Ospreys are a relatively long-lived bird species. The oldest known osprey in North America was a 25-year old male. The oldest known female was 23 years old. However, very few individuals live to this age. Chance of survival from one year to the next varies between populations, but is estimated to be approximately 60% for young ospreys (less than 2 years old) and 80 to 90% for adult ospreys.

Range lifespan

Status: wild:
25 (high) years.

Average lifespan

Status: wild:
314 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max lifespan in wild: 25 years for males and 23 years for females.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Ospreys are a relatively long-lived bird species. The oldest known osprey in North America was a 25-year old male. The oldest known female was 23 years old. However, very few individuals live to this age. Chance of survival from one year to the next varies between populations, but is estimated to be approximately 60% for young ospreys (less than 2 years old) and 80 to 90% for adult ospreys.

Range lifespan

Status: wild:
25 (high) years.

Average lifespan

Status: wild:
314 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 32 years (wild) Observations: IMR was estimated based on data from the wild (http://www.fs.fed.us/database/feis/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Some ospreys migrate seasonally, but not all. Non-migratory populations breed and winter in the same location, though they may wander several hours from their nest during the non-breeding season. These populations begin breeding between December and March. Migratory populations generally breed where winters are cold enough to drive fish into deep water where they are inaccessible. These populations begin breeding in April or May.

Courtship in ospreys centers on food and nest sites. In migratory osprey populations, males and females arrive at the nest site separately, the male often arriving several days earlier than the female. Male ospreys sometimes perform a conspicuous aerial display near the nest site. This display usually occurs during early courtship, and may serve to attract potential mates or to threaten an intruder. Both sexes collect materials for the nest, but the female does most of the arranging of materials at the nest. Osprey nests are typically constructed of sticks, and lined with softer materials such as seaweed, kelp, grasses or cardboard. A wide variety of flotsam and jetsam may also be incorporated into osprey nests, including fishing line, plastic bags and nearly anything else that an osprey might find and can lift. Osprey pairs use the same nest year after year, but must spend some time each year repairing it and adding materials before eggs can be laid.

Once a pair has established a nest, the male begins to deliver food to the female. This feeding continues until the young fledge or the nest fails. Generally, females that receive more food are more receptive to mating attempts by the male, and are less likely to copulate with other males. Females beg for food from their mates, and occasionally from neighboring males if they are not well fed by their mate. Males may protect their paternity by feeding their mate. They may also protect their paternity by guarding their mate from other males and copulating frequently when she is most fertile (several days before egg laying).

Ospreys are generally monogamous. However, polygyny can occur in rare instances where nest sites are close enough together that a male can defend two nests. When this occurs, the first nest usually experiences higher reproductive success than the second because the male devotes more resources to that nest.

Mating System: monogamous ; polygynous

The breeding season of ospreys differs between populations. Non-migratory populations breed in the winter and spring, laying eggs between December and March. The breeding season of migratory populations occurs in the spring and summer, with egg laying in April and May. Two to four eggs are laid over a period of several days, each 1 to 2 days apart. Both the male and female incubate the eggs, which hatch after approximately 40 days. Because incubation starts when the first egg is laid, the eggs hatch asynchronously in the order in which they were laid. Chicks that hatch first are larger and have a competitive advantage over those that are hatch later. If food becomes scarce, the smaller chicks are less successful in competing for food, and often die. This decrease in the number of chicks in the nest makes food more available to the surviving chicks, and increases their likelihood of survival. This process, common in raptors, is called brood reduction.

When osprey chicks hatch, they are covered in white down with brown streaks on the face, back, and wings. This is replaced by charcoal-colored down after approximately 10 days. Feathers begin to replace the down at approximately two weeks. By one month after hatching, chicks have reached 70 to 80% of the adult size. Osprey chicks fledge between 48 and 76 days old. Generally, chicks in migratory populations fledge sooner than those in non-migratory populations. After fledging, young ospreys begin to hunt on their own. However, they often continue to return to the nest to receive food from their parents for two to eight weeks after fledging. Because ospreys migrate individually, juvenile ospreys must be fully independent of their parents by the time the southward migration begins.

Ospreys are sexually mature at approximately 3 years old, but may not breed until age 5 in areas where nest sites are scarce. Migratory ospreys in both Europe and the U.S. exhibit a pattern of behavior that is unusual in raptors. Rather than returning to the breeding grounds in their first summer, yearling ospreys almost always remain on the wintering grounds throughout the year. They then return to the breeding grounds the following summer when they are more likely to be able to breed successfully. This strategy allows young ospreys that are too physically immature to breed to avoid an unnecessary migration.

Breeding interval: Ospreys breed once yearly.

Breeding season: The breeding season lasts for approximately 2.5 to 4 months. Breeding begins between December and March in non-migratory populations. In migratory populations, breeding begins in April or May.

Range eggs per season: 1 to 7.

Average eggs per season: 3.

Range time to hatching: 32 to 43 days.

Range fledging age: 48 to 59 days.

Range time to independence: 7 to 17 weeks.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Average eggs per season: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
1095 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1095 days.

Both male and female ospreys care for their young. Ospreys provide parental care by protecting their young from from predators and weather, and by feeding them. During incubation and the nestling stage, the male osprey provides food to the female and the chicks. This entails delivering 60 to 100 g of fish to the nest per daylight hour (3 to 10 fish per day) during the nestling and fledgling stages. When a fish is delivered to the nest, one of the adults rips pieces of flesh from the fish and feeds them to the chicks. Parents continue to feed the young until two to eight weeks after they fledge.

During the first weeks after hatching, osprey chicks are not able to control their body temperature well. The female parent broods the chicks almost constantly for the first two weeks. She continues to brood them intermittently during very hot or cool weather until they are approximately four weeks old. Both parents expend considerable effort protecting the nest from intruders, including other ospreys and potential predators.

Parental Investment: no parental involvement; altricial ; pre-hatching/birth (Provisioning: Male, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Poole, A. 1989. Ospreys: A Natural and Unnatural History. New York: Cambridge University Press.
  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook. New York: Simon & Shuster Inc..
  • Snyder, N., H. Snyder. 1991. Birds of Prey: Natural History and Conservation of North American Raptors. Stillwater, MN: Voyageur Press, Inc..
  • Poole, A. 1994. Family Pandionidae (Osprey). Pp. 42-50 in J Del Hoyo, A Elliott, J Sargatal, eds. Handbook of the Birds of the World, Vol. 2. Barcelona: Lynx Edicions.
  • Poole, A., R. Bierregaard, M. Martell. 2002. Osprey (Pandion haliaetus). A Poole, F Gill, eds. The Birds of North America, Vol. 683. Philadelphia, PA: The Birds of North America, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nesting phenology varies throughout the range. For example, in Florida, eggs are laid from late November to early March, with a peak from December to mid-January. In the Chesapeake Bay region, ospreys first arrive at nests early to mid-March, lay eggs from late March to mid-May, with a peak in April. In southern New England, ospreys arrive beginning in mid- to late March, and eggs are laid between early April to early June, with a peak in mid- to late April. In east-central Labrador, ospreys arrive around early May, and eggs are laid from mid-May to mid-June.In southeastern British Columbia, ospreys arrive in mid- to late April, with egg laying from early May (peak) to late May.

