Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Brief Summary

Species Abstract

The European White Stork is a stately wading predatory bird, which often nests in proximity to human settlements, and correspondingly, appears richly in human legend throughout recorded history. The population of this species has declined since the year 1900, primarily in Western Europe; this trend is chiefly due to relentless conversion of open land to agricultural uses in Europe, but also relates to surface water supply reduction in the African wintering range. Its migratory patterns reveal a distinct divide, owing to its preference to avoid long sea crossings. C. ciconia is the national bird of Lithuania, and in a number of European cultures is thought to bring harmony to families; the European White Stork is historically associated with the birth of babies in many regions of Europe.

Breeding pair atop their nest near Ķemeri National Park, Latvia. @ C.Michael Hogan

DISTRIBUTION

Ciconia breeds from Western Europe to the western part of Russia, southern Kazakhstan and thence south to Greece, Turkey and Iran. Furthermore it breeds as far southwest as the Iberian Peninsula including both Spain and Portugal, and into northwest Africa, especially Morocco; however, the breeding areas are severely fragmented within those large geographic outlines. Consequently, the largest breeding populations are found in only a small number of countries including, Belarus, Ukraine, Poland, Bulgaria, Spain, Portugal and the Baltic countries. Wintering occurs as far south as sub-Saharan Africa and as far east as eastern China. Its long winter migration can reach as far as South Africa, and occasionally breeding will take place that far south. Birds migrate in irregularly shaped flocks which can be sizable, and sometimes will pause migration when a plague of locusts is occurring in East Africa.

A clear migratory divide exists for this species, which eschews long flights over open seas, (Perrins, Lebreton and Hirons) partly due to its reliance on atmospheric thermals, which occur over land. Thus the principal migration routes include either the Straits of Gibraltar or the Bosphorus, noting that some birds choose to winter in southern Europe as well.

MORPHOLOGY

C. circonia can attain a length of 115 centimetres and a body mass of three to four kilograms. (Perrins, Attenborough and Arlot) Wingspan can be as great as 1.65 metres. Legs and long powerful sharply pointed bill are bright salmon-red in colour, with mostly white feathers, save for the jet-black scapulars, greater wing-coverts and quills. (Sharpe) Vocalisation is typically absent except loud bill-clappering when sitting atop nests; additionally, hissing and coughing sounds are occasionally vocalised.

REPRODUCTION

Massive nests measuring 1.9 metres across are constructed high atop posts, trees or buildings, made from sticks and twigs; it is common to see nest sites near human habitation areas, but most often in open country rather than in forests. When the adult pair meet at the nest, they often engage in a ritual of bowing, followed by tipping their heads far back and producing their characteristic loud bill clattering. Typically three to five glossy white eggs are laid in each breeding cycle; these elliptically shaped eggs are about seven centimetres in length, coarse in exterior texture and dotted with small pores. (Oates, Reid and Ogilvie-Grant) Both male and female incubate the eggs for a total period of about 33 days. Initially for the first ten days, chicks are fed regurgitated food. The chicks typically evacuate their nest at age 60 days. (Burton) European White Storks mate for life and re-use the same nest from one year to the next. Lifespan in the wild can be as great as 25 years.

BEHAVIOUR

In flight the bird's head and neck are prominently extended. (Peterson, Mountfort and Hollum) Flying is somewhat slow and appears laboured, although it can soar on atmospheric thermals to magnify its own propulsion power. Terrestrially C. ciconia moves very deliberately as it stalks prey, and lunges in its final attack mode. Nesting occurs in farmlands and villages across Northern Europe; surprisingly I observed nests in larger cities such as Marrakech, Morocco in the midst of busy commercial districts.

HABITAT AND ECOLOGY

The European White Stork is most commonly found in damp and marshy areas, but often on drier grassy prairies; a typical nesting habitat is on the broad low-lying grasslands in the Baltic countries, where proximity exists to human settlements as well as marshy ecosytems. Moreover, it feeds chiefly on a variety of amphibians, arthropods and small mammals. Specific prey categories include lizards, grasshoppers, locusts, snails, mice, voles, and small fish. Very often C. ciconia is seen wading in shallow marshes in pursuit of its prey

CONSERVATION

Although the species breeding range is expansive, this area has contracted during the twentiieth century, the European White Stork no longer nesting in southern Sweden or in Switzerland. The chief reason for species decline is ongoing intensification of modern agriculture, steadily depriving C. ciconia of marshy habitat as natural wetlands are converted to food production to meet demand of the expanding human population. Besides the main reason of agricultural expansion as a factor for species decline, other factors contributory to excessive mortality are known to be expanded use of pesticides to support agriculture in the 1900s and also the increase of stork collisions with power lines during this period.

The species population decline is most dramatic among the western species among the migration divide; for example, European White Stork breeding populations in the Netherlands declined over ninety percent from the 1930s to 1980s. Further exacerbation of the western branch of the species decline is reduction of West African locust populations in the Western Sahel; these locust shortages have become more pronounced with increasing frequency of drought and shortage of surface water in the Western Sahel progressively during the 1900s and continuing to the present. I noted similar declines in surface waters in Morocco, with inexorable pressure from human diversion and use of surface waters, resulting in depauperate supplies for migrating birds. My observations in Morocco included measurement of water quality, river flow, lake levels and examination of historical river flow records in addition to review of historical aerial photographs. Since the late 1980s some local bird populations have made a mild rebound due to certain European wetland conservation efforts.

  • C. Michael Hogan. 2009. ''Species account for Ciconia ciconia". Globaltwitcher. ed. N.Stromberg
  • Christopher M. Perrins, Jean-Dominique Lebreton and G.J.M. Hirons. 1993. Bird population studies: relevance to conservation and management, 683 pages
  • Christopher M. Perrins, David Attenborough and Norman Arlot. 1987. New generation guide to the birds of Britain and Europe, University of Chicago Press, 320 pages
  • Richard Bowdler Sharpe. 1896. A handbook to the birds of Great Britain, Volume 3
  • Eugene William Oates, Savil Grey Reid, William Robert Ogilvie-Grant. 1902. Catalogue of the collection of birds eggs in the British museum'', page 106. British Museum (Natural History). Dept. of Zoology
  • Robert Burton. 2002. International Wildlife Encyclopedia, page 2551 ISBN 9780761472667
  • Roger Tory Peterson, Guy Mountfort and P.A.D. Hollum. 2001. A Field Guide to the Birds of Britain and Europe, Peterson Field Guides, 512 pages
Creative Commons Attribution 3.0 (CC BY 3.0)

© C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comprehensive Description

Longueur 100-115 cm, envergure 180-200 cm, poids 2,3-4,4 kg.

L’habitat est généralement constitué de milieux ouverts ou buissonnants dans lesquels la nourriture est facilement accessible, soit notamment les milieux prairiaux et les zones humides. Les massifs forestiers sont évités.

La Cigogne blanche se nourrit de vertébrés et invertébrés divers, dont le volume dépasse rarement celui d’une souris. Lors des années sèches, les insectes et petits rongeurs sont recherchés, mais les animaux aquatiques sont préférés lors d’années humides. Sur les sites où les proies sont abondantes (têtards, criquets, etc.), les cigognes peuvent se rassembler en grandes troupes (rarement plus de 100 individus sur le territoire français). Elle peut également fréquenter en nombre les installations de stockage de déchets, notamment en halte migratoire. Dans les quartiers d’hiver africains, d’énormes rassemblements peuvent suivre les vols de criquets. L’espèce est en voie de sédentarisation dans certaines régions.

Normalement, les nicheurs ne s’éloignent que de quelques kilomètres du nid. La Cigogne blanche est grégaire, bien qu’elle niche le plus souvent isolément. Le même couple peut nicher plusieurs saisons de suite sur le même nid. Toutefois, il semble que la fidélité au nid soit plus importante que celle au partenaire. Le mâle, qui revient le premier sur le site, accepte souvent la première femelle qui se présente. La parade, dont l’élément le plus évident est le balancement de la tête d’avant en arrière, s’accompagne de claquements de bec.

Le nid est construit sur des arbres ou tout autre élément érigé, même d’origine anthropique (toits, pylônes, plates-formes artificielles…). Un entassement de branchages constitue la base, la coupe du nid faite de rameaux étant tapissée d’herbe, de chiffons et papiers. Les nids les plus volumineux atteignent 2 m de hauteur pour 2 m de diamètre. L’unique ponte de 3 à 5 œufs est le plus souvent déposée au début d’avril. L’incubation dure 33-34 jours et les jeunes s’envolent à l’âge de 2 mois.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

European white storks breed throughout Europe, North Africa, Asia Minor, and the Middle East, although they have a fairly fragmented distribution within that large area. Breeding populations have been extirpated from many areas of Europe historically. They migrate into tropical Africa, parts of the Middle East, and the Indian subcontinent during the winter.

Biogeographic Regions: palearctic (Native ); oriental (Native ); ethiopian (Native )

  • Cramp, S., K. Simmons, I. Ferguson-Lees, R. Gillmor, P. Hollom, R. Hudson, E. Nicholson, M. Ogilvie, P. Olney, K. Voous, J. Wattel. 1977. Handbook of the Birds of Europe the Middle East and North Africa. Oxford: Oxford University Press.
  • BBC. 2003. "How do white storks adapt to their environment?" (On-line). Science and Nature: Animals. Accessed January 24, 2006 at http://www.bbc.co.uk/nature/animals/features/180index.shtml.
  • Smithsonian National Zoological Park. 2001. "White Stork- fact sheet" (On-line). Poland.pl. Accessed January 24, 2006 at http://poland.pl/spec/storks/facts.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

White storks are large, wading birds. They are covered in white feathers, except for the black primary feathers on their wings. They have long, sharp bills, and slender legs that are bright orange. Hatchlings and young have black bills and yellowish gray legs. Adults stand from 100 to 115 cm stall, with half of that height being made up by the legs. Their wingspan is 155 to 165 cm. Males are larger, on average, than females but both sexes are identical in plumage.

Range mass: 5000 to 10000 g.

Average mass: 8000 g.

Range length: 100 to 115 cm.

Range wingspan: 155 to 65 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

  • Latus, C., K. Kujawa. 2005. The effect of land cover and fragmentation of agricultural landscape on the density of white stork in Brandenburg, Germany. Polish Journal of Ecology, 53: 535-543.
  • BirdGuides. 1999. "White Stork, Ciconia ciconia" (On-line). BirdGuides. Accessed March 20, 2006 at http://www.birdguides.com/html/vidlib/species/Ciconia_ciconia.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

White storks inhabit open wetlands, savannas, steppes, meadows, pastures, and agricultural fields throughout their range. They prefer areas with shallow, standing water that are not too cold or humid. Their habitat preferences coincide with human preferences for agricultural areas and settlements, resulting in a long-term commensalism. During the breeding season, white storks also seek out areas with suitable structures on which to build nests, especially sunny sites on tall trees or rooftops. They have also been known to nest on walls, stacks of hay and straw, ruins, chimneys, and artificial nesting platforms.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland

