Articles on this page are available in 2 other languages: Spanish (17), Dutch (1) (learn more)

Overview

Brief Summary

Do you ever see a hen harrier in the Netherlands? Then you are very fortunate! These beautiful birds are having a very difficult time surviving in this country. They are only found in just a few places and their numbers keep dropping. It is unknown why this is happening, but is probably due to a lack of food and a decline in their breeding grounds. Just like the marsh harrier, hen harriers have a shallow V-shaped sillouette as they scan the ground for prey or glide low over the ground.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circus cyaneus

Intermediate in appearance between the slim bird hawks (genus Accipiter) and thick-set buzzards (genus Buteo), the Northern Harrier is most easily identified by its size (17 ½ - 24 inches), long wings, long squared-off tail, and conspicuous white rump patch. Male Northern Harriers are light gray above and pale below, while females are solid brown above and streaked brown and tan below. Like most species of raptors, females are larger than males. The Northern Harrier is found widely across Eurasia (where it is known as the Hen Harrier) and North America. In the New World, this species breeds across Canada, Alaska, and the northern tier of the United States. In winter, Northern Harriers may be found from the southern Great Lakes and Pacific Northwest south to Mexico, Central America, and the West Indies. In the Old World, this species breeds across northern Europe and Asia south to Portugal and northern China, wintering as far south as North Africa and South Asia. The Northern Harrier inhabits a variety of open habitats, including grassland, marshes, and agricultural fields. This species avoids built-up areas and forests. The diet of the Northern Harrier consists primarily of small mammals and songbirds. Due to this species’ preference for open habitat, Northern Harriers may be most easily observed flying low over the tops of tall grasses in search of prey. Less frequently, Northern Harriers may be seen soaring high over open areas, displaying their characteristic long tail and wings. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 44-52 cm, envergure 100-120 cm, poids 300-600 g.

Il habite toutes sortes de terrains ouverts, à tendance sèche et à couverture végétale basse (cultures, friches, landes, coupes forestières…). En hiver, il est souvent trouvé dans les cultures, prairies, landes et zones humides. La sélection de l’habitat est gouvernée par la disponibilité de la proie principale.

Le Busard Saint-Martin se nourrit surtout de petits oiseaux et rongeurs saisis par surprise. Il est le plus agile des busards européens et capture (notamment le mâle) plus de proies rapides – passereaux, en particulier – que ses congénères. Lorsqu’il chasse les campagnols, il se déplace lentement (environ 20-30 km/h) et ignore les oiseaux volants, tandis que lorsqu’il chasse les oiseaux, son vol de recherche peut dépasser les 40 km/h. Il arrive qu’il parasite d’autres oiseaux de proie tels que le Busard cendré, le Faucon crécerelle ou le Hibou des marais.

C’est un chasseur solitaire tout au long de l’année, qui peut s’assembler là où les ressources alimentaires abondent (rarement plus de 10 individus ensemble). En hiver, bien que moins sédentaire qu’en saison de reproduction, il tend à fréquenter un territoire individuel, au moins pendant quelques semaines. L’espèce est généralement monogame mais des harems se forment certaines années dans certaines populations. Lors des bonnes années à rongeurs, les nids, normalement très dispersés, peuvent être regroupés en colonies lâches, à quelques centaines de mètres les uns des autres. Le mâle commence à nourrir la femelle dès les premières étapes de construction du nid, puis l’approvisionne entièrement durant l’incubation et les premiers jours de la nichée. Les proies sont souvent passées à la femelle en vol, de façon spectaculaire et en criant.

Le nid est un amoncellement de végétation récoltée alentour (herbes, bruyères, joncs…) dont la hauteur varie selon les sites choisis (jusqu’à 45 cm dans les sites humides). Il est construit au sol dans la végétation épaisse. La ponte de 4 à 6 œufs (maximum 12, mais il peut alors s’agir d’une 2e couvée ajoutée à la 1ère) est déposée à partir de la fin-avril. L’incubation dure environ 1 mois et les jeunes s’envolent à l’âge de 32-42 jours, les mâles étant plus précoces que les femelles.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range in North America extends from northern Alaska to northern Saskatchewan and southern Quebec; south to northern Baja California, southern Texas, southern Missouri, West Virginia, southeastern Virginia, and North Carolina (and formerly Florida). In Eurasia, breeding occurs from the British Isles, Scandinavia, northern Russia, and Siberia south to the Mediterranean region, southern Russian, Turkestan, Amurland, Ussuriland, Sakhalin, and the Kurile Islands (AOU 1998). The species breeds rarely or erratically south of the North American breeding range (MacWhirter and Bildstein 1996). Breeding range is large but often highly discontinuous. During the nonbreeding season in North America the range extends from southern Canada or the northern contiguous United States south through the United States, Middle America, and the Antilles to northern Colombia, Venezuela, and Barbados; casual or accidental in Hawaii (AOU 1998, MacWhirter and Bildstein 1996). In North America, northern harriers winter in largest numbers in the Great Basin and central and southern Great Plains (Root 1988). The coastal areas of New York, New Jersey, Delaware, Maryland, and Virginia support the highest number of wintering birds in the Northeast (National Audubon Society 1971-74, 1982-83, 1985-87). During the nonbreeding season in Eurasia the range extends from the British Isles, southern Scandinavia, and southern Japan south to northwestern Africa, Asia Minor, India, Burma, eastern China, and the Ryukyu Islands (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
ID IL IN IA KS KY LA ME MD
MA MI MN MS MO MT NE NV NH NJ
NM NY NC ND OH OK OR PA RI SC
SD TN TX UT VT VA WA WV WI WY
AB BC MB NB NF NT NS ON PE PQ
SK YT MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Northern harriers are found throughout the northern hemisphere. In the Americas (the Nearctic) they breed throughout North America from Alaska and much of Canada to as far south as Baja California, New Mexico, Texas, Kansas, and North Carolina. They are only rarely seen breeding in parts of the Atlantic coastal states, such as Vermont, Rhode Island, and Maine and are also rare in the arid and mountainous western regions, including most of California, Oregon, and Washington. Their winter range is from southern Canada to the Caribbean and Central America.