Clutch size is 1-4 (most often 3). Incubation, usually mainly by the female (male provides food), lasts 5-6 weeks. Young fledge in around 50-60 days and thereafter are dependent on their parents for up to several additional weeks. Individuals first breed usually at 3 years, sometimes at 4-5 years.

Delays in clutch initiation, such as caused when Canada geese occupy nest sites, may cause a reduction in reproductive output (Steeger and Ydenberg, 1993, Can. J. Zool. 71:2141-2146). Number of young fledged increases with increased abundance of food resources. Large numbers may nest in a relatively small area when food resources are adequate and nesting sites are plentiful.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding in the Himalayas or other parts of the Indian Union not seen.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Some ospreys live in the same place all year. These ospreys are called “residents” or “sedentary.” Resident ospreys usually start breeding between December and March. Other ospreys migrate between their breeding grounds and wintering grounds. These ospreys breed in areas where it is too cold to spend the winter. Migratory ospreys breed later during the year than residents. They start breeding in April or May.

In migratory osprey populations, the male usually arrives at the nest site a few days before the female. When the male has chosen a nest site, he often performs a flashy aerial flight display near the nest site. Males probably perform this display to attract females and to scare off other males. The male and female build the nest together, using sticks for the outside and softer materials like seaweed, kelp, grasses or cardboard for the lining. They often also include trash that they find laying around, including fishing line, plastic bags and soda cans and bottles. Osprey pairs use the same nest year after year, so returning pairs do not need to build a nest. However, each spring they must spend some time repairing their nest and adding materials before they can lay eggs.

Once a pair has built their nest, the male begins to deliver fish to the female. The male brings food to the female so that she will mate with him. The male continues to hunt all of the fish for the female and the chicks until the chicks have fledged. Once the chicks start flying, the female begins hunting too.

Ospreys are normally monogamous. One male mates with one female, and mating pairs stay together until one of them dies. However, males occasionally have more than one mate. This is called polygyny. When this happens, it is usually in areas where nests are very close together, so that the male can defend and bring food to both nests.

Mating System: monogamous ; polygynous

Ospreys are able to breed when they are three years old. However, in areas where there are not enough nest sites, ospreys may not breed until they are five years old. Once they have begun breeding, ospreys breed once per year.

Non-migratory ospreys breed in the winter and spring and lay their eggs between December and March. Migratory ospreys breed in the spring and summer and lay their eggs in April and May. The female lays one egg every day or every other day until she has laid two to four eggs. The male and female both incubate the eggs, which hatch after about 40 days. Because the eggs are laid one or two days apart, they also hatch one or two days apart. Chicks that hatch first are bigger than the other chicks and are usually dominant over the smaller chicks. If the parents cannot provide enough food for all of the chicks in the nest, the smallest chicks do not get enough food and sometimes die. This is called brood reduction.

When osprey chicks hatch, they are covered in white down with brown streaks on the face, back, and wings. When the chicks are 10 days old, the white down is replaced by charcoal-colored down. Chicks begin to grow feathers when they are two weeks old. Osprey chicks begin to fly when they are 48 to 76 days old. Once they can fly, osprey chicks begin to hunt for themselves, though they usually also take food from their parents until they can catch enough fish to feed themselves.

Breeding interval: Ospreys breed once yearly.

Breeding season: The breeding season lasts for approximately 2.5 to 4 months. Breeding begins between December and March in non-migratory populations. In migratory populations, breeding begins in April or May.

Range eggs per season: 1 to 7.

Average eggs per season: 3.

Range time to hatching: 32 to 43 days.

Range fledging age: 48 to 59 days.

Range time to independence: 7 to 17 weeks.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Average eggs per season: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
1095 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1095 days.

Male and female ospreys both care for their young. They feed the chicks and protect them from predators and cool, wet weather. The male provides all of the fish for the chicks before they can fly. This means that males have to catch up 10 fish each day for the female and the chicks. The parents tear the fish into small pieces for the chicks to eat. Osprey parents hunt fish for their chicks until the chicks can hunt enough fish to feed themselves. Chicks can usually feed themselves two to eight weeks after they begin flying.

During the first few weeks after hatching, osprey chicks cannot control their body temperature very well. The female parent broods the chicks frequently for the first two weeks and during very hot or cool weather until they are about four weeks old. Both parents spend a lot of time protecting the nest from other ospreys and potential predators.