Wetlands: marsh

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Berthold, P., K. Michael, U. Querner. 2004. Long-term satellite tracking of white stork migration: constancy versus variability. J Ornithol, 145: 356-359.
  • Wikipedia. 2006. "White Stork" (On-line). Wikipedia. Accessed March 20, 2006 at http://en.wikipedia.org/wiki/White_Stork.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour This species is a Palearctic migrant (del Hoyo et al. 1992) that travels with the assistance of thermal updrafts, the occurrence of which restricts the migratory routes the species can take (Hancock et al. 1992). For example the species must avoid long stretches of open water such as the Mediterranean Sea and must therefore bypass it on narrow fronts to the west or east (Snow and Perrins 1998, Van den Bossche 2002), after which it crosses the Sahara on a broad front (Brown et al. 1982). Once within Africa the species becomes considerably nomadic in response to changing abundances of food (e.g. locust swarms) (Hancock et al. 1992). It breeds from February to April in the Palearctic, whilst the tiny breeding population in South Africa breeds from September to November (del Hoyo et al. 1992). It nests in loose colonies of up to 30 pairs (Hancock et al. 1992, del Hoyo et al. 1992) or solitarily (del Hoyo et al. 1992). The main departure from the European breeding grounds occurs in August (Hancock et al. 1992) with the species travelling in large flocks (Brown et al. 1982, Hancock et al. 1992) of many thousands of individuals (Snow and Perrins 1998), generally arriving in Africa by early-October (Brown et al. 1982). It forages singly, in small groups of 10-50 individuals (Hockey et al. 2005), or in large flocks if prey is abundant and on its wintering grounds it may gather in large numbers (hundreds or thousands of individuals) at abundant food sources (e.g. locust swarms or grass fires) (Hancock et al. 1992). The species feeds diurnally (Hancock et al. 1992) and roosts communally at night in trees (Brown et al. 1982). Habitat The species inhabits open areas, generally avoiding regions with persistent cold, wet weather or large tracts of tall, dense vegetation such as reedbeds or forests (Hancock et al. 1992, del Hoyo et al. 1992, del Hoyo et al. 1992), shallow marshes, lakesides (Hancock et al. 1992, del Hoyo et al. 1992), lagoons (del Hoyo et al. 1992), flood-plains, rice-fields and arable land (Snow and Perrins 1998) especially where there are scattered trees for roosting (del Hoyo et al. 1992). Non-breeding During the winter the species shows a preference for drier habitats (Hancock et al. 1992) such as grasslands, steppe, savanna and cultivated fields (del Hoyo et al. 1992), often gathering near lakes, ponds (Hancock et al. 1992), pools, slow-flowing streams, ditches (del Hoyo et al. 1992) or rivers (Hancock et al. 1992). Diet The species is carnivorous and has a varied and opportunistic diet (del Hoyo et al. 1992). It takes small mammals (del Hoyo et al. 1992) (e.g. voles, water voles, mice, shrews, young rats (Hancock et al. 1992)), large insects (e.g. beetles, grasshoppers, crickets and locusts), adult and juvenile amphibians, snakes, lizards, earthworms, fish (del Hoyo et al. 1992), eggs and nestlings of ground-nesting birds, molluscs and crustaceans (Hancock et al. 1992). Breeding site The nest is constructed of sticks (del Hoyo et al. 1992) and is commonly positioned up to 30 m above the ground (Brown et al. 1982) in trees or on the roofs of buildings, as well as on pylons, telegraph poles, stacks of straw and other anthropogenic sites (including specially erected nesting structures), cliffs and occasionally among rushes on the ground (del Hoyo et al. 1992). The species nests solitarily or in loose colonies, often using traditional nesting sites (there are records of individual nests being used every year for 100 years) (Hancock et al. 1992, del Hoyo et al. 1992). Nesting sites are usually situated near foraging areas, but may be up to 2-3 km away (Snow and Perrins 1998). Management information Intensively grazed (> 1 cow per hectare) unfertilised grassland was found to attract a higher abundance of this species in Hungary (Baldi et al. 2005), and traditional livestock-farming practices such as creating herb-rich meadows for stock grazing and hay production are thought to be beneficial (Goriup and Schulz 1990). A model used to study the impact of different land use patterns on the species found that sequential (asynchronous) mowing of grasslands may increase the food supply for nestlings, thereby increasing reproductive success (as sequential mowing generates a small number of high-quality foraging patches throughout the breeding season) (Johst et al. 2001). A report by the International Council for Bird Preservation (ICBP) suggests that habitat management for the species should include the periodic flooding of meadows, the creation of a mosaic of native grasslands and meadows, and the retention or creation of ditches, ponds and lakes (Goriup and Schulz 1990). The report also advises management strategies in relation to electricity pylons (e.g. burying or marking aerial cables and preventing disturbance to nests during maintenance) to reduce the threats of electrocution and collision (Goriup and Schulz 1990). Due to the species's habit of defecating on its legs to regulate its body temperature in hot climates it is inadvisable to fit individuals with leg-rings for tracking purposes (dry uric acid builds-up on the legs and hardens around leg-rings, tightening them and leading to injuries) (Goriup and Schulz 1990). Other methods of monitoring movements such as satellite telemetry or patagial wing-tags are therefore advised (Goriup and Schulz 1990).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

White storks eat a variety of prey that includes insects, scorpions and spiders, frogs, tadpoles, fish, toads, rodents, lizards, snakes, crustaceans, earthworms, small mammals, and hatchlings or eggs of ground-nesting birds. Foraging Ciconia ciconia visually search for food while walking with their bill pointed toward the gound. When they detect prey, white storks jab their bill forward to grab their prey. In dry years they eat mainly insects and mice. In wet years they eat mainly aquatic animals. Plague insects, such as locusts (Schistocerca gregaria, Locustana pardalina, Dociostaurus maroccanus), armyworms (Spodoptera), and caterpillars (Laphygma exempta, Chloridea obsoleta), form an important part of the diet in areas or years when they become abundant. The primary prey taken varies greatly with regional abundance of prey.

Animal Foods: birds; mammals; amphibians; reptiles; fish; eggs; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic crustaceans

Primary Diet: carnivore (Eats terrestrial vertebrates, Insectivore , Eats non-insect arthropods, Vermivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

White storks influence the populations of their prey items. They have a long-term association with humans in the Palearctic because they prefer similar areas to those preferred by humans for agriculture.

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There are few predators of adult Ciconia ciconia. Nestlings and fledglings may be preyed on by hawks and eagles. White storks place their nests in high places, protecting their young and eggs from most terrestrial predators. They also vigorously defend the young.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

White storks communicate through vocalizations and through postures and movements. Tactile communication occurs between the parents and the infant as well as between the male and the female during mating behaviors. For example, after 14 days old, young white storks tap their parents bills to beg for food.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The oldest recorded lifespan in the wild is 25 years, captive individuals may live up to 48 years. Mortality after the second year of life has been estimated at 21%, before 2 years of age it may be 30% or higher.

Range lifespan

Status: wild:
26 (high) years.

Average lifespan

Status: wild:
22 years.

Range lifespan

Status: captivity:
48 (high) years.

Typical lifespan

Status: wild:
20 to 25 years.

Average lifespan

Status: captivity:
35.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 39 years (wild) Observations: Wild birds may live and reproduce past 30 years of age (http://nationalzoo.si.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

White storks begin their mating season each spring when males return to breeding grounds, in March or April. Males arrive a few days before females. While waiting for females, males enlarge the nest which he and his mate used the previous year. The male and female make soft cooing noises to each other as a form of courtship, and make loud, noisy warnings to keep intruders away.

Initially, when a female rejoins a male, he carries out the "head-shaking crouch" display. In this display, the male lowers himself into the nest as in an incubating posture. Then, he stretches out his long neck and begins to shake his head from side to side. Next, the male and female will cement their pair bond with an "up-down" display, in which the birds pump their heads up and down with outstretched wings. This display is also accompanied by clattering of the bills.

Ciconia ciconia remain in life-long monogamous mating pairs from the age of three or four. Because of this, there is a close pair-bond between the male and female.

Mating System: monogamous

White storks nest in loose, informal colonies and breed in small groups, consisting of only a few pairs. These pairs may nest within sight of each other, but not terribly closely. Nests are huge and bulky and are constructed from sticks, branches, rags, paper, and other available materials. Nests can be up to 2 meters in diameter and 3 meters in depth. Ciconia ciconia make one of the largest nests of all birds. Both males and females participate in nest building, but males tend to bring more of the materials. Nests have been built on towers, rooftops, walls, haystacks, telephone poles, chimneys, constructed nest towers, trees, cliff-ledges, and occasionally on the ground.

White storks mate yearly. Females lay between 3 and 6 eggs, which hatch after roughly one month. Young white storks may leave their nesting grounds and be independent after about eight weeks. They do not begin reproducing until they are about four years of age.

Breeding interval: White storks breed once a year, each spring.

Breeding season: Breeding season takes place in the spring, beginning in March and April.

Range eggs per season: 3 to 6.

Average eggs per season: 5.

Range time to hatching: 30 to 37 days.

Average time to hatching: 35 days.

Range fledging age: 7.5 to 9 weeks.

Average fledging age: 8 weeks.

Range time to independence: 8 to 10 weeks.

Range age at sexual or reproductive maturity (female): 3 to 5 years.

Range age at sexual or reproductive maturity (male): 3 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 4.

Nest-building is an important part of parental care because it creates a suitable environment for the young. Both males and females spend time incubating the eggs, feeding hatchlings, and protecting fledglings. Regurgitated food is fed to the young by both parents each hour until the hatchlings reach 10 days old, then every two hours until they reach 15 days old. Young begin to fledge between 58 and 64 days old and become independent 7 to 20 days later.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Wuczynski, A. 2005. The turnover of White Storks on nests during spring migration. ACTA Ornithologica, 40: 83-85.
  • Tryjanowski, P., T. Sparks, J. Ptaszyk, J. Kosicki. 2004. Do White Storks always profit from an early return to their breeding grounds?. Bird Study, 51: 222-227.
  • Berthold, P., K. Michael, U. Querner. 2004. Long-term satellite tracking of white stork migration: constancy versus variability. J Ornithol, 145: 356-359.
  • Cramp, S., K. Simmons, I. Ferguson-Lees, R. Gillmor, P. Hollom, R. Hudson, E. Nicholson, M. Ogilvie, P. Olney, K. Voous, J. Wattel. 1977. Handbook of the Birds of Europe the Middle East and North Africa. Oxford: Oxford University Press.
  • BBC. 2003. "How do white storks adapt to their environment?" (On-line). Science and Nature: Animals. Accessed January 24, 2006 at http://www.bbc.co.uk/nature/animals/features/180index.shtml.
  • Smithsonian National Zoological Park. 2001. "White Stork- fact sheet" (On-line). Poland.pl. Accessed January 24, 2006 at http://poland.pl/spec/storks/facts.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ciconia ciconia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTACCCGATGACTATTCTCAACCAACCACAAAGACATTGGCACCCTATACCTAATCTTCGGCGCATGAGCTGGCATAGTTGGAACCGCCCTTAGCCTTCTTATTCGCGCAGAACTTGGTCAACCAGGAACCCTCCTAGGAGACGACCAAATCTACAACGTAATCGTTACTGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATCATAATTGGAGGGTTCGGAAACTGATTAGTCCCCCTTATAATCGGGGCTCCAGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGATTACTCCCTCCGTCCTTCCTACTTCTACTAGCCTCCTCCACAGTAGAAGCAGGGGCAGGCACAGGATGAACCGTATACCCGCCCCTAGCTGGCAATTTAGCCCACGCTGGAGCCTCAGTAGACCTAGCCATCTTCTCCCTCCACCTAGCAGGTGTCTCCTCAATCCTAGGAGCAATCAACTTCATCACAACCGCCATCAACATAAAACCTCCCGCCCTATCACAGTACCAAACCCCCCTATTCGTATGATCCGTCCTTATCACCGCCGTCCTACTACTACTATCCCTTCCAGTCCTCGCTGCTGGCATTACTATACTACTCACAGACCGAAACCTAAACACCACATTCTTTGACCCTGCTGGAGGAGGAGACCCTGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATTCTGATCCTCCCAGGATTCGGGATCATCTCCCACGTAGTAACATACTATGCAGGCAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATATTATCCATCGGATTCCTAGGCTTTATCGTATGAGCCCACCACATATTTACAGTAGGTATAGACGTAGACACCCGAGCATACTTCACATCCGCCACTATAATCATCGCCATTCCAACTGGCATCAAAGTCTTCAGCTGACTAGCTACGCTACATGGAGGGACTATCAAATGAGACCCTCCAATACTCTGAGCCCTAGGCTTCATCTTCCTCTTCACCATCGGAGGCCTAACAGGAATTGTTCTAGCAAACTCCTCACTAGACATCGCTCTACATGATACATACTATGTAGTCGCTCACTTCCATTATGTTCTATCAATAGGGGCCGTCTTTGCTATCCTAGCAGGCTTCACTCACTGATTCCCACTATTCACAGGATATACCCTACACCCCACATGAACCAAAACTCACTTTGGAGTCATATTTACAGGTGTAAACCTAACCTTCTTCCCACAACACTTCCTAGGCCTAGCCGGCATGCCCCGACGATACTCCGACTACCCAGACGCTTACACCCTATGAAACACCATATCCTCCATCGGCTCATTAATCTCAATAACAGCCGTAATTATACTAATATTCATCATCTGAGAAGCCTTCACATCAAAACGAAAAGTCCTACAGCCAGAACTAACCCCCACCAACGTTGAATGAATCCACGGCTGCCCACCTCCATACCACACTTTCGAAGAACCAGCCTTTGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ciconia ciconia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The breeding population of Ciconia ciconia declined during most of the twentieth century. This population decline was largely due to the destruction of suitable feeding habitats because of intensified agricultural development. However, white stork populations have rebounded by 20% in recent years because of land use policies, particularly in Spain and eastern European countries. Conservation efforts include preserving wetlands through the EcoFund Foundation and the Polish Society of Wildlife Friends. Preserving wetlands is not the only conservation effort. White storks can also build their huge nests on rooftops. In areas where they are not tolerated or nests are deemed dangerous, the Polish Pro-Natura Society removes and relocates them. White stork populations in Poland are especially healthy, it is said that 1 in every 4 white storks is "Polish."