In the Palearctic, northern harriers breed throughout Eurasia, from Portugal in the west, to Lapland and Siberia in the north, and east through China. They winter in northern African and tropical Asia.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native )

Other Geographic Terms: holarctic

  • Macwhirter, R., K. Bildstein. 1996. Northern Harrier. The Birds of North America, 210: 1-25.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The northern harrier has a circumpolar distribution. In North America,
it is found from north Alaska east across Canada to the Atlantic Coast,
and south to Mexico [8,16]. It breeds from the northernmost part of
its range through the central states, and winters in the southern states.
Some populations are year-round residents [16].
  • 8. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 16. Johnsgard, Paul A. 1990. Hawks, eagles, and falcons. Washington, DC: Smithsonian Institution Press. 403 p. [21510]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Northern harriers are found throughout the northern hemisphere. In the Americas they breed throughout North America from Alaska and Canadian provinces south of tundra regions south as far as Baja California, New Mexico, Texas, Kansas, and North Carolina. They are only rarely seen breeding in parts of the Atlantic coastal states, such as Vermont, Rhode Island, and Maine and are similarly rare in the arid and mountainous western interior, including most of California, Oregon, and Washington. Their winter range is from southern Canada to the Caribbean and Central America.

In the Palearctic, northern harriers breed throughout Eurasia, from Portugal in the west, to Lapland and Siberia in the north, and east through China. They winter in northern African and tropical Asia.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native )

Other Geographic Terms: holarctic

  • Macwhirter, R., K. Bildstein. 1996. Northern Harrier. The Birds of North America, 210: 1-25.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Northern harriers have several characteristics which distinguish them from other birds. Feathers around their face in the shape of a disk focus sound into their ears. Their wings form a v-shape during flight. They also have a white rump which is visible during flight.

Adult harriers have yellow eyes. Males are gray on their back side. On the front they are white with darker spots on their chests and black tips on their wings. Adult females are brown with white strips on the undersides of their wings. Immature harriers resemble adult females, bt they are a darker shade of brown with a rusty colr underneath. Immature harriers have brown eyes.

The length of adult males varies between 41 and 45 cm (16 to 18 in). The length of adult females varies between 45 and 50 cm (18 to 20 in). Typically the wingspan of adult males varies between 97 and 109 cm (38 to 43 in). The wingspan of adult females varies between 111 and 122 cm (44 to 48 in). The weight of adult males is approximately 290 to 390 grams(1/2 to 1 lb). The average weight of adult females is approximately 390 to 600 grams(1 to 1.3lbs). (Wheeler and Clark 1995,Weidensaul 1996,Ryser 1985,Wheeler and Clark 1987)

Range mass: 290 to 600 g.

Range length: 41 to 50 cm.

Range wingspan: 340 to 384 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger; sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Northern harriers have several characteristics which distinguish them from other birds. Specialized feathers around their face in the shape of a disk focus sound into their ears. Their wings form a dihedral when in gliding flight, and they have a distinctive white rump patch which is obvious during flight.

Adult harriers have yellow eyes. Adult males are gray on their dorsal side. Ventrally, they are white, except for spots on their chest, and black wingtips. Adult females are a brown color, except for underneath their wings, where there are white stripes. Immature males and females resemble the adult female, but they have a darker shade of brown covering the dorsal side and a brownish rusty color underneath. Immature harriers have brown eyes.

The length of adult males varies between 41 and 45 cm (16 to 18 in). The length of adult females varies between 45 and 50 cm (18 to 20 in). Typically the wingspan of adult males varies between 97 and 109 cm (38 to 43 in). The wingspan of adult females varies between 111 and 122 cm (44 to 48 in). The weight of adult males is approximately 290 to 390 grams(1/2 to 1 lb). The average weight of adult females is approximately 390 to 600 grams(1 to 1.3lbs). (Wheeler and Clark 1995,Weidensaul 1996,Ryser 1985,Wheeler and Clark 1987)

Range mass: 290 to 600 g.

Range length: 41 to 50 cm.

Range wingspan: 340 to 384 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger; sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 58 cm

Weight: 531 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Adults and immatures of both sexes have a distinctive, white rump patch.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: BREEDING: Marshes, meadows, grasslands, and cultivated fields. Perches on ground or on stumps or posts. Nests on the ground, commonly near low shrubs, in tall weeds or reeds, sometimes in bog; or on top of low bush above water, or on knoll of dry ground, or on higher shrubby ground near water, or on dry marsh vegetation.

NORTHEAST: A wide range of open habitats and vegetative associations are used, including abandoned fields, upland maritime heaths, wet hayfields, salt marshes, and cattail marshes (Serrentino 1992). Nests are placed on the ground, usually in dense cover. Nesting sites have included abandoned fields in dense stands of meadowsweet (Spiraea latifolia) or red-osier dogwood (Cornus stolonifera) in New Hampshire (Serrentino 1987), upland maritime heaths comprised of northern bayberry (Myrica pensylvanica), black huckleberry (Gaylussacia baccata) and wild rose (Rosa spp.) in Massachusetts (Holt and Melvin 1986), and in wet hayfields dominated by reed canary grass (Phalaris arundinacea) in Vermont (Laughlin and Kibbe 1985). Breeding sites in New Jersey saltmarshes on the Atlantic coast have been found in pure stands of common reed (Phragmites australis), as well as in salt hay grass (Spartina patens) and smooth cordgrass (Spartina alterniflora) (Dunne 1984). On Long Island, nests were found in stands of common reed and poison ivy (Toxicodendron radicans) (England 1989).