Parental Investment: no parental involvement; altricial ; pre-hatching/birth (Provisioning: Male, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Poole, A. 1989. Ospreys: A Natural and Unnatural History. New York: Cambridge University Press.
  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook. New York: Simon & Shuster Inc..
  • Snyder, N., H. Snyder. 1991. Birds of Prey: Natural History and Conservation of North American Raptors. Stillwater, MN: Voyageur Press, Inc..
  • Poole, A. 1994. Family Pandionidae (Osprey). Pp. 42-50 in J Del Hoyo, A Elliott, J Sargatal, eds. Handbook of the Birds of the World, Vol. 2. Barcelona: Lynx Edicions.
  • Poole, A., R. Bierregaard, M. Martell. 2002. Osprey (Pandion haliaetus). A Poole, F Gill, eds. The Birds of North America, Vol. 683. Philadelphia, PA: The Birds of North America, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The breeding season of ospreys differs between populations. Non-migratory populations breed in the winter and spring, laying eggs between December and March. The breeding season of migratory populations occurs in the spring and summer, with egg laying in April and May. Two to four eggs are laid over a period of several days, each 1 to 2 days apart. Both the male and female incubate the eggs, which hatch after approximately 40 days. Because incubation starts when the first egg is laid, the eggs hatch asynchronously in the order in which they were laid. Chicks that hatch first are larger and have a competitive advantage over those that are hatch later. If food becomes scarce, the smaller chicks are less successful in competing for food, and often die.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pandion haliaetus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTATTCTCAACCAACCACAAAGACATTGGCACACTATACCTAATCTTCGGCGCCTGAGCCGGCATAGTTGGCACTGCCCTTAGCCTACTCATCCGTGCAGAACTAGGCCAACCTGGCACTCTACTAGGCGAC---GACCAAATCTACAATGTAGTCGTCACAGCCCATGCATTCGTAATAATCTTCTTCATAGTCATACCAATCATAATCGGAGGCTTCGGTAACTGACTTGTCCCGCTCATAATCGGCGCCCCAGACATAGCCTTCCCACGTATAAACAACATAAGCTTCTGACTATTACCTCCATCCCTACTACTCCTACTAGCCTCCTCAACAGTAGAAGCAGGAGCTGGCACAGGGTGAACAGTATATCCACCACTAGCCAGCAACATAGCCCACGCCGGAGCCTCAGTAGACCTAGCCATCTTCTCCCTCCACCTAGCCGGTGTATCATCTATCCTAGGTGCAATCAACTTCATCACAACTGCTATTAACATAAAACCCCCAACCCTCTCACAATACCAAACCCCCCTATTCGTATGATCCGTACTTATCACTGCTGTATTACTACTACTCTCACTTCCAGTTCTCGCTGCTGGTATTACAATACTCTTAACTGACCGAAACCTCAACACCACATTCTTTGACCCAGCTGGAGGAGGTGACCCTATCCTATACCAACACCTCTTCTGATTTTTCGGACACCCAGAAGTGTACATCCTAATTTTACCAGGCTTCGGAATTATCTCCCACGTAGTAACATACTACTCAAGCAAAAAAGAACCATTCGGCTATATAGGTATAGTATGAGCCATACTATCAATCGGATTCCTAGGTTTCATTGTATGAGCCCACCACATATTTACAGTTGGGATAGACGTAGACACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pandion haliaetus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Ospreys are not listed under the Endangered Species Act. However, this species is listed as threatened, endangered or a species of special concern in several U.S. states, including Michigan. Ospreys are also protected under the U.S. Migratory Bird Act and CITES Appendix II. They are not listed on the IUCN Red List.

In the late 19th and early 20th centuries, the main threats to osprey populations were egg collectors and shootings. These declined by the mid-twentieth century, though some shootings still occur. With the introduction and widespread use of the pesticide DDT (dichloro-diphenyl-trichloroethane), osprey populations in many areas declined sharply from the 1950’s through the 1970’s. During this period, 90% of breeding pairs disappeared from the Atlantic coast between New York City and Boston. DDT was banned in the U.S. around 1970, but continues to be used in some countries that serve as wintering grounds for ospreys. Populations of ospreys largely rebounded after the banning of DDT and are now reaching historic levels. Installation of artificial nest structures, hacking projects and new habitat created by reservoirs have allowed osprey populations to increase and expand their range.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: threatened

IUCN Red List of Threatened Species: least concern

  • LaPierre, Y. 1991. Divided over voyageurs. National Parks, 70: 36-40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over 10 years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in 10 years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N4N : N5B: Secure - Breeding, N4N: Apparently Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Very large range; increasing population trend in many areas where formerly depleted by effects of pesticides; benefiting from active management in many areas; pesticide-related problems still exist in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Red List Category & Criteria: Least Concern (ver 3.1) Year Published: 2009 Assessor/s: BirdLife International Reviewer/s: Bird, J., Butchart, S."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ospreys are not listed under the Endangered Species Act. However, this species is listed as threatened, endangered or a species of special concern in several U.S. states, including Michigan. Ospreys are also protected under the U.S. Migratory Bird Act and CITES Appendix II. They are not listed on the IUCN Red List.

In the late 19th and early 20th centuries, the main threats to osprey populations were egg collectors and shootings. Shooting an egg-collection became less common by about 1950, though ospreys are still shot occasionally. Osprey populations in many areas were accidentally poisoned by the pesticide DDT (dichloro-diphenyl-trichloroethane), and many populations shrunk from the 1950’s through the 1970’s. DDT was banned in the U.S. around 1970, but is still used in some countries where ospreys spend the winter. Populations of ospreys grew again after DDT was banned. Ospreys are now almost as abundant as they have ever been. Ospreys have been helped by people constructing artificial nest structures for them, hacking projects and new habitat that has been created by man-made reservoirs.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

State of Michigan List: threatened

  • LaPierre, Y. 1991. Divided over voyageurs. National Parks, 70: 36-40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The National Audubon Society publishes periodic Blue Lists that
indentify population problems in bird species. As of 1982, three
categories were reported: Blue-listed species--those with populations
that are clearly declining; Species of Special Concern--previously
blue-listed species with populations that may be recovering; and Species
of Local Concern--species with presumed population declines that are
unconfirmed or of a local nature. The osprey was blue-listed from 1972
to 1981, of Special Concern in 1982, and of local concern throughout its
range in 1986 [34]. It is state-listed as threatened in South Dakota
[33] and Washington [35], and is currently listed as a sensitive species
in Region 3 by the U.S. Froest Service [8].
  • 8. Finch, Deborah M. 1992. Threatened, endangered, and vulnerable species of terrestrial vertebrates in the Rocky Mountain Region. Gen. Tech. Rep. RM-215. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 38 p. [18440]
  • 33. South Dakota Department of Game, Fish and Parks. 1994. Fragile legacy: Endangered, threatened and rare animals of South Dakota. Pierre, SD: South Dakota Department of Game, Fish, and Parks, Wildlife Division. 55 p. [24341]
  • 34. France, R.; Sharp, M. 1992. First record of the rough-legged hawk, Buteo lagopus, from Ellesmere Island, Northwest Territories. Canadian Field-Naturalist. 106(4): 511-512. [23425]
  • 35. Washington Department of Wildlife. 1994. Species of special concern in Washington - state and federal status. Olympia, WA: Washington Department of Wildlife. 41 p. [25414]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Resident breeder.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: Population increases and range expansions have been documented for many areas in the United States (Henny and Anthony 1989). These increases are believed to be due, at least in part, to reduced use of pesticides that apparently caused population declines in the 1960s and 1970s. Osprey populations now appear to be reoccupying their historical habitat and, in some areas, have expanded their range to include habitats around new reservoirs. Some other areas have experienced local declines where nesting habitat has been lost or fish populations have declined (Henny and Anthony 1989). A significant increase was recorded in migration counts in northeastern North America, 1972-1987 (Titus and Fuller 1990). See Henny (1986) for regional status in North America; Vahle et al. (1988) for status in the southwestern U.S. Increased in Canada in the 1980s and early 1990s (Kirk et al. 1995, Ewins 1995). Increasing in Utah (Monson 1996, Great Basin Naturalist 56:150-156).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Unset
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Human persecution was the main historical threat, prevalent from the 18th-20th centuries (Ferguson-Lees and Christie 2001). A combination of deforestation and the collection of eggs and live birds drove the species extinct in Azerbaijan (del Hoyo et al. 1994). In the U.S.A. (and to a lesser extent elsewhere), numbers fell significantly from 1950-1970 as a result of pesticide use, although they are now recovering, as they are in Scotland where the species had been extirpated by collection and hunting (del Hoyo et al. 1994, Ferguson-Lees and Christie 2001). Pesticide use has now been reduced to a minor threat, but shooting still affects many birds on migration in the Mediterranean, notably in Malta. A few Australian birds are apparently impacted by local human disturbance (del Hoyo et al. 1994). It is very highly vulnerable to the effects of potential wind energy development (Strix 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Now recovering in many areas following severe declines resulting from organochlorine biocide use. A primary threat is the continued use of organochlorines in Central and South America (Henny and Anthony 1989, Evans 1982). Also, organochlorines and other contaminants still are contributing to eggshell thinning and low hatching success in populations nesting around Delaware Bay (Steidl et al. 1991). Other human-related causes of death in the eastern United States include included gunshots, steel traps, impact with or electrocution by high-tension wires, and being caught or drowned in nets (Wiemeyer et al. 1980, cited in Henny and Anthony 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Ospreys were widely persecuted by humans between the 18th to mid 20th centuries, particularly in Europe. From the 1950's onwards, the major threat to this species is from over-use of organochloride pesticides, especially in North America, that cause thinning of egg shells of ospreys"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Legislation

"CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) India Listed Species:Yes. Appendix:II, III. CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) Global Listed Species:Yes. Appendix:II, III. AEWA (Agreement on the Conservation of African-Eurasian Migratory Waterbirds) Listed Species:Yes. Appendix:II. IWPA (Indian Wildlife Protection Act, 1972) Listed Species:Yes. IWPA (Indian Wildlife Protection Act, 1972) Schedule:I."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: Management mainly involves erection of nesting platforms, creation of osprey management areas, and/or reintroduction via hacking (reviewed in Henny 1986); also protection of nesting sites in areas subject to logging (see Palmer 1988). See Vahle et al. (1988) and Lefranc and Glinski (1988) for information on research and management needs in the southwestern U.S. See Martin et al. (1986) for specifications for the construction and placement of nesting platforms.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

In the 1960's osprey populations declined as a result of DDT which were
washed into water courses and ingested by fish. These DDT residues
affected the estrogen hormone which controls calcium and egg shell
thickness, resulting in thinner shells and broken eggs [4,26].
Following tight restrictions on the use of DDT, pesticide residues
declined, and North American osprey populations increased consistently
between 1968 and 1981. Ospreys are still vulnerable to contamination
during migration in Central and South America, where DDT continues to be
used to control mosquitos which carry malaria parasites [26].

Some bird species have been observed forming protective nesting
associations with ospreys by building their nests in the sides or
bottoms of the stick nests of ospreys. These include house wrens
(Troglodytes aedon), house sparrows (Passer domesticus), European
starlings (Sturnus vulgaris), common grackles (Quiscalus quiscula),
night-herons (Nycticorax spp.), swallows (Hirundinidae), and jays
(Corvidae) [26].

Artificial nest sites are successfully used by ospreys. One study
showed that the overall breeding success improved from 45.9 percent in
natural trees to 62.9 percent in man-made platforms [12].

Human disturbance during the critical periods of incubation and early
nesting stages can be fatal to embryos and nestlings if adults are kept
from their nests. Until an osprey pair becomes habituated to human
activities, human disturbance will jeopardize their nesting success
[29].

REFERENCES :
NO-ENTRY
  • 4. Cadman, Michael D.; Eagles, Paul F. J.; Helleiner, Frederick M. 1987. Atlas of the breeding birds of Ontario. University of Waterloo Press. 617 p. [20129]
  • 12. Houston, C. Stuart; Scott, Frank. 1992. The effect of man-made platforms on osprey reproduction at Loon Lake, Saskatchewan. Journal of Raptor Research. 26(3): 152-158. [20131]
  • 26. Ryser, Fred A. 1985. Birds of the Great Basin. Reno, NV: University of Nevada Press. 604 p. [20135]
  • 29. Van Daele, Lawrence J.; Van Daele, Hilary A. 1982. Factors affecting the productivity of ospreys nesting in west-central Idaho. Condor. 84: 292-299. [15143]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known negative impacts of ospreys on humans. In the past, some fishermen have believed that ospreys competed with them for fish. However, studies have demonstrated that ospreys take a very small portion of all fish harvested and are not serious competition for commercial and recreational fishing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ospreys may be a valuable indicator species for monitoring the long-term health of large rivers, bays and estuaries. Ospreys are well-suited to this role because of their piscivorous lifestyle and their known sensitivity to many contaminants. They are also relatively easily studied because they have conspicuous nests and are tolerant of short-term disturbance such as nest observations by researchers. The presence of ospreys may also benefit local economies by boosting ecotourism.

Positive Impacts: ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known negative impacts of ospreys on humans. In the past, some fishermen have believed that ospreys competed with them for fish. However, studies have shown that ospreys take a much smaller amount of fish than the fishermen, and do not compete with fishermen for fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Ospreys help attract ecotourism to areas. They may also be a valuable indicator species for monitoring the health of large rivers, bays and estuaries. If water is polluted, the pollutants will be found in the fish that the ospreys eat. Since ospreys are sensitive to many of these pollutants, the health of the ospreys can tell us about the health of the aquatic ecosystem where they live.

Positive Impacts: ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Osprey

For other uses, see Osprey (disambiguation).
"Fish hawk" redirects here. For other meanings of the term, see Fish Hawk.

The osprey (Pandion haliaetus), sometimes known as the sea hawk, fish eagle, river hawk or fish hawk, is a diurnal, fish-eating bird of prey. It is a large raptor, reaching more than 60 cm (24 in) in length and 180 cm (71 in) across the wings. It is brown on the upperparts and predominantly greyish on the head and underparts.

The osprey tolerates a wide variety of habitats, nesting in any location near a body of water providing an adequate food supply. It is found on all continents except Antarctica, although in South America it occurs only as a non-breeding migrant.

As its other common name suggests, the osprey's diet consists almost exclusively of fish. It possesses specialised physical characteristics and exhibits unique behaviour to assist in hunting and catching prey. As a result of these unique characteristics, it has been given its own taxonomic genus, Pandion and family, Pandionidae. Four subspecies are usually recognized, one of which has recently been given full species status (see below). Despite its propensity to nest near water, the osprey is not classed as a sea-eagle.