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

  • Goutner, V., V. Liordos, E. Tsachalidis. 1993. Growth of White Stork Ciconia ciconia nestlings. Ardea, 1: 133-137.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor, non-breeding summer visitor and winter visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species is threatened by habitat alteration including the drainage of wet meadows (Goriup and Schulz 1990, del Hoyo et al. 1992), prevention of floods on flood-plains (by dams, embankments, pumping stations and river canalisation schemes) (Goriup and Schulz 1990), conversion of foraging areas (del Hoyo et al. 1992), development, industrialisation and intensification of agriculture (Hancock et al. 1992) (e.g. mechanised ploughing of rough pastures to sow fertilised crops or swards of more productive grass varieties) (Goriup and Schulz 1990). It is also threatened by a shortage of nesting sites in some areas (del Hoyo et al. 1992) as, for example, the roofs of new rural buildings do not support nests and nest structures on pylons are frequently destroyed during maintenance work (Goriup and Schulz 1990). During the winter in Africa there may be high rates of mortality due to changes in feeding conditions owing to drought, desertification and the control of locust populations by insecticides (Goriup and Schulz 1990, Hancock et al. 1992). The species may also suffer as a result of the excessive use of pesticides (e.g. in Africa) (del Hoyo et al. 1992, Hockey et al. 2005) and through eating poisoned baits put out to catch large carnivores (del Hoyo et al. 1992). Another serious threat is collision with and electrocution from overhead powerlines (del Hoyo et al. 1992), especially whilst on migration in Europe (Hancock et al. 1992). The species is hunted for food and sport (del Hoyo et al. 1992), mainly on migration (Hancock et al. 1992) and in its winter quarters (Goriup and Schulz 1990).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

White storks often build their large stick nests on rooftops, chimneys, and electrical towers, which can be both dangerous and an annoyance. In some areas the presence of stork nests is seen as a sign of good luck and nests are tolerated.

Negative Impacts: household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The benefits of Ciconia ciconia come largely from their aesthetic value. They also help to control populations of agricultural pests, such as grasshoppers.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

White stork

The white stork (Ciconia ciconia) is a large bird in the stork family Ciconiidae. Its plumage is mainly white, with black on its wings. Adults have long red legs and long pointed red beaks, and measure on average 100–115 cm (39–45 in) from beak tip to end of tail, with a 155–215 cm (61–85 in) wingspan. The two subspecies, which differ slightly in size, breed in Europe (north to Finland), northwestern Africa, southwestern Asia (east to southern Kazakhstan) and southern Africa. The white stork is a long-distance migrant, wintering in Africa from tropical Sub-Saharan Africa to as far south as South Africa, or on the Indian subcontinent. When migrating between Europe and Africa, it avoids crossing the Mediterranean Sea and detours via the Levant in the east or the Strait of Gibraltar in the west, because the air thermals on which it depends do not form over water.

A carnivore, the white stork eats a wide range of animal prey, including insects, fish, amphibians, reptiles, small mammals and small birds. It takes most of its food from the ground, among low vegetation, and from shallow water. It is a monogamous breeder, but does not pair for life. Both members of the pair build a large stick nest, which may be used for several years. Each year the female can lay one clutch of usually four eggs, which hatch asynchronously 33–34 days after being laid. Both parents take turns incubating the eggs and both feed the young. The young leave the nest 58–64 days after hatching, and continue to be fed by the parents for a further 7–20 days.

The white stork has been rated as Least Concern by the International Union for Conservation of Nature (IUCN). It benefited from human activities during the Middle Ages as woodland was cleared, but changes in farming methods and industrialisation saw it decline and disappear from parts of Europe in the 19th and early 20th centuries. Conservation and reintroduction programs across Europe have resulted in the white stork resuming breeding in the Netherlands, Belgium, Switzerland and Sweden. It has few natural predators, but may harbour several types of parasite; the plumage is home to chewing lice and feather mites, while the large nests maintain a diverse range of mesostigmatic mites. This conspicuous species has given rise to many legends across its range, of which the best-known is the story of babies being brought by storks.

Taxonomy and evolution[edit]

The white stork was one of the many bird species originally described by Linnaeus in the landmark 1758 10th edition of his Systema Naturae,[2] where it was given the binomial name of Ardea ciconia. It was reclassified to (and was designated the type species of) the new genus Ciconia by French zoologist Mathurin Jacques Brisson in 1760.[3][4] Both the genus and specific epithet, cǐcōnia, are the Latin word for "stork",[5] originally recorded in the works of Horace and Ovid.[6] The Latin word survives in most Romance languages (cicogna, cigüeña, cegonha and the like). The word stork is derived from the Old English word storc, and appeared in the 10th-century works the Erfurt Glossary, where the word is equated with Ciconia, and Aelfric's Homilies. The word is related to the Old High German storah, "stork", and similar words in many other European languages, all of which are descended from the Germanic sturko-z.[7]

There are two subspecies:

  • C. c. ciconia, the nominate subspecies described by Linnaeus in 1758, breeds from Europe to northwest Africa and westernmost Asia, and in southern Africa, and winters mainly in Africa south of the Sahara Desert,[8] though some birds winter in India.[9]
  • C. c. asiatica, described by Russian naturalist Nikolai Severtzov in 1873, breeds in Turkestan and winters from Iran to India. It is slightly larger than the nominate subspecies.[8][10]

The stork family contains six genera in three broad groups: the open-billed and wood storks (Mycteria and Anastomus), the giant storks (Ephippiorhynchus, Jabiru and Leptoptilos), and the "typical" storks, Ciconia. The typical storks include the white stork and six other extant species,[11] which are characterised by straight pointed beaks and mainly black and white plumage.[12] Its closest relatives are the larger, black-billed Oriental white stork (Ciconia boyciana) of East Asia, which was formerly classified as a subspecies of the white stork,[8] and the maguari stork (C. maguari) of South America. Close evolutionary relationships within Ciconia are suggested by behavioural similarities and, biochemically, through analysis of both mitochondrial cytochrome b gene sequences and DNA-DNA hybridization.[13]

Fossil record[edit]

A Ciconia fossil representing the distal end of a right humerus has been recovered from Miocene beds of Rusinga Island, Lake Victoria, Kenya.[14] The 24–6 million year old fossil could have originated from either a white stork or a black stork (C. nigra), which are species of about the same size with very similar bone structures. The Middle Miocene beds of Maboko Island have yielded further remains.[14]

Description[edit]

A juvenile feeding on an insect

The white stork is a large bird. It has a length of 100–115 cm (39–45 in),[nb 1][15] and a standing height of 100–125 cm (39–49 in). The wingspan is 155–215 cm (61–85 in) and its weight is 2.3–4.5 kg (5.1–9.9 lb).[16][17] Like all storks, it has long legs, a long neck and a long straight pointed beak.[11] The sexes are identical in appearance, except that males are larger than females on average.[8] The plumage is mainly white with black flight feathers and wing coverts; the black is caused by the pigment melanin.[18] The breast feathers are long and shaggy forming a ruff which is used in some courtship displays.[19] The irises are dull brown or grey, and the peri-orbital skin is black. The adult has a bright red beak and red legs,[8] the colouration of which is derived from carotenoids in the diet. In parts of Spain, studies have shown that the pigment is based on astaxanthin obtained from an introduced species of crayfish (Procambarus clarkii) and the bright red beak colours show up even in nestlings, in contrast to the duller beaks of young white storks elsewhere.[20]

In flight. White storks fly with their necks outstretched.

As with other storks, the wings are long and broad enabling the bird to soar.[21] In flapping flight its wingbeats are slow and regular. It flies with its neck stretched forward and with its long legs extended well beyond the end of its short tail. It walks at a slow and steady pace with its neck upstretched. In contrast, it often hunches its head between its shoulders when resting.[22] Moulting has not been extensively studied, but appears to take place throughout the year, with the primary flight feathers replaced over the breeding season.[19]

Head, neck and upper body of a white stork with a long beak with is reddish at the base fading to black at the tip
An older juvenile at Vogelpark Avifauna, Netherlands. Beaks turn red starting at the base.

Upon hatching, the young white stork is partly covered with short, sparse, whitish down feathers. This early down is replaced about a week later with a denser coat of woolly white down. By three weeks, the young bird acquires black scapulars and flight feathers. On hatching the chick has pinkish legs, which turn to greyish-black as it ages. Its beak is black with a brownish tip.[19] By the time it fledges, the juvenile bird's plumage is similar to that of the adult, though its black feathers are often tinged with brown, and its beak and legs are a duller brownish-red or orange. The beak is typically orange or red with a darker tip.[22] The bills gain the adults' red colour the following summer, although the black tips persist in some individuals. Young storks adopt adult plumage by their second summer.[23]

Similar species[edit]

Within its range the white stork is distinctive when seen on the ground but, when seen at a distance in flight, it can be confused with several other species with similar underwing patterns, such as the yellow-billed stork, great white pelican and Egyptian vulture.[22] The yellow-billed stork is identified by its black tail and a longer, slightly curved, yellow beak. The white stork also tends to be larger than the yellow-billed stork.[24] The great white pelican has short legs which do not extend beyond its tail, and it flies with its neck retracted, keeping its head near to its stocky body, giving it a different flight profile.[25] Pelicans also behave differently, soaring in orderly, synchronised flocks rather than in disorganised groups of individuals as the white stork does.[26] The Egyptian vulture is much smaller, with a long wedge-shaped tail, shorter legs and a small yellow-tinged head on a short neck.[27] The common crane, which can also look black and white in strong light, shows longer legs and a longer neck in flight.[28]

Distribution and habitat[edit]

Several black and white birds with long red legs and long red beaks walk in a green grassy area.
A flock foraging in Turkey. White storks avoid areas overgrown with tall grass and shrub.