Other nesting habitats in the Northeast are cattail marshes (Laughlin and Kibbe 1985, Serrentino 1989), bogs (Hall 1983, Laughlin and Kibbe 1985, Andrle and Carroll 1988), native grassland prairies (Genoways and Brenner 1985), and dwarf conifer forest (England 1989). In other regions of North America, harriers nest in a variety of upland and wetland habitats such as willow (SALIX spp.) swales and meadows (Hamerstrom and Kopeny 1981), pure stands of blackberry (RUBUS spp.) (Toland 1985), hayfields and cropland (Duebbert and Lokemoen 1977, Follen 1986) and undisturbed grass/legume vegetation (Duebbert and Lokemoen 1977).

CALIFORNIA: In California, habitats include freshwater marshes, brackish and saltwater marshes, wet meadows, weedy borders of lakes, rivers and streams, annual and perennial grasslands (including those with vernal pools), weed fields, ungrazed or lightly grazed pastures, some croplands (especially alfalfa, grain, sugar beets, tomatoes, and melons), sagebrush flats, and desert sinks (MacWhirter and Bildstein 1996, J. Silveira in litt., J. Seay in litt.) (Shuford and Gardali 2008). Harriers nest on the ground, mostly within patches of dense, often tall, vegetation in undisareas (MacWhirter and Bildstein 1996).

NON-BREEDING: In the Northeast, winter in greatest numbers in the saltmarshes of the Atlantic coast, with the winter population exhibiting a tendency to increase from north to south (National Audubon Society 1971-74, 1982-83, 1985-87). Although harriers appear to prefer coastal regions in the Northeast, they will range inland during the winter when suitable open habitats are available (Root 1988), though avoiding the mountainous interior. Other habitats used by harriers during the nonbreeding season in both coastal and inland areas include agricultural fields (croplands, hayfields, and pastures), abandoned fields, and freshwater wetlands. Elsewhere in North America, wintering harriers have been observed in habitats similar to those in the Northeast (Craighead and Craighead 1956, Bildstein 1978, Temeles 1986, Collopy and Bildstein 1987, Littlefield and Thompson 1987).

WINTER ROOSTS: Communal roosting flocks may be formed during the nonbreeding season, beginning in October and often breaking up at the onset of spring migration (Bildstein 1979). Harriers roost on the ground in open habitats such as agricultural and abandoned fields, and saltmarshes (Weller et al. 1955, Mumford and Danner 1974, Bildstein 1979, Evans 1982, Bosakowski 1983). The same roost may be used for several nights or for several months (Bent 1937, Craighead and Craighead 1956). The number of birds using roosts varies from several to 60 individuals, and roosts may be shared with short-eared owls (Asio flammeus). Roost sites may be abandoned during periods of flooding or heavy snow (Bildstein 1979) or when prey becomes depleted in areas adjacent to roosts (Craighead and Craighead 1956, Bildstein 1979).

HUNTING HABITAT: Selection of hunting habitat is affected by several parameters including proximity to the nest site (Schipper 1977, Martin 1987, Serrentino 1987), sex and age of the individual (Schipper et al. 1975, Bildstein 1978, Marquiss 1980), prey abundance and availability (Schipper et al. 1975), vegetation structure (Schipper et al. 1975, Temeles 1986), and the presence of competitors (Temeles 1986). During the breeding season, females often hunt in areas adjacent to the nest site (Schipper 1977, Martin 1987, Serrentino 1987). Males hunt farther from the nest where they may encounter habitat types different than those located adjacent to nests.

Differences in habitat selection have been observed among adult females, adult males, and juveniles. In Ohio, intersexual differences in habitat selection were related to prey choice (Bildstein 1978). Females were observed significantly more often than males in fallow fields where small mammals were common. Adult males preferred corn stubble where avian prey was predominant. Males took more birds than females (40% vs. 4%), while females were principally small mammal specialists (93% for females versus 56% for males). Unsexed juveniles relied primarily on mammals.

Harriers select habitats on the basis of the availability and abundance of prey species. In the Netherlands, harriers preyed upon common voles (Microtus arvalis) in agricultural areas when voles were accessible and populations were high (Schipper et al. 1975). However, when voles became concealed by heavy snowfall, harriers hunted in reedbeds where avian prey was common.

During the nonbreeding season harriers may defend hunting territories (Temeles 1986). In California, females defended hunting territories against other females and males, and aggressively excluded males from preferred hunting habitats such as fallow fields. The substantial size difference between male and female harriers is probably responsible for female dominance of males.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour In the northern part of its range, it is completely migratory, wintering in Europe (Scotland and further south), extreme North Africa, southern Asia, and from southern Canada south to Colombia in the New World. It leaves breeding grounds between August and November, returning between March and May (del Hoyo et al. 1994). Birds are generally solitary and hunt alone but gather at concentrations of food and roosts, where they typically number tens of individuals, and may form loose flocks on migration (del Hoyo et al. 1994, Snow and Perrins 1998, Ferguson-Lees and Christie 2001). Migration is usually on a broad front, with birds willing to cross wide expanses of water and thus not concentrating at narrow crossing points as do many raptors (del Hoyo et al. 1994, Snow and Perrins 1998). Habitat It is generally a bird of open country, where there is some limited cover from vegetation (del Hoyo et al. 1994). Diet It generally feeds on small vertebrates, mostly mammals and birds (del Hoyo et al. 1994, Ferguson-Lees and Christie 2001). Breeding site The nest is made in dense vegetation on the ground (del Hoyo et al. 1994). Management information The species requires open habitat but some shrub cover is necessary (del Hoyo et al. 1994).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