Taxonomy and systematics[edit]

The osprey was one of the many species described by Carolus Linnaeus in his 18th-century work, Systema Naturae, and named as Falco haliaeetus.[2] The genus, Pandion, is the sole member of the family of Pandionidae, and used to contain only one species, the osprey (P. haliaetus). The genus Pandion was described by the French zoologist Marie Jules César Savigny in 1809, and is taken from a mythical Greek king, Pandion.[3][4][5]

The osprey differs in several respects from other diurnal birds of prey. Its toes are of equal length, its tarsi are reticulate, and its talons are rounded, rather than grooved. The osprey and owls are the only raptors whose outer toe is reversible, allowing them to grasp their prey with two toes in front and two behind. This is particularly helpful when they grab slippery fish.[6] It has always presented something of a riddle to taxonomists, but here it is treated as the sole living member of the family Pandionidae, and the family listed in its traditional place as part of the order Falconiformes. Other schemes place it alongside the hawks and eagles in the family Accipitridae—which itself can be regarded as making up the bulk of the order Accipitriformes or else be lumped with the Falconidae into Falconiformes. The Sibley-Ahlquist taxonomy has placed it together with the other diurnal raptors in a greatly enlarged Ciconiiformes, but this results in an unnatural paraphyletic classification.[7]

Classification[edit]

American subspecies
The Australasian subspecies is the most distinctive
Californian bird with small portions of fish offal on its beak

The osprey is unusual in that it is a single living species that occurs nearly worldwide. Even the few subspecies are not unequivocally separable. There are four generally recognised subspecies, although differences are small, and ITIS only lists the first two.[3]

Recently, P. h. cristatus has been given full species status[10] as eastern osprey.

Fossil record[edit]

To date there have been two extinct species named from the fossil record.[11] Pandion homalopteron was named by Stuart L. Warter in 1976 from fossils of Middle Miocene, Barstovian age, found in marine deposits in the southern part of the U.S. state of California. The second named species Pandion lovensis, was described in 1985 by Jonathan J. Becker from fossils found in the U.S. state of Florida and dating to the latest Clarendonian and possibly representing a separate lineage from that of P. homalopteron and P. haliaetus. A number of claw fossils have been recovered from Pliocene and Pleistocene sediments in Florida and South Carolina, USA. The oldest recognized Pandionidae family fossils have been recovered from the Oligocene age Jebel Qatrani Formation, of Faiyum, Egypt. However they are not complete enough to assign to a specific genus.[12] Another Pandionidae claw fossil was recovered from Early Oligocene deposits in the Mainz basin, Germany, and was described in 2006 by Gerald Mayr.[13]

Etymology[edit]

The genus name Pandion is after the mythical Greek king Pandion of Athens and grandfather of Theseus, who was transformed into an eagle.[14] The specific epithet haliaetus is derived from the Greek ἁλιάετος "sea eagle/osprey".[15]

The origins of osprey are obscure;[16] the word itself was first recorded around 1460, derived via the Anglo-French ospriet and the Medieval Latin avis prede "bird of prey," from the Latin avis praedæ though the Oxford English Dictionary notes a connection with the Latin ossifraga or "bone breaker" of Pliny the Elder.[17][18] However, this term referred to the Lammergeier.[19]

Description[edit]


Problems playing this file? See media help.

The osprey is 0.9–2.1 kg (2.0–4.6 lb) in weight and 50–66 cm (20–26 in) in length with a 127–180 cm (50–71 in) wingspan. The subspecies are fairly close in size, with the nominate subspecies averaging 1.53 kg (3.4 lb), P. h. carolinensis averaging 1.7 kg (3.7 lb) and P. h. cristatus averaging 1.25 kg (2.8 lb). The wing chord measures 38 to 52 cm (15 to 20 in), the tail measures 16.5 to 24 cm (6.5 to 9.4 in) and the tarsus is 5.2–6.6 cm (2.0–2.6 in).[20][21] The upperparts are a deep, glossy brown, while the breast is white and sometimes streaked with brown, and the underparts are pure white. The head is white with a dark mask across the eyes, reaching to the sides of the neck.[22] The irises of the eyes are golden to brown, and the transparent nictitating membrane is pale blue. The bill is black, with a blue cere, and the feet are white with black talons.[6] A short tail and long, narrow wings with four long, finger-like feathers, and a shorter fifth, give it a very distinctive appearance.[23]

In flight, over Lake Wylie, South Carolina

The sexes appear fairly similar, but the adult male can be distinguished from the female by its slimmer body and narrower wings. The breast band of the male is also weaker than that of the female, or is non-existent, and the underwing coverts of the male are more uniformly pale. It is straightforward to determine the sex in a breeding pair, but harder with individual birds.[23]

The juvenile osprey may be identified by buff fringes to the plumage of the upperparts, a buff tone to the underparts, and streaked feathers on the head. During spring, barring on the underwings and flight feathers is a better indicator of a young bird, due to wear on the upperparts.[22]

In flight, the osprey has arched wings and drooping "hands", giving it a gull-like appearance. The call is a series of sharp whistles, described as cheep, cheep or yewk, yewk. If disturbed by activity near the nest, the call is a frenzied cheereek![24] About this sound Osprey call 

Distribution and habitat[edit]

The osprey is the second most widely distributed raptor species, after the peregrine falcon. It has a worldwide distribution and is found in temperate and tropical regions of all continents except Antarctica. In North America it breeds from Alaska and Newfoundland south to the Gulf Coast and Florida, wintering further south from the southern United States through to Argentina.[25] It is found in summer throughout Europe north into Ireland, Scandinavia, Finland and Scotland, England, and Wales though not Iceland, and winters in North Africa.[26] In Australia it is mainly sedentary and found patchily around the coastline, though it is a non-breeding visitor to eastern Victoria and Tasmania.[27] There is a 1,000 km (620 mi) gap, corresponding with the coast of the Nullarbor Plain, between its westernmost breeding site in South Australia and the nearest breeding sites to the west in Western Australia.[28] In the islands of the Pacific it is found in the Bismarck Islands, Solomon Islands and New Caledonia, and fossil remains of adults and juveniles have been found in Tonga, where it probably was wiped out by arriving humans.[29] It is possible it may once have ranged across Vanuatu and Fiji as well. It is an uncommon to fairly common winter visitor to all parts of South Asia,[30] and Southeast Asia from Myanmar through to Indochina and southern China, Indonesia, Malaysia and the Philippines.[31]

Behaviour and ecology[edit]

Diet[edit]

Eating a fish

Fish make up 99% of the osprey's diet.[32] It typically takes fish weighing 150–300 g (5.3–10.6 oz) and about 25–35 cm (9.8–13.8 in) in length, but the weight can range from 50 grams (1.8 oz) to 2 kg (4.4 lb). Virtually any type of fish in that size range are taken.