The nominate race of the white stork has a wide although disjunct summer range across Europe, clustered in the Iberian Peninsula and North Africa in the west, and much of eastern and central Europe, with 25% of the world's population concentrated in Poland,[29] as well as parts of western Asia. The asiatica population of about 1450 birds is restricted to a region in central Asia between the Aral Sea and Xinjiang in western China.[30][31] The Xinjiang population is believed to have become extinct around 1980.[32] Migration routes extend the range of this species into many parts of Africa and India. Some populations adhere to the eastern migration route, which passes across Israel into eastern and central Africa.[33][34]

A few records of breeding from South Africa have been known since 1933 at Calitzdorp, and about 10 birds have been known to breed since the 1990s around Bredasdorp.[35] A small population of white storks winters in India and is thought to derive principally from the C. c. asiatica population[10] as flocks of up to 200 birds have been observed on spring migration in the early 1900s through the Kurram Valley.[36] However, birds ringed in Germany have been recovered in western (Bikaner) and southern (Tirunelveli) India.[9][37] An atypical specimen with red orbital skin, a feature of the Oriental white stork, has been recorded[38] and further study of the Indian population is required.[10] North of the breeding range, it is a passage migrant or vagrant in Finland, Great Britain, Iceland, Ireland, Norway and Sweden, and west to the Azores and Madeira. In recent years, the range has expanded into western Russia.[39][40]

The white stork's preferred feeding grounds are grassy meadows, farmland and shallow wetlands. It avoids areas overgrown with tall grass and shrubs.[41] In the Chernobyl area of northern Ukraine, white stork populations declined after the 1986 nuclear accident there as farmland was succeeded by tall grass shrubs.[42] In parts of Poland, poor natural foraging grounds have forced birds to seek food at rubbish dumps since 1999.[43] White storks have also been reported foraging in rubbish dumps in the Middle East, North Africa and South Africa.[44]

The white stork breeds in greater numbers in areas with open grasslands, particularly grassy areas which are wet or periodically flooded, and less in areas with taller vegetation cover such as forest and shrubland.[45] They make use of grasslands, wetlands, and farmland on the wintering grounds in Africa.[35] White storks were probably aided by human activities during the Middle Ages as woodland was cleared and new pastures and farmland were created, and they were found across much of Europe, breeding as far north as Sweden. The population in Sweden is thought to have established in the 16th century after forests were cut down for agriculture. About 5000 pairs were estimated to breed in the 18th century which declined subsequently. The first accurate census in 1917 found 25 pairs and the last pair failed to breed around 1955.[46] The white stork is a rare visitor to the British Isles, as about 20 birds are seen in Britain every year, but there are no records of nesting.[47] A pair nested atop St Giles High Kirk in Edinburgh, Scotland in 1416.[48]

A decline in population began in the 19th century due to industrialisation and changes in agricultural methods. White storks no longer nest in many countries, and the current strongholds of the western population are in Portugal, Spain, Ukraine and Poland. In the Iberian Peninsula, populations are concentrated in the southwest, and have also declined due to agricultural practices.[45] A study published in 2005 found that the Podhale region in the uplands of southern Poland had seen an influx of white storks, which first bred there in 1931 and have nested at progressively higher altitudes since, reaching 890 m (3000 ft) in 1999. The authors proposed that this was related to climate warming, and the influx of other animals and plants to higher altitudes.[49] White storks arriving in Poznań province (Greater Poland Voivodeship) in western Poland in spring to breed did so some 10 days earlier in the last twenty years of the 20th century than at the end of the 19th century.[50]

Migration[edit]

A blue sky with many tiny silhouettes of distant flying birds
A flock in migration over Israel. Migrating white storks use the uplift of air thermals to reduce the effort of long-distance flying.

Systematic research into migration of white stork began with German ornithologist Johannes Thienemann who commenced ringing studies in 1906 at the Rossitten Bird Observatory, on the Curonian Spit in what was then East Prussia. Although not many storks passed through Rossitten itself, the observatory coordinated the large-scale ringing of the species throughout Germany and elsewhere in Europe. Between 1906 and the Second World War about 100,000, mainly juvenile, white storks were ringed, with over 2,000 long-distance recoveries of birds wearing Rossitten rings reported between 1908 and 1954.[51]

Routes[edit]

White storks fly south from their summer breeding grounds in Europe in August and September, heading for Africa.[41] There, they spend the winter in savannah from Kenya and Uganda south to the Cape Province of South Africa.[52] In these areas they congregate in large flocks which may exceed a thousand individuals.[22] Some diverge westwards into western Sudan and Chad, and may reach Nigeria.[33] In spring, the birds return north; they are recorded from Sudan and Egypt from February to April.[53] They arrive back in Europe around late March and April,[41] after an average journey of 49 days. By comparison, the autumn journey is completed in about 26 days. Tailwinds and scarcity of food and water en route (birds fly faster over regions lacking resources) increase average speed.[34]

To avoid a long sea crossing over the Mediterranean, birds from central Europe either follow an eastern migration route by crossing the Bosphorus to Turkey, traversing the Levant, then bypassing the Sahara Desert by following the Nile valley southwards, or follow a western route over the Strait of Gibraltar.[54] These migration corridors maximise help from the thermals and thus save energy.[55][56] The eastern route is by far the more important with 530,000 white storks using it annually, making the species the second commonest migrant there (after the European honey buzzard). The flocks of migrating raptors, white storks and great white pelicans can stretch for 200 km (125 mi).[57] The eastern route is twice as long as the western, but storks take the same time to reach the wintering grounds by either.[58]

Juvenile white storks set off on their first southward migration in an inherited direction but, if displaced from that bearing by weather conditions, they are unable to compensate, and may end up in a new wintering location. Adults can compensate for strong winds and adjust their direction to finish at their normal winter sites, because they are familiar with the location. For the same reason, all spring migrants, even those from displaced wintering locations, can find their way back to the traditional breeding sites.[59] An experiment with young birds raised in captivity in Kaliningrad and released in the absence of wild storks to show them the way revealed that they appeared to have an instinct to fly south, although the scatter in direction was large.[60]

Energetics[edit]

White storks rely on the uplift of air thermals to soar and glide the long distances of their annual migrations between Europe and Sub-Saharan Africa. For many, the shortest route would take them over the Mediterranean Sea; however, since air thermals do not form over water, they generally detour over land to avoid the trans-Mediterranean flights that would require prolonged energetic wing flapping.[61] It has been estimated that flapping flight metabolises 23 times more body fat than soaring flight per distance travelled.[62] Thus, flocks spiral upwards on rising warm air until they emerge at the top, up to 1,200–1,500 m (3,900–4,900 ft) above the ground (though one record from Western Sudan observed an altitude of 3,300 m (10,800 ft)).[53]

Long flights over water may occasionally be undertaken. A young white stork ringed at the nest in Denmark subsequently appeared in England, where it spent some days before moving on. It was later seen flying over St Mary's, Isles of Scilly, and arrived in a poor condition in Madeira three days later. That island is 500 km (320 mi) from Africa, and twice as far from the European mainland.[63] Migration through the Middle East may be hampered by the khamsin, winds bringing gusty overcast days unsuitable for flying. In these situations, flocks of white storks sit out the adverse weather on the ground, standing and facing into the wind.[53]

Behaviour[edit]

An adult in Tsavo East National Park, Kenya. The lower parts of its legs are a whitish colour due to being covered with its droppings—an example of thermoregulation by urohidrosis.

The white stork is a gregarious bird; flocks of thousands of individuals have been recorded on migration routes and at wintering areas in Africa. Non-breeding birds gather in groups of 40 or 50 during the breeding season.[22] The smaller dark-plumaged Abdim's stork is often encountered with white stork flocks in southern Africa.[64] Breeding pairs of white stork may gather in small groups to hunt, and colony nesting has been recorded in some areas.[65] However, groups among white stork colonies vary widely in size and the social structure is loosely defined; young breeding storks are often restricted to peripheral nests, while older storks attain higher breeding success while occupying the better quality nests toward the centres of breeding colonies.[66] Social structure and group cohesion is maintained by altruistic behaviours such as allopreening. White storks exhibit this behaviour exclusively at the nest site. Standing birds preen the heads of sitting birds, sometimes these are parents grooming juveniles, and sometimes juveniles preen each other.[67] Unlike most storks, it never adopts a spread-winged posture, though it is known to droop its wings (holding them away from its body with the primary feathers pointing downwards) when its plumage is wet.[68]

A white stork's droppings, containing faeces and urine, are sometimes directed onto its own legs, making them appear white.[24] The resulting evaporation provides cooling and is termed urohidrosis.[69] Birds that have been ringed can sometimes be affected by the accumulation of droppings around the ring leading to constriction and leg trauma.[70] The white stork has also been noted for tool use by squeezing moss in the beak to drip water into the mouths of its chicks.[71]

Communication[edit]

The adult white stork's main sound is noisy bill-clattering, which has been likened to distant machine gun fire. The bird makes these sounds by rapidly opening and closing its beak so that a knocking sound is made each time its beak closes. The clattering is amplified by its throat pouch, which acts as a resonator. Used in a variety of social interactions, bill-clattering generally grows louder the longer it lasts, and takes on distinctive rhythms depending on the situation—for example, slower during copulation and briefer when given as an alarm call. The only vocal sound adult birds generate is a weak barely audible hiss; however, young birds can generate a harsh hiss, various cheeping sounds, and a cat-like mew they use to beg for food. Like the adults, young also clatter their beaks.[72] The up-down display is used for a number of interactions with other members of the species. Here a stork quickly throws its head backwards so that its crown rests on its back before slowly bringing its head and neck forwards again, and this is repeated several times. The display is used as a greeting between birds, post coitus, and also as a threat display. Breeding pairs are territorial over the summer, and use this display, as well as crouching forward with the tails cocked and wings extended.[73]

Feeding[edit]

White storks consume a wide variety of animal prey. They prefer to forage in meadows that are within roughly 5 km (3 mi) of their nest and sites where the vegetation is shorter so that their prey is more accessible.[41] Their diet varies according to season, locality and prey availability. Common food items include insects (primarily beetles, grasshoppers, locusts and crickets), earthworms, reptiles, amphibians, particularly frog species such as the edible frog (Pelophylax kl. esculentus) and common frog (Rana temporaria) and small mammals such as voles, moles and shrews. Less commonly, they also eat bird eggs and young birds, fish, molluscs, crustaceans and scorpions. They hunt mainly during the day, swallowing small prey whole, but killing and breaking apart larger prey before swallowing.[65] Rubber bands are mistaken for earthworms and consumed, occasionally resulting in fatal blockage of the digestive tract.[74]

White stork picking a dead young rabbit

Birds returning to Latvia during spring have been shown to locate their prey, moor frogs (Rana arvalis), by homing in on the mating calls produced by aggregations of male frogs.[75]

The diet of non-breeding birds is similar to that of breeding birds, but food items are more often taken from dry areas.[76] White storks wintering in western India have been observed to follow blackbuck to capture insects disturbed by them.[77] Wintering white storks in India sometimes forage along with the woolly-necked stork (Ciconia episcopus).[78] Food piracy has been recorded in India with a rodent captured by a western marsh harrier appropriated by a white stork, while Montagu's harrier is known to harass white storks foraging for voles in some parts of Poland.[79][80]

Breeding and lifespan[edit]

At least eight tall, black and white birds, in three nests on the roof of a building.
Nests on a belfry in Spain. White storks often form small nesting colonies.