Northern harriers inhabit wetland plant communities of sedge (Carex
spp.), rush (Juncus spp.), reed (Phragmites spp.), bulrush (Scirpus
spp.), willow (Salix spp.), and tamarisk (Tamarix spp.) [6,16].
  • 6. Cornely, J. E.; Britton, C. M.; Sneva, F. A. 1983. Manipulation of flood meadow vegetation and observations on small mammal populations. Prairie Naturalist. 15: 16-22. [14509]
  • 16. Johnsgard, Paul A. 1990. Hawks, eagles, and falcons. Washington, DC: Smithsonian Institution Press. 403 p. [21510]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern harriers are found mainly in open habitats such as fields, savannas, meadows, marshes, upland prairies, and desert steppe. They also occur in agricultural areas and riparian zones. Densest populations are found in large expanses of undisturbed, open habitats with dense, low vegetation. In eastern North America northern harriers are found most frequently in wetland habitats. In western North America they are most abundant in upland habitats such as desert steppe. Northern harriers avoid forested and mountainous areas.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral

Wetlands: marsh

Other Habitat Features: agricultural ; riparian

  • Eastman, J. 1999. Birds of Lake, Pond, and Marsh. Pennsylvania, USA: Stackpole Books.
  • Wheeler, B., W. Clark. 1987. The Peterson Field Guide Series- A Field Guide to Hawks of North America. Boston: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the term: tussock

Northern harriers prefer sloughs, wet meadows, marshlands, swamps,
prairies, plains, grasslands, and shrublands [8]. They nest on the
ground, usually near water, or in tall grass, open fields, clearings, or
on the water. In the latter case, nests are built on a stick
foundation, willow clump, or sedge tussock [8]. Northern harriers
prefer low perches such as fence posts or stumps. For hunting, they use
large forest openings. They occur from sea level to 10,400 feet (3,200
m) in elevation [17].
  • 8. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 17. Kochert, Michael N. 1986. Raptors. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Denver Service Center: 313-349. [13527]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

16 Aspen
63 Cottonwood
74 Cabbage palmetto
105 Tropical hardwoods
106 Mangrove
217 Aspen
238 Western juniper
239 Pinyon - juniper

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: shrub

K023 Juniper - pinyon woodland
K038 Great Basin sagebrush
K039 Blackbrush
K048 California steppe
K049 Tule marshes
K050 Fescue - wheatgrass
K055 Sagebrush steppe
K056 Wheatgrass - needlegrass shrubsteppe
K059 Trans-Pecos shrub savanna
K063 Foothills prairie
K064 Grama - needlegrass - wheatgrass
K066 Wheatgrass - needlegrass
K067 Wheatgrass - bluestem - needlegrass
K068 Wheatgrass - grama - buffalograss
K069 Bluestem - grama prairie
K072 Sea oats prairie
K073 Northern cordgrass prairie
K074 Bluestem prairie
K075 Nebraska Sandhills prairie
K076 Blackland prairie
K077 Bluestem - sacahuista prairie
K078 Southern cordgrass prairie
K079 Palmetto prairie
K080 Marl - everglades
K081 Oak savanna
K084 Cross Timbers
K086 Juniper - oak savanna
K087 Mesquite - oak savanna
K088 Fayette prairie
K092 Everglades
K105 Mangrove
K114 Pocosin

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES19 Aspen-birch
FRES29 Sagebrush
FRES30 Desert shrub
FRES32 Texas savanna
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands
FRES42 Annual grasslands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

Northern harriers need open, low woody or herbaceous vegetation for
nesting and hunting [8]. Harriers usually nest adjacent to hunting
grounds and where nest predation is low. Their food base should be
within 11.2 miles (18 km) of their nests [21]. They use disproportionate
amounts of rank grasses, sedges (Carex spp.), willows (Salix spp.),
goldenrod (Solidago spp.) and nettle (Urtica spp.) for nest building
relative to the abundance of those plant genera [16]. In Massachusetts,
northern harriers nest in mixed stands of shining sumac (Rhus
copallina), Virginia rose (Rosa virginiana), pasture rose (R. carolina),
northern arrowwood (Viburnum recognitum), and highbush blueberry
(Vaccinium corymbosum) [5].
  • 8. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 5. Dusek, G. L. 1975. Vegetational responses by substrate, gradient, and aspect on a twelve acre test plot in the Bull Mountains. In: Clark, W. F., ed. Proceedings of the Fort Union Coal Field symposium; [Date unknown]
  • 16. Johnsgard, Paul A. 1990. Hawks, eagles, and falcons. Washington, DC: Smithsonian Institution Press. 403 p. [21510]
  • 21. Simmons, Robert; Smith, P. C. 1985. Do northern harriers (Circus cyaneus) choose nest sites adaptively?. Canadian Journal of Zoology. 63: 494-498. [21508]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern harriers are found mainly in open habitats such as fields, savannas, meadows, marshes, upland prairies, and desert steppe. They also occur in agricultural areas and riparian zones. Densest populations are found in large expanses of undisturbed, open habitats with dense, low vegetation. In eastern North America northern harriers are found most frequently in wetland habitats. In western North America they are most abundant in upland habitats such as desert steppe. Northern harriers avoid forested and mountainous areas.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral

Wetlands: marsh

Other Habitat Features: agricultural ; riparian

  • Eastman, J. 1999. Birds of Lake, Pond, and Marsh. Pennsylvania, USA: Stackpole Books.
  • Wheeler, B., W. Clark. 1987. The Peterson Field Guide Series- A Field Guide to Hawks of North America. Boston: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 51 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Generally arrives in northern breeding areas in March-April (and May in Alaska). Northward migration may continue in an area even after local nesting has begun. Southward migration in the U.S. and Canada occurs August-November. Northern breeders may migrate farther south than do some more sedentary populations breeding at lower latitudes (Palmer 1988). In Costa Rica, arrives in early October, departs by early May (Stiles and Skutch 1989).