Ospreys have vision that is well adapted to detecting underwater objects from the air. Prey is first sighted when the osprey is 10–40 m (33–131 ft) above the water, after which the bird hovers momentarily then plunges feet first into the water.[33]

The osprey is particularly well adapted to this diet, with reversible outer toes, sharp spicules on the underside of the toes,[34] closable nostrils to keep out water during dives, and backwards-facing scales on the talons which act as barbs to help hold its catch.

Occasionally, the osprey may prey on rodents, rabbits, hares, amphibians, other birds,[35] and small reptiles.[36]

Reproduction[edit]

Preparing to mate on the nest
Osprey sitting next to its nest

The osprey breeds near freshwater lakes and rivers, and sometimes on coastal brackish waters. Rocky outcrops just offshore are used in Rottnest Island off the coast of Western Australia, where there are 14 or so similar nesting sites of which five to seven are used in any one year. Many are renovated each season, and some have been used for 70 years. The nest is a large heap of sticks, driftwood and seaweed built in forks of trees, rocky outcrops, utility poles, artificial platforms or offshore islets.[32][37] Generally, ospreys reach sexual maturity and begin breeding around the age of three to four, though in some regions with high osprey densities, such as Chesapeake Bay in the U.S., they may not start breeding until five to seven years old, and there may be a shortage of suitable tall structures. If there are no nesting sites available, young ospreys may be forced to delay breeding. To ease this problem, posts are sometimes erected to provide more sites suitable for nest building.[38]


The platform design developed by one organization, Citizens United to Protect the Maurice River and Its Tributaries, Inc. has become the official design of the State of New Jersey, U.S.A. The platform plans and materials list, available online, have been utilized by people from a number of different geographical regions.[39] Osprey-watch.org is the global site for mapping osprey nest locations and logging observations on reproductive success.[40]

Ospreys usually mate for life. Rarely, polyandry has been recorded.[41] The breeding season varies according to latitude; spring (September–October) in southern Australia, April to July in northern Australia and winter (June–August) in southern Queensland.[37] In spring the pair begins a five-month period of partnership to raise their young. The female lays two to four eggs within a month, and relies on the size of the nest to conserve heat. The eggs are whitish with bold splotches of reddish-brown and are about 6.2 cm × 4.5 cm (2.4 in × 1.8 in) and weigh about 65 g (2.3 oz).[37] The eggs are incubated for about 5 weeks to hatching.

The newly hatched chicks weigh only 50–60 g (1.8–2.1 oz), but fledge in 8–10 weeks. A study on Kangaroo Island, South Australia, had an average time between hatching and fledging of 69 days. The same study found an average of 0.66 young fledged per year per occupied territory, and 0.92 young fledged per year per active nest. Some 22% of surviving young either remained on the island, or returned at maturity to join the breeding population.[41] When food is scarce, the first chicks to hatch are most likely to survive. The typical lifespan is 7–10 years, though rarely individuals can grow to as old as 20–25 years. The oldest European wild osprey on record lived to be over thirty years of age. In North America, great horned owls, golden eagles, and bald eagles are the only major predators of ospreys, capable of taking both nestlings and adults.[36][42][43][44][45] However, kleptoparasitism by bald eagles, where the larger raptor steals the osprey's catch, is more common than predation. The white-tailed eagle, which is very similar to the bald eagle, may harass or predate the osprey in Eurasia.[46] Raccoons can be a serious threat to nestlings or eggs if they can access the nest.[47] Nile crocodiles have been observed to grab ospreys while they hunt.[48] Endoparasitic trematodes (Scaphanocephalus expansus and Neodiplostomum spp.) have been recorded in wild ospreys.[49]

Migration[edit]

European breeders winter in Africa.[50] American and Canadian breeders winter in South America, although some stay in the southernmost U.S. states such as Florida and California.[51] Some ospreys from Florida migrate to South America.[52] Australasian ospreys tend not to migrate.

Studies of Swedish ospreys showed that females tend to migrate to Africa earlier than the males. More stopovers are made during their autumn migration. The variation of timing and duration in autumn was more variable than in spring. Although migrating predominantly in the day, they sometimes fly in the dark hours particularly in crossings over water and cover on average 260–280 km (160–170 mi) per day with a maximum of 431 km (268 mi) per day.[53] European birds may also winter in South Asia, an osprey ringed in Norway has been recovered in western India.[54]

Status and conservation[edit]

A juvenile on a man-made nest

The osprey has a large range, covering 9,670,000 square kilometres (3,730,000 sq mi) in just Africa and the Americas, and has a large global population estimated at 460,000 individuals. Although global population trends have not been quantified, the species is not believed to approach the thresholds for the population decline criterion of the IUCN Red List (i.e., declining more than 30% in ten years or three generations), and for these reasons, the species is evaluated as Least Concern.[1] There is evidence for regional decline in South Australia where former territories at locations in the Spencer Gulf and along the lower Murray River have been vacant for decades.[28]

In the late 19th and early 20th centuries, the main threats to osprey populations were egg collectors and hunting of the adults along with other birds of prey,[36][55] but osprey populations declined drastically in many areas in the 1950s and 1960s; this appeared to be in part due to the toxic effects of insecticides such as DDT on reproduction.[56] The pesticide interfered with the bird's calcium metabolism which resulted in thin-shelled, easily broken or infertile eggs.[25] Possibly because of the banning of DDT in many countries in the early 1970s, together with reduced persecution, the osprey, as well as other affected bird of prey species, have made significant recoveries.[32] In South Australia, nesting sites on the Eyre Peninsula and Kangaroo Island are vulnerable to unmanaged coastal recreation and encroaching urban development.[28]

The osprey is the provincial bird of both Nova Scotia, Canada and Södermanland, Sweden.

Cultural depictions[edit]

Nisos, a king of Megara in Greek mythology, became a sea eagle or osprey, to attack his daughter after she fell in love with Minos, king of Crete.[57]

The Roman writer Pliny the Elder reported that parent ospreys made their young fly up to the sun as a test, and dispatch any that failed.[58]

Another odd legend regarding this fish-eating bird of prey, derived from the writings of Albertus Magnus and recorded in Holinshed's Chronicles, was that it had one webbed foot and one taloned foot.[55][59]

There was a medieval belief that fish were so mesmerised by the osprey that they turned belly-up in surrender,[55] and this is referenced by Shakespeare in Act 4 Scene 5 of Coriolanus:

I think he'll be to Rome
As is the osprey to the fish, who takes it
By sovereignty of nature.

In Buddhism, the osprey is sometimes represented as the "King of Birds", especially in the 'The Jātaka: Or, Stories of the Buddha’s Former Births' , no.486.