The white stork breeds in open farmland areas with access to marshy wetlands, building a large stick nest in trees, on buildings, or on purpose-built man-made platforms.[81] Each nest is 1–2 m (3.3–6.6 ft) in depth, 0.8–1.5 m (2.6–4.9 ft) in diameter, and 60–250 kg (130–550 lb) in weight.[82] Nests are built in loose colonies.[66] Not persecuted as it is viewed as a good omen, it often nests close to human habitation; in southern Europe, nests can be seen on churches and other buildings. The nest is typically used year after year especially by older males. The males arrive earlier in the season and choose the nests. Larger nests are associated with greater numbers of young successfully fledged, and appear to be sought after.[83] Nest change is often related to a change in the pairing and failure to raise young the previous year, and younger birds are more likely to change nesting sites.[84] Although a pair may be found to occupy a nest, partners may change several times during the early stages and breeding activities begin only after a stable pairing is achieved.[85]

Mating

Several bird species often nest within the large nests of the white stork. Regular occupants are house sparrows, tree sparrows, and common starlings; less common residents include Eurasian kestrels, little owls, European rollers, white wagtails, black redstarts, Eurasian jackdaws, and Spanish sparrows.[86] Paired birds greet by engaging in up-down and head-shaking crouch displays, and clattering the beak while throwing back the head.[8] Pairs copulate frequently throughout the month before eggs are laid. High-frequency pair copulation is usually associated with sperm competition and high frequency of extra-pair copulation; however, extra-pair copulation is infrequent in white storks.[87]

Egg

A white stork pair raises a single brood a year. The female typically lays four eggs, though clutches of one to seven have been recorded.[72] The eggs are white, but often look dirty or yellowish due to a glutinous covering. They measure 72.58 mm × 51.86 mm (2.857 in × 2.042 in),[88] and weigh 96–129 g (3.4–4.6 oz),[72] of which 10.76 g (0.380 oz) is shell.[88] Incubation begins as soon as the first egg is laid, so the brood hatches asynchronously, beginning 33 to 34 days later. The first hatchling typically has a competitive edge over the others. While stronger chicks are not aggressive towards weaker siblings, as is the case in some species, weak or small chicks are sometimes killed by their parents.[89][90] This behaviour occurs in times of food shortage to reduce brood size and hence increase the chance of survival of the remaining nestlings. White stork nestlings do not attack each other, and their parents' method of feeding them (disgorging large amounts of food at once) means that stronger siblings cannot outcompete weaker ones for food directly, hence parental infanticide is an efficient way of reducing brood size. Despite this, this behaviour has not commonly been observed.[89]

The temperature and weather around the time of hatching in spring is important; cool temperatures and wet weather increase chick mortality and reduce breeding success rates.[45] Somewhat unexpectedly, studies have found that later-hatching chicks which successfully reach adulthood produce more chicks than do their earlier-hatching nestmates.[91] The body weight of the chicks increases rapidly in the first few weeks and reaches a plateau of about 3.4 kg (7.5 lb) in 45 days. The length of the beak increases linearly for about 50 days.[92] Young birds are fed with earthworms and insects, which are regurgitated by the parents onto the floor of the nest. Older chicks reach into the mouths of parents to obtain food.[93] Chicks fledge 58 to 64 days after hatching.[94]

White storks generally begin breeding when about four years old, although the age of first breeding has been recorded as early as two years and as late as seven years.[19] The oldest known wild white stork lived for 39 years after being ringed in Switzerland,[95] while captive birds have lived for more than 35 years.[8]

Parasites and diseases[edit]

White stork nests are habitats for an array of small arthropods, particularly over the warmer months after the birds arrive to breed. Nesting over successive years, the storks bring more material to line their nests and layers of organic material accumulate within them. Not only do their bodies tend to regulate temperatures within the nest, but excrement, food remains and feather and skin fragments provide nourishment for a large and diverse population of free-living mesostigmatic mites. A survey of twelve nests found 13,352 individuals of 34 species, the most common being Macrocheles merdarius, M. robustulus, Uroobovella pyriformis and Trichouropoda orbicularis, which together represented almost 85% of all the specimens collected. These feed on the eggs and larvae of insects and on nematodes, which are abundant in the nest litter. These mites are dispersed by coprophilous beetles, often of the family Scarabaeidae, or on dung brought by the storks during nest construction. Parasitic mites do not occur, perhaps being controlled by the predatory species. The overall impact of the mite population is unclear, the mites may have a role in suppressing harmful organisms (and hence be beneficial), or they may themselves have an adverse effect on nestlings.[96][97]

The birds themselves host species belonging to more than four genera of feather mites.[98] These mites, including Freyanopterolichus pelargicus[99][100] and Pelargolichus didactylus[100] live on fungi growing on the feathers. The fungi found on the plumage may feed on the keratin of the outer feathers or on feather oil.[101] Chewing lice such as Colpocephalum zebra tend to be found on the wings, and Neophilopterus incompletus elsewhere on the body.[102]

The white stork also carries several types of internal parasites, including Toxoplasma gondii[103] and intestinal parasites of the genus Giardia.[104] A study of 120 white stork carcasses from Saxony-Anhalt and Brandenburg in Germany yielded eight species of trematode (fluke), four cestode (tapeworm) species, and at least three species of nematode.[105] One species of fluke, Chaunocephalus ferox, caused lesions in the wall of the small intestine in a number of birds admitted to two rehabilitation centres in central Spain, and was associated with reduced weight. It is a recognised pathogen and cause of morbidity in the Asian Openbill (Anastomus oscitans).[106]

West Nile virus (WNV) is mainly a bird infection that is transmitted between birds by mosquitos.[107] Migrating birds appear to be important in spread of the virus,[108] the ecology of which remains poorly known.[109] On 26 August 1998, a flock of about 1,200 migrating white storks that had been blown off course on their southward journey landed in Eilat, in southern Israel. The flock was stressed as it had resorted to flapping flight to return to its migratory route, and a number of birds died. A virulent strain of West Nile virus was isolated from the brains of eleven dead juveniles. Other white storks subsequently tested in Israel have shown anti-WNV antibodies.[110] In 2008 three juvenile white storks from a Polish wildlife refuge yielded seropositive results indicating exposure to the virus, but the context or existence of the virus in that country is unclear.[111]

Conservation[edit]

Results of the 2004/05 white stork census in Europe (numbers of breeding pairs)

The white stork's decline due to industrialisation and agricultural changes (principally the draining of wetlands and conversion of meadows to crops such as maize) began in the 19th century: the last wild individual in Belgium was seen in 1895, in Sweden in 1955, in Switzerland in 1950 and in the Netherlands in 1991. However, the species has since been reintroduced to many regions.[112] It has been rated as Least Concern by the IUCN since 1994, after being evaluated as Near Threatened in 1988.[1] The white stork is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.[113] Parties to the agreement are required to engage in a wide range of conservation strategies described in a detailed action plan. The plan is intended to address key issues such as species and habitat conservation, management of human activities, research, education, and implementation.[114] Threats include the continued loss of wetlands, collisions with overhead power lines, use of persistent pesticides (such as DDT) to combat locusts in Africa, and largely illegal hunting on migration routes and wintering grounds.[8]

Three long-legged, long-billed black and white birds stand on a huge pile of sticks atop an artificial platform on a pole
A man-made nest platform in Poland built as a conservation measure and to prevent storks disrupting electricity supplies through nesting on pylons. Three young white storks are on the top of the nest and two Eurasian tree sparrows are perching on the side of the nest.

A large population of white storks breeds in central (Poland, Ukraine and Germany) and southern Europe (Spain and Turkey). In a 2004/05 census, there were 52,500 pairs in Poland, 30,000 pairs in Ukraine, 20,000 pairs in Belarus, 13,000 pairs in Lithuania (the highest known density of this species in the world), 10,700 pairs in Latvia, and 10,200 in Russia. There were around 5,500 pairs in Romania, 5,300 in Hungary and an estimated 4,956 breeding pairs in Bulgaria.[115] In Germany, the majority of the total 4,482 pairs were in the eastern region, especially in the states of Brandenburg and Mecklenburg-Vorpommern (1296 and 863 pairs in 2008 respectively).[116] Apart from Spain and Portugal (33,217 and 7,684 pairs in 2004/05 respectively), populations are generally much less stable. The Danish population declined to just three pairs in 2005. In the eastern Mediterranean region Turkey has a sizeable population of 6195 pairs, and Greece 2139 pairs. In Western Europe the white stork remains a rare bird despite conservation efforts. In 2004 France had only 973 pairs, and the Netherlands 528 pairs.[115]

In the early 1980s, the population had fallen to fewer than nine pairs in the entire upper Rhine River valley, an area closely identified with the white stork for centuries. Conservation efforts successfully increased the population of birds there to 270 pairs (in 2008), largely due to the actions of the Association for the Protection and Reintroduction of Storks in Alsace and Lorraine.[117] The reintroduction of zoo-reared birds has halted further declines in Italy, the Netherlands, and Switzerland. There were 601 pairs breeding in Armenia and around 700 pairs in the Netherlands in 2008,[118] and few pairs also breed in South Africa, typically recent colonists from within the normal wintering population.[8] In Poland, electric poles have been modified with a platform at the top to prevent the white stork's large nest from disrupting the electricity supply, and sometimes nests are moved from an electric pole to a man-made platform.[82] Introductions of zoo-reared birds in the Netherlands has been followed up by feeding and nest-building programs by volunteers.[118] Similar reintroduction programs are taking place in Sweden,[119] and Switzerland,[120] where 175 pairs were recorded breeding in 2000.[121] Long term viability of the population in Switzerland is unclear as breeding success rates are low, and supplementary feeding does not appear to be of benefit.[120]

Cultural associations[edit]

Bociany (Storks), a painting by Józef Chełmoński (1849–1914)

Due to its large size, predation on vermin, and nesting behaviour close to human settlements and on rooftops, the white stork has an imposing presence that has had an impact on human culture and folklore.[63] In Ancient Egypt, it was associated with, and was the hieroglyph for, the Ba, or "soul".[122] The Hebrew word for the white stork is chasidah (חסידה), meaning "merciful" or "kind".[123] Greek and Roman mythology portray storks as models of parental devotion, and it was believed that they did not die of old age, but flew to islands and took the appearance of humans. The bird is featured in at least three of Aesop's Fables: The Fox and the Stork, The Farmer and the Stork, and The Frogs Who Desired a King.[124] They were also thought to care for their aged parents, feeding them and even transporting them, and children's books depicted them as a model of filial values. A Greek law called Pelargonia, from the Ancient Greek word pelargos for stork, required citizens to take care of their aged parents.[8] The Greeks also held that killing a stork could be punished with death.[125] It was allegedly protected in Ancient Thessaly as it hunted snakes, and widely held to be Virgil's "white bird".[126] Roman writers noted the white stork's arrival in spring, which alerted farmers to plant their vines.[127]

Followers of Islam revered storks because they made an annual pilgrimage to Mecca on their migration.[128] Some of the earliest understanding on bird migration were initiated by an interest in white storks; Pfeilstorch ("arrow storks") were found in Europe with African arrows embedded in their bodies. A well-known example of such a stork found in the summer of 1822 in the German town of Klütz in Mecklenburg was made into a mounted taxidermy specimen, complete with the ornate African arrow, that is now in the University of Rostock.[129]

Supposed filial virtues of the stork[130]

Storks have little fear of humans if not disturbed, and often nest on buildings in Europe. In Germany, the presence of a nest on a house was believed to protect against fires. They were also protected because of the belief that their souls were human.[131] German and Dutch households would encourage storks to nest on houses, sometimes by constructing purpose-built high platforms, to bring good luck.[123] Poles, Lithuanians and Ukrainians believe that storks bring harmony to a family on whose property they nest.[132]

The white stork is a popular motif on postage stamps, and it is featured on more than 120 stamps issued by more than 60 stamp-issuing entities.[133] It is the national bird of Lithuania,[134] and it was a Polish mascot at the Expo 2000 Fair in Hanover.[135] In the 19th century, storks were also thought to only live in countries having a republican form of government.[136] Polish poet Cyprian Kamil Norwid mentioned storks in his poem Moja piosnka (II) ("My Song (II)"):[137]

For the land where it's a great travesty
To harm a stork's nest in a pear tree,
For storks serve us all...
I am homesick, Lord!...