During migration, harriers move in a broad front at heights up to 770 m (Kerlinger 1989). They have been observed traveling along both coastal and inland ridges at numerous sites in eastern North America (Nagy 1977, Bildstein et al. 1984, Heintzelman 1986, Dunne and Sutton 1986). Sattler and Bart (1984) stated that harriers may not be as conspicuous as other raptors during migration because of their frequent use of flapping flight versus soaring, and their tendency to migrate individually or in small flocks. Harriers do not appear to avoid crossing water during migration. They have been seen "island hopping" in Maine, and have been observed in Bermuda, the Bahamas, and the West Indies (Bildstein 1988, Kerlinger 1989).

Most of the information on harrier migration comes from the autumn season. In the Northeast, the peak of fall migration occurs during September in Maine (Appell 1986), from the last week in September to the first week in October in Rhode Island (C. Raithel, pers. comm.), and from early October to mid-November in Maryland (Stewart and Robbins 1958). In West Virginia, one or two harriers are usually observed migrating over the eastern mountain ridges from September to early October (Hall 1983). At Hawk Mountain in Pennsylvania, the peak period for harrier migration is October and November, although their entire migratory period ranges from August to November (Broun 1939, Spofford 1969, Nagy 1977). During August and September, immature harriers are the most common, followed by both adults and immatures in varying numbers in October. Adult males are predominant later in the season (Nagy 1977). Using data from four raptor banding stations (Cape May Point and Kittatinny Mountain, New Jersey; Hawk Cliff, Ontario; and Duluth, Minnesota), Bildstein et al. (1984) found similar trends in the timing of migration with respect to sex and age as that observed by Nagy (1977) at Hawk Mountain.

During the spring migration in central Wisconsin, adult males preceded both adult females and immatures, and adult females arrived before immatures at potential breeding areas (Hamerstrom 1969). On Long Island, New York, males also arrived at breeding sites before females (England 1989).

RECOVERIES: Hammond and Henry (1949) banded 150 nestling harriers in North Dakota and received returns on 12 (8%). The birds had dispersed in a general southern direction, with recoveries from North Dakota (one), Kansas (one), Texas (six), Louisiana (one), Mexico (one), and British Columbia (one). More than half the birds were recovered within one year (seven of 12). Between 1959 and 1977, 12 returns were received from harriers banded as nestlings on the Buena Vista Marsh in Wisconsin (F. Hamerstrom, pers. comm., cited by Beske 1982). The birds had migrated in a general south-southeasterly direction and all were recovered during their first fall and winter. Returns were from the following states: Wisconsin (one), Michigan (two), Illinois (two), Tennessee (one), Mississippi (one), Alabama (one), Georgia (one), Florida (one), South Carolina (one), and North Carolina (one).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Depending on availability, eats small mammals (especially voles and cotton rats), small and medium-size birds (especially passerines), and some reptiles, amphibians, large insects, carrion. Hunts over open land or marshes; usually flies low when hunting, captures prey on ground.(Palmer 1988) During the breeding season, young are fed primarily small mammals and birds. In Pennsylvania, a variety of birds, mostly juvenile, were important prey for the young, and included northern flickers (Colaptes auratus), eastern meadowlarks (Sturnella magna), red-winged blackbirds (Agelaius phoeniceus), bobolinks (Dolichonyx oryzivorus), American robins (Turdus migratorius), and mourning doves (Zenaida macroura) (Randall 1940). Other prey taken were several species of mice (Microtus, Peromyscus, and Zapus spp.), frogs (Rana spp.), and garter snakes (Thamnophis sirtalis). In New Hampshire, microtine rodents and small and medium-sized birds were the most common prey of harriers (Serrentino 1987). When prey could be identified, the following were noted; shorttail shrew (Blarina brevicauda), meadow vole (Microtus pennsylvanicus), meadow jumping mouse (Zapus hudsonius), ruffed grouse (Bonasa umbellus), northern flicker, American robin, bobolink, and garter snake. In a population breeding on the barrier beaches of Long Island, New York, the meadow vole was the primary prey, with avian species being of secondary importance (England 1989). Waders and passerine birds were the avian groups represented in greatest frequency in prey remains.

Small mammals and birds were also the most important prey taken in other North American studies (Breckenridge 1935, Hecht 1951, Craighead and Craighead 1956, Toland 1985). Harriers in New Brunswick concentrated on meadow voles early in the breeding season, with juvenile birds becoming the most common prey item during the mid and late nestling stages (Barnard et al. 1987).

In Michigan and Ohio, prey taken in winter consisted primarily of meadow voles (Craighead and Craighead 1956, Bildstein 1978). In Pennsylvania, several rodent species (Microtus, Peromyscus, and Zapus spp.), cottontail rabbits (SYLVILAGUS spp.), and birds were common in the fall and winter diets of harriers (Randall 1940). At a freshwater marsh in Florida, the birds preyed primarily on cotton rats (Collopy and Bildstein 1987). Godfrey and Fedynich (1987) reported that harriers appeared to take waterfowl opportunistically in Texas.

During the breeding season, high prey densities have been associated with increased breeding success (Hamerstrom et al. 1985, Simmons et al. 1986). The number of breeding harriers increased during periods of high meadow vole abundance in Wisconsin (Hamerstrom 1979, Hamerstrom et al. 1985) and New Brunswick (Simmons et al. 1986). Hamerstrom et al. (1985) noted that nesting success showed a slightly positive relationship with vole abundance. In New Brunswick, clutch size was positively correlated with vole indices and high provisioning rates by males were associated with an increase in the number surviving to fledging (Simmons et al. 1986). The starvation of nestlings was more common during vole population lows.