The Irish poet William Butler Yeats used a grey wandering osprey as a representation of sorrow in The Wanderings of Oisin and Other Poems (1889).[58]

The osprey is depicted as a white eagle in heraldry,[59] and more recently has become a symbol of positive responses to nature,[55] and has been featured on more than 50 international postage stamps.[60]

In 1994, the osprey was declared the provincial bird of Nova Scotia, Canada.[61]

The osprey is used as a brand name for various products and sports teams. Examples include: the Ospreys (a Welsh, Rugby team, of the European country of Wales); the Geraldton skiing team (in Western Australia); the Richard Stockton College Osprey, a Division III NCAA intercollegiate athletics team, and the first college in the nation (and the only one for many years) to adopt the osprey as its mascot and athletic team name, North Florida Ospreys (a NCAA Division II intercollegiate athletics team), the Missoula Osprey (a minor league baseball team); the Seattle Seahawks (an American football team of the National Conference); the Wagner Seahawks (a NCAA Division I intercollegiate athletics team); and the Cold Spring Harbor Seahawks (a High school football team in Cold Spring Harbor, New York[62]).

Examples of the osprey used as a mascot include: Ozzie Osprey (of the University of North Florida); Talon the Osprey of Richard Stockton College; Sammy the Seahawk (of University of North Carolina Wilmington); the Wells International Seahawks (of Bangkok, Thailand); the Salve Regina Seahawks (of Newport, Rhode Island); and the LA Harbor College Seahawks (of South Bay).[63][64]

References[edit]