Storks and childbirth[edit]

Der Klapperstorch (The Stork), a painting by Carl Spitzweg (1808–1885)

According to European folklore, the stork is responsible for bringing babies to new parents. The legend is very ancient, but was popularised by a 19th-century Hans Christian Andersen story called The Storks.[128] German folklore held that storks found babies in caves or marshes and brought them to households in a basket on their backs or held in their beaks. These caves contained adebarsteine or "stork stones". The babies would then be given to the mother or dropped down the chimney. Households would notify when they wanted children by placing sweets for the stork on the window sill.[123] From there the folklore has spread around the world to countries such as the Philippines and South America.[123] Birthmarks on the back of the head of newborn baby, nevus flammeus nuchae, are sometimes referred to as stork-bite.[138]

In Slavic mythology and religion, storks were thought to carry unborn souls from Iriy to Earth in spring and summer.[139] This belief still persists in the modern folk culture of many Slavic countries, in the simplified child story that "storks bring children into the world".[140] Storks were seen by the Slavs as bringing luck, and killing one would bring misfortune.[141] A long-term study that showed a spurious correlation between the numbers of stork nests and human births is widely used in the teaching of basic statistics as an example to highlight that correlation does not necessarily indicate causation.[142][143] The child-bringing myth has appeared in different forms in history. Children of African American slaves were sometimes told that white babies were brought by storks, while black babies were born from buzzard eggs.[144]

Psychoanalyst Marvin Margolis suggests the enduring nature of the stork fable of the newborn is linked to its addressing a psychological need, in that it allays the discomfort of discussing sex and procreation with children. Birds have long been associated with the maternal symbols from pagan goddesses such as Juno to the Holy Ghost, and the stork may have been chosen for its white plumage (depicting purity), size (in that it is big enough to carry an infant), and flight at high altitude (likened to flying between Earth and Heaven).[123] The fable and its relation to the internal world of the child have been discussed by Sigmund Freud,[123] and Carl Jung.[145] In fact, Jung recalled being told the story himself upon the birth of his own sister.[146] The traditional link with the newborn continues with their use in advertising for such products as nappies and birth announcements.[123]

There were negative aspects to stork folklore as well; a Polish folk tale relates how God made the stork's plumage white, while the Devil gave it black wings, imbuing it with both good and evil impulses. They were also associated with handicapped or stillborn babies in Germany, explained as the stork having dropped the baby en route to the household, or as revenge or punishment for past wrongdoing. A mother who was confined to bed around the time of childbirth was said to have been "bitten" by the stork.[123] In Denmark, storks were said to toss a nestling off the nest and then an egg in successive years.[123] In medieval England, storks were also associated with adultery, possibly inspired by their courtship rituals. Their preening and posture saw them linked with the attribute of self-conceit.[147]

In literature[edit]

Patrick Leigh Fermor describes a flock of storks migrating south across the Balkans in 1934 in his memoir published as The Broken Road.[148]

Notes[edit]

  1. ^ By convention, length is measured from the tip of the bill to the tip of the tail on a dead bird (or skin) laid on its back.

References[edit]