Harrier density and distribution may be affected by prey abundance during the winter. The number observed at winter roosts increased during winters when meadow vole abundance was high (Weller et al. 1955, Craighead and Craighead 1956). Bildstein (1979) also observed that the placement of roost sites was related, in part, to the density of prey in the surrounding areas. Roost sites were commonly situated in the center of the birds' hunting areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The diet is variable, depending on dominant prey types in the area. In areas with large populations of small mammals, they make up 95% of the diet. In northern grasslands, the diet may be almost exclusively Microtus voles. Northern harriers also eat other small vertebrates, including snakes, frogs, passerine birds, and small waterfowl. When hunting for food, harriers glide at a slow pace close to the ground until prey is found. Harriers then dive quickly to capture it. They may also hide in vegetation, waiting to pounce on prey. They sometimes store extra prey to eat later.

Animal Foods: birds; mammals; amphibians; reptiles

Foraging Behavior: stores or caches food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The primary prey base of northern harriers is meadow voles (Microtus
pennsylvanicus) [8,16]. They also eat a variety of amphibians,
reptiles, and invertebrates when these food sources are abundant [16].
Other prey includes hares (Lepus spp.), rabbits (Sylvilagus spp.),
shrews (Sorex spp.), ground squirrels (Spermophilus spp.), lesser
prairie chickens (Tympanuchus pallidicinctus), passerine birds, and
occasional carion [7,14,16].
  • 8. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 14. Haukos, David A.; Broda, Gerald S. 1989. Northern harrier (Circus cyaneus) predation of lesser prairie-chicken (Tympanuchus pallidicinctus). Journal of Raptor Research. 23(4): 182-183. [18135]
  • 16. Johnsgard, Paul A. 1990. Hawks, eagles, and falcons. Washington, DC: Smithsonian Institution Press. 403 p. [21510]
  • 7. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21385]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The diet is variable, depending on dominant prey types in the area. In areas with large populations of small mammals, they make up 95% of the diet. In northern grasslands, the diet may be almost exclusively Microtus voles. Northern harriers also eat other small vertebrates, including snakes, frogs, passerine birds, and small waterfowl. When hunting for food, harriers glide at a slow pace close to the ground until prey is found. Harriers then dive quickly to capture it. They may also hide in vegetation, waiting to pounce on prey. They sometimes store extra prey to eat later.

Animal Foods: birds; mammals; amphibians; reptiles

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Predation by northern harriers can have significant effects on populations of field mice and other rodents.

As prey, northern harriers provide food for some terrestrial predators, such as coyotes Canis_latrans, striped skunks Mephitis_mephitis, raccoons Procyon_lotor, and red foxes Vulpes_vulpes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Northern harriers have many predators, including raccoons, skunks, American crows, common ravens, coyotes, feral dogs, red foxes, and great horned owls. American crows and common ravens prey on eggs, while other raptors, especially great horned owls, target nestlings.

Northern harriers with young generally respond aggressively to predators. Defense ranges from aggressive distress calls to striking the intruder with closed talons. Males and females contribute equally to defense.

Northern harriers often compete with Asio flammeus for the same food source. Food shortages can occur because both hunt the same prey. Northern harriers have a tendency to steal prey away from short eared owls by harassing them until the owl drops its prey. Short eared owls have been known to hunt both at night and during the day, while northern harriers hunt only during the day.

Known Predators:

  • American crow Corvus_brachyrhynchos 
  • common ravens (Corvus_corax)
  • coyotes (Canis_latrans)
  • great horned owls (Bubo_virginianus)
  • feral dogs (Canis_lupus_familiaris)
  • striped skunks (Mephitis_mephitis)
  • red foxes (Vulpes_vulpes)
  • raccoons (Procyon_lotor)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Predators of northern harriers include red fox (Vulpes vulpes), striped
skunk (Mephitis mephitis), raccoons (Procyon lotor), feral cats (Felis
domesticus), mink (Mustela vison), and ravens, crows, and magpies
(Corvids) [21].
  • 21. Simmons, Robert; Smith, P. C. 1985. Do northern harriers (Circus cyaneus) choose nest sites adaptively?. Canadian Journal of Zoology. 63: 494-498. [21508]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Predation by northern harriers can have significant effects on populations of field mice and other rodents.

As prey, northern harriers provide food for some terrestrial predators, such as coyotes Canis latrans, striped skunks Mephitis mephitis, raccoons Procyon lotor, and red foxes Vulpes vulpes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Northern harriers have many predators, including raccoons, skunks, American crows, common ravens, coyotes, feral dogs, red foxes, and great horned owls. American crows and common ravens prey on eggs, while other raptors, especially great horned owls, target nestlings.

Northern harriers with young generally respond aggressively to predators. Defense ranges from aggressive distress calls to striking the intruder with closed talons. Males and females contribute equally to defense.

Northern harriers often compete with short eared owls for the same food source. Food shortages can occur because both hunt the same prey. Northern harriers have a tendency to steal prey away from short eared owls by harassing them until the owl drops its prey. Short eared owls have been known to hunt both at night and during the day, while northern harriers hunt only during the day.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 383 (1930).
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Comments: Global population has been estimated at 1,300,000 birds, of which 455,000 (about 35%) occur in the United States and Canada (Rich et al. 2004). Number of breeding pairs in Canada in the early 1990s was estimated at 20,000 to 50,000 (Kirk et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

NONBREEDING: May aggregate in communal roosts in winter in areas of high prey density (Evans 1982; see also Palmer 1988). In winter, may hunt in same area for several consecutive days (see Palmer 1988). In the nonbreeding season, females may defend preferred feeding areas against males. Vegetation structure affects harrier habitat selection and hunting behavior. Harriers often increase flight altitude with increasing vegetation height, enabling them to "see" into the vegetation (Schipper 1977, Serrentino 1987). In a freshwater marsh in Florida, harrier hunting success was negatively affected by the dense marsh grasses that concealed their primary prey, the cotton rat (SIGMODON HISPIDUS) (Collopy and Bildstein 1987).