  1. ^ a b BirdLife International (2013). "Pandion haliaetus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ (Latin) Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). p. 91. "F. cera pedibusque caeruleis, corpore supra fusco subtus albo, capite albido" 
  3. ^ a b "Pandion haliaetus ". Integrated Taxonomic Information System. Retrieved 5 September 2007. 
  4. ^ Graves, R (1955). "The Sons of Pandion." Greek Myths. London: Penguin. pp. 320–323. ISBN 0-14-001026-2.
  5. ^ All about Ospreys, From desk of Thisbe Nissen
  6. ^ a b Terres, J. K. (1980). The Audubon Society Encyclopedia of North American Birds. New York, NY: Knopf. pp. 644–646. ISBN 0-394-46651-9. 
  7. ^ Salzman, Eric (1993). "Sibley's Classification of Birds". Birding 58 (2): 91–98. doi:10.2307/2911426. JSTOR 2911426. Retrieved 5 September 2007. 
  8. ^ a b c d Tesky, Julie L. (1993). "Pandion haliaetus ". U.S. Department of Agriculture, Forest Service. Retrieved 6 September 2007. 
  9. ^ Barrow, M. V. (1998). A passion for Birds: American ornithology after Audubon. Princeton, NJ: Princeton University Press. ISBN 0-691-04402-3. 
  10. ^ Christidis, L. and Boles, W.E. (2008) Systematics and Taxonomy of Australian Birds, Csiro Publishing, ISBN 0643065113.
  11. ^ Avibase Pandion entry Accessed on 2 December 2010
  12. ^ Olson, S. L. (1985). Avian Biology Vol. 8 (Chapter 2. The fossil record of birds). Academic Press. pp. 79–238. doi:10.1016/B978-0-12-249408-6.50011-X. 
  13. ^ Mayr, G. (2006). "An osprey (Aves: Accipitridae: Pandioninae) from the early Oligocene of Germany". Palaeobiodiversity and Palaeoenvironments 86 (1): 93–96. doi:10.1007/BF03043637. 
  14. ^ Graves, R (1955). "The Sons of Pandion". Greek Myths. London: Penguin. pp. 320–323. ISBN 0-14-001026-2. 
  15. ^ LSJ, s.v. ἁλιάετος
  16. ^ Livingston, CH (1943). "Osprey and Ostril". Modern Language Notes 58 (2): 91–98. doi:10.2307/2911426. JSTOR 2911426. 
  17. ^ Morris, W (1969). The American Heritage Dictionary of the English Language. Boston: American Heritage Publishing Co., Inc. and Houghton Mifflin Company. 
  18. ^ "Osprey". Online Etymology Dictionary. Retrieved 29 June 2007. 
  19. ^ J. Simpson, E. Weiner (eds), ed. (1989). "Osprey". Oxford English Dictionary (2nd ed.). Oxford: Clarendon Press. ISBN 0-19-861186-2. 
  20. ^ Ferguson-Lees, J. and Christie, D. A. 2001) Raptors of the World. Houghton Mifflin Company, ISBN 978-0-618-12762-7
  21. ^ History- Osprey P. h. carolinensis. All About Birds
  22. ^ a b "Osprey". Connecticut Department of Environmental Protection. 1999. Retrieved 30 September 2007. 
  23. ^ a b Forsman, Dick (2008). The Raptors of Europe & the Middle East A Handbook of Field Identification. Princeton University Press. pp. 21–25. ISBN 0-85661-098-4. 
  24. ^ Peterson, Roger Tory (1999). A Field Guide to the Birds. Houghton Mifflin Company. p. 136. ISBN 978-0-395-91176-1. 
  25. ^ a b Bull J, Farrand, J Jr (1987). Audubon Society Field Guide to North American Birds:Eastern Region. New York: Alfred A. Knopf. p. 469. ISBN 0-394-41405-5. 
  26. ^ Hume R (2002). RSPB Birds of Britain and Europe. London: Dorling Kindersley. p. 89. ISBN 0-7513-1234-7. 
  27. ^ Simpson K, Day N, Trusler P (1993). Field Guide to the Birds of Australia. Ringwood, Victoria: Viking O'Neil. p. 66. ISBN 0-670-90478-3. 
  28. ^ a b c Dennis, TE (2007). "Distribution and status of the Osprey (Pandion haliaetus) in South Australia". Emu 107 (4): 294–299. doi:10.1071/MU07009. 
  29. ^ Steadman D (2006). Extinction and Biogeography in Tropical Pacific Birds, University of Chicago Press. ISBN 978-0-226-77142-7
  30. ^ Rasmussen, P. C. and Anderton, J. C. (2005). Birds of South Asia. The Ripley Guide. Vols 1 & 2. Smithsonian Institution and Lynx Edicions. 
  31. ^ Strange M (2000). A Photographic Guide to the Birds of Southeast Asia including the Philippines and Borneo. Singapore: Periplus. p. 70. ISBN 962-593-403-0. 
  32. ^ a b c Evans DL (1982). "Status Reports on Twelve Raptors:Special Scientific Report Wildl. No. 238". U.S. Dept. Interior, Fish and Wildl. Serv. 
  33. ^ Poole, A. F., R. O. Bierregaard, and M. S. Martell. (2002). Osprey (Pandion haliaetus). In The Birds of North America, No. 683 (A. Poole and F. Gill, eds.). The Birds of North America, Inc., Philadelphia, PA.
  34. ^ Clark, W. S. and Wheeler, B. K. (1987). A field guide to Hawks of North America. Houghton Mifflin, Boston. ISBN 0-395-36001-3
  35. ^ Goenka, DN (1985). "The Osprey (Pandion haliaetus haliaetus) preying on a Gull". J. Bombay Nat. Hist. Soc. 82 (1): 193–194. 
  36. ^ a b c Kirschbaum, K.; Watkins P. "Pandion haliaetus". University of Michigan Museum of Zoology. Retrieved 3 January 2008. 
  37. ^ a b c Beruldsen, G (2003). Australian Birds: Their Nests and Eggs. Kenmore Hills, Qld: self. p. 196. ISBN 0-646-42798-9. 
  38. ^ "Osprey". Chesapeake Bay Program. Retrieved 4 April 2013. 
  39. ^ Osprey platform plans. Cumauriceriver.org. Retrieved on 2011-11-23.
  40. ^ Project OspreyWatch. Osprey-watch.org Retrieved on 2013-09-30.
  41. ^ a b Dennis, TE (2007). "Reproductive activity in the Osprey (Pandion haliaetus) on Kangaroo Island, South Australia". Emu 107 (4): 300–307. doi:10.1071/MU07010. 
  42. ^ Flemming, S. P. and Bancroft, R. P. (1990). "Bald Eagle attacks Osprey nestling". J. Raptor Res. 24: 26–27. 
  43. ^ Macdonald, J. and Seymour, N. R. (1994). "Bald Eagle attacks adult Osprey". J. Raptor Res. 28 (2): 122. 
  44. ^ Cold, C. W. (1993). "Adult male Osprey killed at nest by Great Horned Owl". Passenger Pigeon 55: 269–270. 
  45. ^ Lafontaine, AR and Fowler, JH (1976). "Golden Eagle preys on Osprey". Auk 93: 390–391. 
  46. ^ Willgohs, J. F. (1961). The white-tailed eagle Haliaëtus albicilla albicilla (Linné) in Norway. Norwegian Universities Press.
  47. ^ Reese, J. (1969). "A Maryland Osprey population 75 years ago and today". Maryland Birdlife 25: 116–119. 
  48. ^ Prevost, Y. A. (1977). Feeding ecology of Ospreys in Antigonish County, Nova Scotia. Master's Thesis. Macdonald College of McGill University, Montreal, QB.
  49. ^ Hoffman, Glenn L.; Wu, L. Y.; Kingscote, A. A. (1953). "Scaphanocephalus expansus (Crepl.), a Trematode of the Osprey, in North America". The Journal of Parasitology 39 (5): 568. doi:10.2307/3273860. 
  50. ^ Mullarney, Killian; Svensson, Lars, Zetterstrom, Dan; Grant, Peter. (2001). Birds of Europe. Princeton University Press. pp. 74–5 ISBN 0-691-05054-6
  51. ^ "Migration Strategies and Wintering Areas of North American ospreys as Revealed by Satellite Telemetry" (PDF). Newsletter Winter 2000. Microwave Telemetry Inc. Retrieved 2 December 2008. 
  52. ^ Martell, M.S.; Mcmillian, M.A.; Solensky, M.J.; Mealey, B.K. (2004). "Partial migration and wintering use of florida by ospreys". Journal of Raptor Research 38 (1): 55–61.  mirror
  53. ^ Alerstam, T., Hake, M. and Kjellén, N. (2006). "Temporal and spatial patterns of repeated migratory journeys by ospreys". Animal Behaviour 71 (3): 555–566. doi:10.1016/j.anbehav.2005.05.016. 
  54. ^ Mundkur,Taej (1988). "Recovery of a Norwegian ringed Osprey in Gujarat, India". J. Bombay Nat. Hist. Soc. 85 (1): 190. 
  55. ^ a b c d Cocker, Mark; Mabey, Richard (2005). Birds Britannica. London: Chatto & Windus. pp. 136–141. ISBN 0-7011-6907-9. 
  56. ^ Ames, P (1966). "DDT Residues in the eggs of the Osprey in the North-eastern United States and their relation to nesting success". J. Appl. Ecol. (British Ecological Society) 3 ((Suppl.)): 87–97. doi:10.2307/2401447. JSTOR 2401447. 
  57. ^ Ovid, Metamorphoses 8.90
  58. ^ a b de Vries, Ad (1976). Dictionary of Symbols and Imagery. Amsterdam: North-Holland Publishing Company. p. 352. ISBN 0-7204-8021-3. 
  59. ^ a b Cooper, JC (1992). Symbolic and Mythological Animals. London: Aquarian Press. p. 170. ISBN 1-85538-118-4. 
  60. ^ "Osprey". Birds of the World on Postage Stamps. Retrieved 1 January 2008. 
  61. ^ The Osprey. gov.ns.ca
  62. ^ Cold Spring Harbor High School Seahawks
  63. ^ Visual ID at the Wayback Machine (archived November 19, 2007). University of North Florida
  64. ^ "UNCW Facts". Archived from the original on 6 May 2009. Retrieved 16 April 2009. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Previously considered a subfamily of the Accipitridae (AOU 1998), the Osprey is returned to family status because of its genetic and morphological distinctiveness (AOU 2010 and references cited therein).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The currently recognized scientific name for the osprey is Pandion
haliaetus (Linnaeus) [4,24,32]. Four subspecies are recognized. Size and
plumage best separate subspecies, but the differences are not always
clear. This report will primarily deal with the North American
subspecies: Pandion haliaetus ssp. carolinesis (Gmelin). Other
recognized subspecies are [24,32]:

Pandion haliaetus ssp. haliaetus
Pandion haliaetus ssp. ridgwayi
Pandion haliaetus ssp. cristatus
  • 4. Cadman, Michael D.; Eagles, Paul F. J.; Helleiner, Frederick M. 1987. Atlas of the breeding birds of Ontario. University of Waterloo Press. 617 p. [20129]
  • 24. Poole, Alan F. 1989. Ospreys: a natural and unnatural history. Cambridge; New York: Cambridge University Press. 246 p. [20133]
  • 32. Donohoe, Robert W. 1974. American hornbeam Carpinus caroliniana Walt. In: Gill, John D.; Healy, William M., eds. Shrubs and vines for northeastern wildlife. Gen. Tech. Rep. NE-9. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station: 86-88. [13714]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

osprey
fish hawk
fish eagle

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!