  1. ^ a b BirdLife International (2012). "Ciconia ciconia". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Linnaeus, Carl (1758). Systema Naturae per Regna Tria Naturae, Secundum Classes, Ordines, Genera, Species, cum Characteribus, Differentiis, Synonymis, Locis. Tomus I. Editio decima, reformata (in Latin). Holmiae: (Laurentii Salvii). p. 142. 
  3. ^ Brisson, Mathurin Jacques (1760). Ornithologie ou, Méthode contenant la division des oiseaux en ordres, sections, genres, espéces & leurs variétés (in French) 1. Paris, France: C. J. B. Bauche. p. 48. 
  4. ^ Boles, Walter E. (2005). "A Review of the Australian Fossil Storks of the Genus Ciconia (Aves : Ciconiidae), with the description of a new species". Records of the Australian Museum 57 (2): 165–78. doi:10.3853/j.0067-1975.57.2005.1440. ISSN 0067-1975. Retrieved 26 January 2011. 
  5. ^ Lewis, Charlton Thomas; Kingery, Hugh Macmaster (1918). An Elementary Latin Dictionary. New York, New York: American Book Company. p. 126. ISBN 0-19-910205-8. 
  6. ^ Simpson, D.P. (1979). Cassell's Latin Dictionary (5 ed.). London: Cassell Ltd. p. 103. ISBN 0-304-52257-0. 
  7. ^ Simpson, John; Weiner, Edmund (eds) (1989). "Stork". Oxford English Dictionary (2nd ed.). Oxford, UK: Clarendon Press. p. 1915. ISBN 0-19-861186-2. 
  8. ^ a b c d e f g h i j Elliott 1992, pp. 460–61.
  9. ^ a b Ali, Salim; Ripley, S. Dillon (2001). Handbook of the Birds of India and Pakistan, Volume 1 (2 (paperback) ed.). India: Oxford University Press. pp. 99–101. ISBN 0-19-565934-1. 
  10. ^ a b c Rasmussen, Pamela C.; Anderton, John C. (2005). Birds of South Asia: The Ripley Guide 2. Washington: Smithsonian Institution and Barcelona: Lynx edicions. p. 63. ISBN 84-87334-66-0. 
  11. ^ a b Elliott 1992, p. 437.
  12. ^ Kahl, M. Philip (1987). "An Overview of the Storks of the World". Colonial Waterbirds 10 (2): 131–34. doi:10.2307/1521251. 
  13. ^ Slikas, Beth (1997). "Phylogeny of the Avian Family Ciconiidae (Storks) Based on Cytochrome b Sequences and DNA–DNA Hybridization Distances". Molecular Phylogenetics and Evolution 8 (3): 275–300. doi:10.1006/mpev.1997.0431. ISSN 1055-7903. PMID 9417889. 
  14. ^ a b Dykes, Gareth J.; Alexander, Cyril Walker (2008). "New Records of Fossil 'Waterbirds' from the Miocene of Kenya". American Museum Novitates (3610). ISSN 0003-0082. hdl:2246/5906. 
  15. ^ Cramp, Stanley, ed. (1977). Handbook of the Birds of Europe, the Middle East and North Africa: Birds of the Western Palearctic, Volume 1, Ostrich to Ducks. Oxford University Press. p. 3. ISBN 0-19-857358-8. 
  16. ^ Mead,C. and Ogilvie, M. (2007) The Atlas of Bird Migrations: Tracing the Great Journeys of the Worlds Birds
  17. ^ Hancock & Kushan, Storks, Ibises and Spoonbills of the World. Princeton University Press (1992), ISBN 978-0-12-322730-0.
  18. ^ Grande, Juan Manuel; Negro, Juan José; María Torres, José (2004). "The evolution of bird plumage colouration; a role for feather-degrading bacteria?" (PDF). Ardeola 51 (2): 375–383. doi:10.1007/s00114-008-0462-0. Retrieved 2 April 2011. 
  19. ^ a b c d Cramp 1977, p. 335.
  20. ^ Negro, Juan José; Garrido-Fernandez, Juan (2000). "Astaxanthin is the Major Carotenoid in Tissues of White Storks (Ciconia ciconia) Feeding on Introduced Crayfish (Procambarus clarkii )". Comparative Biochemistry and Physiology Part B 126 (3): 347–52. doi:10.1016/S0305-0491(00)00180-2. 
  21. ^ Elliott 1992, p. 438.
  22. ^ a b c d e Cramp 1977, p. 328.
  23. ^ Van den Bossche 2002, p. 11.
  24. ^ a b Sinclair, Ian; Davidson, Ian (2006). Southern African Birds: a Photographic Guide. Cape Town, RSA: Struik. p. 34. ISBN 1-77007-244-6. 
  25. ^ Cramp 1977, p. 228.
  26. ^ Svensson and Grant 1999, p. 26.
  27. ^ Svensson and Grant 1999, p. 74.
  28. ^ Svensson and Grant 1999, p. 34.
  29. ^ Chernetsov, Nikita; Chromik, Wiesław; Dolata, Pawel T.; Profus, Piotr; Tryjanowski, Piotr (2006). "Sex-Related Natal Dispersal of White Storks (Ciconia ciconia) in Poland: How Far and Where to?" (PDF). The Auk 123 (4): 1103–09. doi:10.1642/0004-8038(2006)123[1103:SNDOWS]2.0.CO;2. ISSN 0004-8038. 
  30. ^ Van den Bossche 2002, p. 10.
  31. ^ Scully, John (1876). "A contribution to the ornithology of eastern Turkestan". Stray Feathers 4: 41–205. 
  32. ^ Ma, Ming; Dai, Cai (2002). "The fate of the White Stork (Ciconia ciconia asiatica) in Xinjiang, China". Abstract Volume. 23rd International Ornithological Congress, Beijing, August 11–17, 2002. p. 352. 
  33. ^ a b Berthold, Peter; Van Den Bossche, Willem; Fiedler, Wolfgang; Kaatz, Christoph; Kaatz, Michael; Leshem, Yossi; Nowak, Eugeniusz; Querner, Ulrich (2001). "Detection of a New Important Staging and Wintering Area of the White Stork Ciconia ciconia by Satellite Tracking". Ibis 143 (4): 450–55. doi:10.1111/j.1474-919X.2001.tb04946.x. 
  34. ^ a b Shamoun-Baranes, Judy; Baharad, Anat; Alpert, Pinhas; Berthold, Peter; Yom-Tov, Yoram; Dvir, Yoav; Leshem, Yossi (2003). "The Effect of Wind, Season and Latitude on the Migration Speed of White Storks Ciconia ciconia, Along the Eastern Migration Route" (PDF). Journal of Avian Biology 34: 97–104. doi:10.1034/j.1600-048X.2003.03079.x. 
  35. ^ a b Allan, David G. (1997). "White Stork". In Harrison, J.A.; Allan, D.G.; Underhill, L.G.; Herremans, M.; Tree, A.J. Parker, V.; Brown, C.J. (eds). The Atlas of Southern African Birds. Volume 1. Non-passerines. BirdLife South Africa. pp. 82–83. ISBN 0-620-20729-9. 
  36. ^ Whitehead, Charles Hughes Tempest (1911). "On the Birds of Kohat and the Kurram Valley. Northern India. Part 3". Journal of the Bombay Natural History Society 20 (4): 954–80. 
  37. ^ Prater, Stanley Henry (1931). "The Migration of the White Stork Ciconia ciconia". Journal of the Bombay Natural History Society 35 (2): 459. 
  38. ^ Jadeja, Vijayraj; Vyas, Raju; Parasharya, B.M. (1998). "Record of Ciconia ciconia asiaticus from Indian Territory". Journal of the Bombay Natural History Society 95 (1): 113. 
  39. ^ Snow, David (1998). Perrins, Christopher M, ed. The Birds of the Western Palearctic Concise Edition (2 volumes). Oxford, UK: Oxford University Press. pp. 141–43. ISBN 0-19-850188-9. 
  40. ^ Thomsen, Kai-Michael; Hötker, Hermann (2006). "The Sixth International White Stork Census: 2004–2005". In Boere G.C., Galbraith C.A., Stroud D.A. (eds). Waterbirds Around the World. Edinburgh, UK: The Stationery Office. pp. 493–95. ISBN 978-0-11-497333-9. 
  41. ^ a b c d Johst, Karin; Brandl, Rolan; Pfeifer, Robert (2001). "Foraging in a Patchy and Dynamic Landscape: Human Land Use and the White Stork". Ecological Applications 11: 60–69. doi:10.1890/1051-0761(2001)011[0060:FIAPAD]2.0.CO;2. ISSN 1051-0761. 
  42. ^ Samusenko, Irina (2004). "Some Aspects of White Stork Ciconia ciconia Population Dynamics in the Region of Chernobyl's Accident". Bird Census News 13 (2000): 157–60. 
  43. ^ Kruszyk, Robert, Ciach, Michał (2010). "White Storks, Ciconia ciconia, Forage on Rubbish Dumps in Poland—a Novel Behaviour in Population". European Journal of Wildlife Research 56 (1): 83–87. doi:10.1007/s10344-009-0313-0. 
  44. ^ Ciach, Michał; Kruszyk, Robert (2010). "Foraging of White Storks Ciconia ciconia on Rubbish Dumps on Non-breeding Grounds". Waterbirds 33 (1): 101–04. doi:10.1675/063.033.0112. 
  45. ^ a b c Carrascal, Luis María; Bautista, Luis Miguel; Lázaro, Encarnación (1993). "Geographical Variation in the Density of the White Stork Ciconia ciconia in Spain: Influence of Habitat Structure and Climate". Biological Conservation 65 (1): 83–87. doi:10.1016/0006-3207(93)90200-K. ISSN 0006-3207. 
  46. ^ Cavallin, Berith (1997). "Storklandskapet". Skånes Natur (in Swedish) 84: 1–160. 
  47. ^ Trewhella Steve (September 2010). White stork in Dorset. wildlifeextra.com
  48. ^ Gurney, John Henry (1921). Early Annals of Ornithology. London: H F & G Witherby. p. 80. 
  49. ^ Tryjanowski, Piotr; Sparks, Tim H.; Profus, Piotr (2005). "Uphill Shifts in the Distribution of the White Stork Ciconia ciconia in Southern Poland: the Importance of Nest Quality". Diversity and Distributions 11 (3): 219–23. doi:10.1111/j.1366-9516.2005.00140.x. ISSN 1366-9516. 
  50. ^ Ptaszyk, J.; Kosicki, J.; Sparks, T. H.; Tryjanowski, P. (2003). "Changes in the Timing and Pattern of Arrival of the White Stork (Ciconia ciconia) in Western Poland". Journal für Ornithologie 144 (3): 323–29. doi:10.1046/j.1439-0361.2003.03011.x. 
  51. ^ Sproll, Alexandra; Fiedler, Wolfgang (2001). "Digging in old Data: Migration and Causes of Death in White Storks (Ciconia ciconia) according to Ringing Recovery Data of the Vogelwarte Rossitten (Eastern Prussia) before the Second World War". Euring Newsletter (European Union for Bird Ringing) 3. 
  52. ^ Cramp 1977, p. 331.
  53. ^ a b c Reed, C. A.; Lovejoy, T. E. (1969). "The Migration of the White Stork in Egypt and Adjacent Areas" (PDF). The Condor 71 (2): 146–54. doi:10.2307/1366076. 
  54. ^ Leshem, Yossi; Yom-Tov, Yoram (1998). "Routes of Migrating Soaring Birds" (PDF). Ibis 140: 41–52. doi:10.1111/j.1474-919X.1998.tb04539.x. 
  55. ^ Alexander, R. McNeill (1992). Exploring Biomechanics, Animals in Motion. New York, New York: Scientific American Library. ISBN 0-7167-5035-X. 
  56. ^ Liechti, Felix; Ehrich, Dorothee; Bruderer, Bruno (1996). "Flight Behaviour of White Storks Ciconia ciconia on their Migration over Southern Israel" (PDF). Ardea 84: 3–13. Archived from the original on 2012-03-05. 
  57. ^ Newton 2010, pp. 74–75.
  58. ^ Newton 2010, p. 144.
  59. ^ Newton 2010, p. 229.
  60. ^ Chernetsov, Nikita; Berthold, Peter; Querner, Ulrich (2004). "Migratory Orientation of First-year White Storks (Ciconia ciconia): Inherited Information and Social Interactions". Journal of Experimental Biology 207 (6): 937–43. doi:10.1242/jeb.00853. ISSN 0022-0949. 
  61. ^ Meyburg, Bernd-U.; Matthes, Joachim; Meyburg, Christiane (2002). "Satellite-tracked Lesser Spotted Eagle Avoids Crossing Water at the Gulf of Suez" (PDF). British Birds 95: 372–76. 
  62. ^ Spaar, Reto; Bruderer, Bruno (1996). "Soaring Migration of Steppe Eagles Aquila nipalensis in Southern Israel: Flight Behaviour under Various Wind and Thermal Conditions" (PDF). Journal of Avian Biology 27 (4): 289–301. doi:10.2307/3677260. JSTOR 3677260. Archived from the original on 2012-03-05. 
  63. ^ a b Cocker, Mark; Mabey, Richard (2005). Birds Britannica. London, UK: Chatto & Windus. p. 58. ISBN 0-7011-6907-9. 
  64. ^ Sinclair, Ian; Hockey, Phil; Arlott, Norman (2005). The larger illustrated guide to birds of southern Africa. Cape Town, RSA: Struik. p. 34. ISBN 1-77007-243-8. 
  65. ^ a b Cramp 1977, p. 332.
  66. ^ a b Vergara, Pablo; Aguirre, José I. (2006). "Age and Breeding Success related to Nest Position in a White Stork Ciconia ciconia Colony" (PDF). Acta Oecologica 30 (3): 414–18. doi:10.1016/j.actao.2006.05.008. ISSN 1146-609X. 
  67. ^ Harrison, Colin James Oliver (1965). "Allopreening as Agonistic Behaviour". Behaviour 24 (3–4): 161–209. doi:10.1163/156853965X00011. JSTOR 4533105. 
  68. ^ Kahl, M. Philip (1984). "Spread-wing Postures and their Possible Functions in Ciconiidae" (PDF). The Auk 88 (4): 715–22. doi:10.2307/4083833. JSTOR 4086376. 
  69. ^ Elphick, Chris; Dunning, John B., Jr; Sibley, David (eds). The Sibley Guide to Bird Life and Behaviour. London, UK: Christopher Helm. p. 575. ISBN 0-7136-6250-6. 
  70. ^ Herholdt, J.J. (1987). "Recovery of a Ring-maimed White Stork". Safring News 16: 82. 
  71. ^ Lefebvre, Louis; Nicolakakis, Nektaria; Boire, Dennis (2002). "Tools and Brains in Birds" (PDF). Behaviour 139 (7): 939–73. doi:10.1163/156853902320387918. Retrieved 16 February 2011. 
  72. ^ a b c Cramp 1977, p. 334.
  73. ^ Cramp 1977, p. 333.
  74. ^ Henry, P. Y.; Wey, G. R.; Balança, G. (2011). "Rubber Band Ingestion by a Rubbish Dump Dweller, the White Stork (Ciconia ciconia)". Waterbirds 34 (4): 504–508. doi:10.1675/063.034.0414.  edit
  75. ^ Igaune, Kristine; Indrikis Krams; Krama, Tatjana; Bobkova, Jadviga (2008). "White Storks Ciconia ciconia Eavesdrop on Mating Calls of Moor Frogs Rana arvalis". Journal of Avian Biology 39 (2): 229–32. doi:10.1111/j.2008.0908-8857.04180.x. 
  76. ^ Antczak, Marcin; Konwerski, Szymon; Grobelny, Seweryn; Tryjanowski, Piotr (2002). "The Food Composition of Immature and Non-breeding White Storks in Poland". Waterbirds 25 (4): 424–28. doi:10.1675/1524-4695(2002)025[0424:TFCOIA]2.0.CO;2. ISSN 1524-4695. 
  77. ^ Parasharya, Bhavbhuti M.; Vyas, Raju (1998). "Foraging Association of White Stork Ciconia ciconia with Blackbuck Antilope cervicapra". Journal of the Bombay Natural History Society 95 (1): 112. 
  78. ^ Pande, Satish; Sant, Niranjan; Bhate, Rohan; Ponkshe, Aditya; Pandit, Pranav; Pawashe, Amit; Joglekar, Charu (2007). "Recent Records of Wintering White Ciconia ciconia and Black C. nigra Storks and Flocking Behaviour of White-necked Storks C. episcopus in Maharashtra and Karnataka States, India". Indian Birds (New Ornis Foundation, Hyderabad) 3 (1): 28–32. ISSN 0973-1407. 
  79. ^ Akhtar, S. Asad; Tiwari, J.K. (1993). "Food Piracy by a White Stork Ciconia ciconia (Linn.)". Journal of the Bombay Natural History Society 90 (1): 90–91. 