BREEDING DENSITY AND DISPERSION: Breeding density about 0.8-6.4 females per ten square kilometers (see Serrentino 1992). Breeding density and dispersion of are affected by the abundance of prey species (Hamerstrom 1979), the occurrence of polygyny (Balfour and Cadbury 1979, Simmons et al. 1986), nest site fidelity (Sealy 1967, Balfour and Cadbury 1979), and habitat quality (Picozzi 1984, Simmons and Smith 1985). The number of nesting harriers increases during high meadow vole abundance in those populations that prey primarily on voles (Hamerstrom 1969, 1979; Clark 1972; Simmons et al. 1986). In Wisconsin (Hamerstrom 1979) and New Brunswick (Simmons et al. 1986), nest densities increased more than twofold when vole abundance rose from low to high. Polygyny tends to increase the degree of nest clumping in breeding populations (Balfour and Cadbury 1979, Simmons et al. 1986, England 1989). In Orkney, the distance between nests decreased with increasing harem size (Picozzi 1984). Harriers often occupy the same nest sites or nesting territories, but not the nest itself, for several years (Sealy 1967, Balfour and Cadbury 1979, Serrentino 1987, England 1989). In New Hampshire, a pair nested in the same field for a minimum of five years (Serrentino 1987).

Both Picozzi (1984) and Simmons and Smith (1985) noted that high densities of breeding harriers in some areas were probably a reflection of habitat quality. At a moorland site in mainland Scotland (Picozzi 1978), nest densities were much lower than densities on the Orkney Islands (Balfour and Cadbury 1979). Differences between the two areas included an abundance of prey in the farmlands and wetlands at Orkney (Picozzi 1984). Simmons and Smith (1985) postulated that harrier nest densities at a predominantly wet marsh in New Brunswick were higher than those reported in other areas because of increased availability of nest sites and high densities of meadow voles.

HUNTING RANGE SIZE: The sizes of hunting ranges vary widely during the breeding season in different areas, presumably because of differences in habitat types, availability of prey species, distribution of nest sites, and stage of the breeding cycle (Craighead and Craighead 1956, Balfour and MacDonald 1970, Balfour and Cadbury 1979, Serrentino 1992). In two midwestern studies, the range sizes for pairs varied from 2.6-5.5 kilometers squared (Breckenridge 1935, Craighead and Craighead 1956). Males usually have larger hunting ranges than females (Hecht 1951, Schipper 1977, Watson 1977). Schipper (1977) reported range sizes from 1.8-12.3 kilometers squared for males in the Netherlands, and Martin (1987) observed range sizes from 9.7-17.7 kilometers squared for males in Idaho. Hunting range sizes of approximately 0.8-5.4 kilometers squared for females were observed in both the Netherlands and New Hampshire (Schipper 1977, Serrentino 1987). In North Dakota, breeding harriers were found only in grassland patches greater than 100 hectares, and were encountered in large patches more often than statistically expected (Johnson and Igl 2001).

Little data are available on the range sizes of nonbreeding harriers. In Michigan, wintering birds flew up to eight kilometers from roost sites to hunting ranges (Craighead and Craighead 1956). The number hunting in a particular area decreased with increasing distance from the roost, and hunting range size varied from 0.12-2.6 kilometers squared. In the Netherlands, appeared to have fixed hunting ranges of unidentified sizes (Schipper et al. 1975).

WEATHER: Cold or rainy weather may negatively affect breeding success. Egg-laying may be delayed by cold weather (Watson 1977, Schipper 1979). Prolonged periods of rainy weather, particularly during the incubation and nestling stages, may cause nest desertion or death of nestlings from exposure (Follen 1986, Simmons et al. 1986). Abnormally high tides have destroyed nests in coastal areas (Dunne 1986).

PARASITES: Raptors are susceptible to a number of bacterial and viral diseases. Numerous species of endoparasites, blood protozoans, and ectoparasites have been recorded in raptors. Little is known of the effects of diseases and parasites on wild populations because of the scarcity of data and the difficulty associated with separating the direct causes of death from diseases and parasites with the indirect causes (e.g., birds weakened by disease may succumb to death from predation, starvation and severe weather) (Newton 1979). External and internal parasites have been found on free-living northern harriers (Peters 1936, Scharf 1966, Hamerstrom 1969, Anderson and Freeman 1969, Pence 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the term: cover

Fires can open up grasslands and expose prey for northern harriers [2].
However, northern harriers were not observed following prescribed fires
in a dry prairie grassland in Florida. The authors admit that counts
for large birds may have been underestimated. Fires were conducted in
January and again in late June. After the June fire, total bird
abundance for all species was lower on the burned site than on the
unburned control [12].

Prescribed fire in North Dakota destroyed three of four northern harrier
nests, while one nest hatched following the fire [18]. No nests were
initiated afterwards. Burning was conducted in mid-June using a
backfire on the downwind side followed by flank fires, and a headfire
across the upwind side.

To determine the effects on small mammal populations, fires were
prescribed on Malheur National Wildlife Refuge, Oregon, where northern
harriers are abundant [6]. Fires in early November removed cover and
immediately reduced the small mammal population. However, small mammals
returned to burned sites the first and second postfire years. There was
an increase in small mammal numbers to above preburn levels during the
second postfire year, but this might have been due to above-average
winter temperatures.