  80. ^ Kitowski, Ignacy (2007). "Why do Montagu's Harriers Disturb Foraging Sessions of White Storks in South-East Poland" (PDF). Berkut 16 (1): 110–18. 
  81. ^ Tryjanowski, Piotr; Sparks, Tim H.; Jerzak, Leszek (eds) (2006). The White Stork in Poland. Poznań, Poland: Bogucki Wydaw. ISBN 83-60247-35-8. 
  82. ^ a b Tryjanowski, Piotr; Kosicki, Jakub Z.; Kuzniak, Stanisław; Sparks, Tim H. (2009). "Long-term Changes and Breeding Success in Relation to Nesting Structures used by the White Stork, Ciconia ciconia". Annales Zoologici Fennici 46: 34–38. doi:10.5735/086.046.0104. 
  83. ^ Vergara, Pablo; Gordo, O.; Aguirre, José I. (2010). "Nest Size, Nest Building Behaviour and Breeding Success in a Species with Nest Reuse: the White Stork Ciconia ciconia" (PDF). Annales Zoologici Fennici 47 (3): 184–94. doi:10.5735/086.047.0303. 
  84. ^ Vergara, Pablo; Aguirre, José I.; Fargallo, Juan A.; Dávila, José A. (2006). "Nest-site fidelity and breeding success in White Stork Ciconia ciconia" (PDF). Ibis 148 (4): 672–77. doi:10.1111/j.1474-919X.2006.00565.x. 
  85. ^ Wuczyński, Andrzej (2005). "The Turnover of White Storks Ciconia ciconia on Nests During Spring Migration". Acta Ornithologica (PDF) 40 (1): 83–85. doi:10.3161/0001645054742651. 
  86. ^ Haverschmidt 1949, pp. 33–34.
  87. ^ Tortosa, Francisco S.; Redondo, Tomas (1992). "Frequent Copulations Despite Low Sperm Competition in White Storks (Ciconia ciconia)". Behaviour 121 (3&4): 288–315. doi:10.1163/156853992X00408. JSTOR 4535031. 
  88. ^ a b Pelt Lechner, A. A. van (1911). Oologia Neerlandica : Eggs of Birds Breeding in the Netherlands (Vol II). The Hague, Netherlands: Nijhof. p. 118. 
  89. ^ a b Zielinski, Piotr (2002). "Brood Reduction and Parental Infanticide – are the White Stork Ciconia ciconia and the Black Stork C. nigra Exceptional?" (PDF). Acta Ornithologica 37 (2): 113–19. doi:10.3161/068.037.0207. 
  90. ^ Tortosa, Francisco S.; Redondo, Tomas (1992). "Motives for Parental Infanticide in White Storks Ciconia ciconia". Ornis Scandinavica 23 (2): 185–89. doi:10.2307/3676447. JSTOR 3676447. 
  91. ^ Aguirre, José I.; Vergara, Pablo (2007). "Younger, Weaker White Stork (Ciconia ciconia) Nestlings Become the Best Breeders" (PDF). Evolutionary Ecology Research 9: 355–64. 
  92. ^ Tsachalidis, Efstathios P.; Liordos, Vasilios; Goutner, Vassilis (2005). "Growth of White Stork Ciconia ciconia Nestlings" (PDF). Ardea 93 (1): 133–37. 
  93. ^ Mužinic, Jasmina; Rašajski, Javor (1992). "On Food and Feeding Habits in the White Stork, Ciconia c. ciconia, in the Central Balkans" (PDF). Õkologie der Vögel (Ecology of Birds) 14: 211–23. 
  94. ^ Van den Bossche 2002, p. 8.
  95. ^ "EURING list of longevity records for European birds". EURING. 2010. Retrieved 2 December 2010. 
  96. ^ Błoszyk, Jerzy; Gwiazdowicz, Dariusz J.; Bajerlein, Daria; Halliday, Robert Bruce (2005). "Nests of the White Stork Ciconia ciconia (L.) as a Habitat for Mesostigmatic Mites (Acari, Mesostigmata)" (PDF). Acta Parasitologica 50 (2): 171–75. 
  97. ^ Bajerlein, Daria; Błoszyk, Jerzy; Gwiazdowicz, Dariusz J.; Ptaszyk, Jerzy; Halliday, Bruce (2006). "Community Structure and Dispersal of Mites (Acari, Mesostigmata) in Nests of the White Stork (Ciconia ciconia)". Biologia 61 (5): 525–30. doi:10.2478/s11756-006-0086-9. 
  98. ^ Rothschild, Miriam; Clay, Theresa (1953). Fleas, Flukes and Cuckoos. A Study of Bird Parasites. London, UK: Collins. p. 152. 
  99. ^ Trouessart, Édouard Louis and Mégnin, Jean Pierre (1885). "Monographie du genre Freyana et description des espèces nouvelles du Musée d'Angers". Bulletin De La Société D'Études Scientifiques D'Angers (in French) 14: 29–45. 
  100. ^ a b "Acari Collection & Systematics". Royal Museum for Central Africa. Retrieved March 10, 2012. 
  101. ^ Pugh, Geoffrey John Frederick (1972). "The Contamination of Birds' Feathers by Fungi". Ibis 114 (2): 172–77. doi:10.1111/j.1474-919X.1972.tb02602.x. 
  102. ^ Fryderyk, Sławomira; Izdebska, Joanna N. (2009). "Chewing Lice (Insecta, Phthiraptera) of the White Stork (Ciconia ciconia L.) in Poland". Annales UMCS, Biologia 64 (2): 83–88. doi:10.2478/v10067-010-0017-6. 
  103. ^ Ortega, Ynes R. (2006). Foodborne Parasites. New York, New York: Springer. p. 121. ISBN 0-387-30068-6. 
  104. ^ Franssen, F.F.; Hooimeijer, J.; Blankenstein, B.; Houwers, Dirk J. (2000). "Giardiasis in a White Stork in The Netherlands". Journal of Wildlife Diseases 36 (4): 764–66. doi:10.7589/0090-3558-36.4.764. PMID 11085441. 
  105. ^ Schuster, Rolf; Schaffer, Thoralf; Shimalov, Vladimir, R; Schaffer, T; Shimalov, V (2002). "[The Helminth Fauna of Indigenous White Storks (Ciconia ciconia)]". Berliner und Munchener Tierarztliche Wochenschrift (in German) 115 (11–12): 435–39. PMID 12481650. 
  106. ^ Höfle, U.; Krone, O.; Blanco, J. M.; Pizarro, M. (2003). "Chaunocephalus ferox in Free-Living White Storks in Central Spain". Avian Diseases 47 (2): 506–12. doi:10.1637/0005-2086(2003)047[0506:CFIFWS]2.0.CO;2. ISSN 0005-2086. PMID 12887215. 
  107. ^ Hayes, Edward B.; Komar, Nicholas; Nasci, Roger S.; Montgomery, Susan P.; O'Leary, Daniel R.; Campbell, Grant L. (2005). "Epidemiology and Transmission Dynamics of West Nile Virus Disease". Emerging Infectious Diseases 11 (8): 1167–73. doi:10.3201/eid1108.050289a. PMC 3320478. PMID 16102302. 
  108. ^ Malkinson, M.; Banet, C. (2002). "The Role of Birds in the Ecology of West Nile Virus in Europe and Africa". Current Topics in Microbiology and Immunology. Current Topics in Microbiology and Immunology 267: 309–22. doi:10.1007/978-3-642-59403-8_15. ISBN 978-3-642-63966-1. PMID 12082995. 
  109. ^ Zeller, Hervé G.; Schuffenecker, Isabelle (2004). "West Nile Virus: An Overview of Its Spread in Europe and the Mediterranean Basin in Contrast to Its Spread in the Americas". European Journal of Clinical Microbiology & Infectious Diseases 23 (3): 147–56. doi:10.1007/s10096-003-1085-1. ISSN 0934-9723. PMID 14986160. 
  110. ^ Malkinson, Mertyn; Banet, Caroline; Weisman, Yoram; Pokamunski, Shimon; King, Roni; Drouet, Marie-Thérèse; Deubel, Vincent (2002). "Introduction of West Nile virus in the Middle East by Migrating White Storks". Emerging Infectious Diseases 8 (4): 392–97. doi:10.3201/eid0804.010217. PMC 2730252. PMID 11971773. 
  111. ^ Hubálek, Zdenek; Wegner, Elżbieta; Halouzka, Jiří; Tryjanowski, Piotr; Jerzak, Leszek; Sikutová, Silvie; Rudolf, Ivo; Kruszewicz, Andrzej G.; Jaworski, Zbigniew; Wlodarczyk, Radoslaw (2008). "Serologic Survey of Potential Vertebrate Hosts for West Nile Virus in Poland". Viral Immunology 21 (2): 247–54. doi:10.1089/vim.2007.0111. 
  112. ^ Berthold, Peter; Fiedler, Wolfgang; Querner, Ulrich (2000). "White Stork (Ciconia ciconia) migration studies: basic research devoted to conservation measures". Global Environment Research 2: 133–41. 
  113. ^ "Annex 2: Waterbird Species to Which the Agreement Applies" (PDF). Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA). UNEP/ AEWA Secretariat. Retrieved 9 December 2010. 
  114. ^ "Introduction". African-Eurasian Waterbird Agreement. UNEP/ AEWA Secretariat. Retrieved 9 December 2010. 
  115. ^ a b "Preliminary Results of the VI International White Stork Census 2004/05". Naturschutzbund Deutschland (NABU). Archived from the original on 12 August 2011. Retrieved 14 January 2012. 
  116. ^ "National data". Naturschutzbund Deutschland (NABU). Retrieved 14 January 2012. 
  117. ^ Moore, Molly (22 June 2008). "French region saves iconic White Storks from brink: population hits 270 pairs after dwindling to nine". The Washington Post. p. A10. 
  118. ^ a b Altenburg, Jouke (2010). "Restoring the Dutch White Stork Population: a Charismatic Species Brought Back by Targeted Conservation Work". Birdlife International. Vogelbescherming Netherlands (BirdLife Netherlands). Retrieved 30 January 2011. 
  119. ^ "The Swedish White Stork Reintroduction Program". Valkommen till Storkprojektet!. Scanian Ornithological Society (SkOF). 17 December 2010. Retrieved 8 February 2011. 
  120. ^ a b Moritzi, Martin; Maumary, Lionel; Schmid, David; Steiner, Isabelle; Vallotton, Laurent; Spaar, Reto; Biber, Olivier (2001). "Time Budget, Habitat Use and Breeding Success of White Storks (Ciconia ciconia) under Variable Foraging Conditions During the Breeding Season in Switzerland" (PDF). Ardea 89 (3): 457–70. 
  121. ^ Schaub, Michael; Pradela, Roger; Lebretona, Jean-Dominique (2004). "Is the Reintroduced White Stork (Ciconia ciconia) Population in Switzerland Self-sustainable?" (PDF). Biological Conservation 119 (1): 105–14. doi:10.1016/j.biocon.2003.11.002. 
  122. ^ West, John Anthony (1995). The Traveler's Key to Ancient Egypt: a Guide to the Sacred Places of Ancient Egypt. Wheaton, Illinois: Theosophical Publishing House. p. 64. ISBN 0-8356-0724-0. 
  123. ^ a b c d e f g h i Margolis, Marvin; Parker, Philip (1972). "The Stork Fable−Some Psychodynamic Considerations". Journal of the American Psychoanalytic Association 20 (3): 494–511. doi:10.1177/000306517202000304. PMID 4116100. 
  124. ^ Aesop (c. 620–564 BCE). Fables. ISBN 1-56156-088-X. 
  125. ^ Dolata, Pawel T. (2006). "The White Stork Ciconia ciconia protection in Poland by tradition, customs, law, and active efforts". In Tryjanowski, Piotr; Sparks, Tim H.; Jerzak, L. (eds). The White Stork in Poland: Studies in Biology, Ecology and Conservation. Poznań, Poland: Bogucki Wydawnictwo Naukowe. ISBN 83-60247-35-8. 
  126. ^ Royds, Thomas Fletcher (1914). The beasts, birds, and bees of Virgil; a naturalist's handbook to the Georgics. Oxford, UK: Oxford. 
  127. ^ Thomas, Richard F. (1988). "Vergil's "White Bird" and the Alexandrian reference (G. 2. 319-20)". Classical Philology 83 (3): 214–17. doi:10.1086/36710. 
  128. ^ a b Sax, Boria (2001). The Mythical Zoo. Oxford, UK: ABC-CLIO. pp. 153–54. ISBN 1-57607-612-1. 
  129. ^ Kinzelbach, Ragnar (2003). "Der Pfeilstorch in der Zoologischen Sammlung der Universität Rostock". Der Sprössling: Fachschaftsrat Biologie der Universität Rostock (in German) (3): 9–10. 
  130. ^ Unknown (1831). Descriptive scenes for children. Boston, Massachusetts: N. S. and S. G. Simpkins. p. 3. OCLC 31373438. 
  131. ^ Hardwick, Charles (1872). Traditions, Superstition and Folk-lore. Manchester. UK: A. Ireland and Co. pp. 238, 247–48. 
  132. ^ "Stork". Encyclopedia of Ukraine. Canadian Institute of Ukrainian Studies. Retrieved 5 December 2010. 
  133. ^ Scharning, Kjell. "White Stork". Theme Birds on Stamps. Retrieved 5 December 2010. 
  134. ^ "Lithuania". Understanding the European Union: Member States. Centre d'Information sur les Institutions Européennes (CIIE). Retrieved 5 December 2010. 
  135. ^ "Kingdom of Storks". PAIIZ NEWSLETTER, number 14, 22nd March 2007. Polish Information and Foreign Investment Agency (PAIIZ).  Retrieved 18 March 2011
  136. ^ Hulme, F. Edward (1895). Natural History Lore and Legend. London, UK: Bernard Quaritch. pp. 17–18. 
  137. ^ Norwid, Cyprian Kamil. "My Song (II)". Polish Literature. LDS Mission Network. Retrieved 23 December 2010. 
  138. ^ Jacobs, Alvin H.; Walton, Robert G. (1976). "The Incidence of Birthmarks in the Neonate". Pediatrics 58 (2): 218–222. 
  139. ^ Gieysztor, Aleksander (1982). Mitologia Słowian (in Polish). Warsaw, Poland: Wydawnictwa Artystyczne i Filmowe. ISBN 83-221-0152-X. 
  140. ^ Jakubiec, Z. (2009). "Dlaczego bocian przynosił dzieci?". Bocianopedia (in Polish). Retrieved 10 March 2011. 
  141. ^ Szczepanowicz, Barbara (2005). "Ptaki Ziemi Świętej: bocian, czapla, ibis [Birds in the Holy Land: stork, heron, ibis]". Ziemia Święta (in Polish) (rok XI 1(41)). Retrieved 8 February 2011. 
  142. ^ Matthews, Robert (2000). "Storks Deliver Babies (p=0.008)" (PDF). Teaching Statistics 22 (2): 36–38. doi:10.1111/1467-9639.00013. 
  143. ^ Didelez, Vanessa (2007). "Statistical Causality". In Østreng, Willy (ed). Consilience: Interdisciplinary Communications 2005/2996. Centre for Advanced Study, Oslo. pp. 114–20. ISBN 978-82-996367-4-2. 
  144. ^ Bay, Mia (2000). The White Image in the Black Mind: African-American Ideas about White People, 1830–1925. New York, New York: Oxford University Press. p. 120. ISBN 0-19-513279-3. 
  145. ^ Jung, Carl (1910). "The Association Method – Lecture III: Experiences Concerning the Psychic Life of the Child". American Journal of Psychology 31 (3): 219–69. doi:10.2307/1413002. JSTOR 1422691. Retrieved 2 March 2011. 
  146. ^ Pickles, Penny (2011). "Jung the Man". The Society of Analytical Psychology: Jungian Analysis and Psychotherapy. London: The Society of Analytical Psychology. Retrieved 2 March 2011. 
  147. ^ de Vries, Ad (1976). Dictionary of Symbols and Imagery. Amsterdam: North-Holland Publishing Company. p. 445. ISBN 0-7204-8021-3. 
  148. ^ Patrick Leigh Fermor, ed. Colin Thubron and Artemis Cooper (2014). The Broken Road. From the Iron Gates to Mount Athos. London: John Murray. p. 54. ISBN 978-1-84854-754-4.

Works cited[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!