Three years following prescribed burning in Wyoming, northern harriers
were not found on unburned plots or on plots burned in early June.
Northern harriers were found, however, on plots burned in late August.
Small mammal densities were high on the August-burned plots, and raptors
were observed preying upon the mammals. The prescribed burning involved
two fires, both conducted in a mountain big sagebrush (Artemisia
tridentata ssp. vaseyana) community. The first fire, set in early June,
resulted in patches of completely burned, partially burned, and unburned
areas. Plant cover on plots burned in June was 50 percent lower than on
control plots at the first postfire year. Cover was 79 percent of the
control by the third postfire year. The second fire was set in late
August, and all living and dead vegetation was consumed. Cover on
August-burned was 82 percent less than on control plots at the first
postfire year, and 54 percent of control plots by the second postfire
year.
  • 18. Kruse, Arnold D.; Piehl, James L. 1986. The impact of prescribed burning on ground-nesting birds. In: Clambey, Gary K.; Pemble, Richard H., eds. The prairie: past, present and future: Proceedings, 9th North American prairie conference; 1984 July 29 - August 1; Moorhead, MN. Fargo, ND: Tri-College University Center for Environmental Studies: 153-156. [3561]
  • 2. Baker, R. H. 1940. Effects of burning and grazing on rodent populations. Journal of Mammalogy. 21: 223. [2849]
  • 6. Cornely, J. E.; Britton, C. M.; Sneva, F. A. 1983. Manipulation of flood meadow vegetation and observations on small mammal populations. Prairie Naturalist. 15: 16-22. [14509]
  • 12. Fitzgerald, Susan M.; Tanner, George W. 1992. Avian community response to fire and mechanical shrub control in south Florida. Journal of Range Management. 45(4): 396-400. [18808]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the term: polygamous

Age of Maturity - 1 year
Mating/Nesting - March through June beginning in the south and moving
north; can mate for life, but sometimes males are
polygamous; can nest 4 pairs/sq mile in good habitat
Clutch - 4 to 6 eggs
Incubation - 24 to 39 days
Fledge - 30 to 35 days
Life Span - 12 years
Migration - move north beginning in February; move south by late
November [7,9,16]
  • 9. DuBois, Kristi; Becker, Dale; Thornbrugh, Joe. 1987. Identification of Montana's birds of prey. Montana Outdoors. 18(6): 11-31. [3606]
  • 16. Johnsgard, Paul A. 1990. Hawks, eagles, and falcons. Washington, DC: Smithsonian Institution Press. 403 p. [21510]
  • 7. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21385]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Northern harriers are most vocal near the nest. When mating, they make fast kek, quik, and ek sounds. When they are in distress, harriers make rapid high-pitched sounds. Males have a more nasal sound than females.

Females issue a call for food, most often during mating season. It is a piercing eeyah, eeyah sound which can last for several minutes. Males respond to this with a purrduk sound that can barely be heard. In response to this sound the female will leave her nest to receive food.

Young harriers emit a "begging call" when they see their parents flying overhead or when they hear their parents call out to one another. This sound is called a pain call, and is a series of chit notes.

Northern harriers, like most raptors, have a keen sense of vision. Northern harriers are unusual in that their owl-like facial ruff enhances their sense of hearing, which they use extensively in finding prey.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Northern harriers are especially vocal around the nest. Sounds of courtship are reflected by rapid kek, quik, or ek notes in series. Calls of distress are urgent and high pitched, also in rapid succession. This call is more nasal-sounding in males than in females.

There also exists a "food call", which is observed most frequently during breeding season. Females issue a piercing eeyah, eeyah scream, which may be repeated for several minutes. This is responded to by a barely audible purrduk chuckle by the male, which solicits the female from the nest.

Young harriers emit a "begging call" when they hear their parents or in response to seeing their parents fly overhead. This sound is often referred to as a pain call, and it is a series of chit notes. This sound only becomes more emphatic with increasing age.

Northern harriers, like most raptors, have a keen sense of vision. Northern harriers are unusual in that their owl-like facial ruff enhances their sense of hearing, which they use extensively in finding prey.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: May hunt throughout day; mostly in early morning and late afternoon in some areas (Evans 1982). In winter, spends much of daylight period perched, as opposed to flying.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is very little information known concerning the lifespan of northern harriers. The longest lifespan reported is 16 years and 5 months. The average lifespan, however, is 16.6 months. The oldest reported breeding female was 8 years old.

Range lifespan

Status: wild:
16.19 (high) years.

Average lifespan

Status: wild:
16.6 months.

Average lifespan

Status: wild:
197 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

There is very little information known concerning the lifespan of northern harriers. The longest lifespan reported is 16 years and 5 months. The average lifespan, however, is 16.6 months. The oldest reported breeding female was 8 years old.

Range lifespan

Status: wild:
16.19 (high) years.

Average lifespan

Status: wild:
16.6 months.

Average lifespan

Status: wild:
197 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

BREEDING CHRONOLOGY: Spring arrival dates on breeding grounds in the Northeast range from mid-March to early April, and laying dates range from mid-April to mid and late June (Bent 1937, Hall 1983, Laughlin and Kibbe 1985). Clutches are laid over a period of about nine days, with eggs being laid at two-day intervals (Hamerstrom 1969). Clutch size usually varies from four to six eggs (Bent 1937, Hamerstrom 1969, Duebbert and Lokemoen 1977). Incubation is 30-32 days and begins before the last egg is laid; as a result, hatch is asynchronous (Breckenridge 1935, Hamerstrom 1969). The nestling period varies from 30-41 days (Urner 1925, Hamerstrom 1969, England 1989). Juveniles stay near the nest and are dependent on their parents for food for an additional three to four weeks (Breckenridge 1935, Hamerstrom 1969).

COURTSHIP AND BREEDING BEHAVIOR: The distinctive courtship flight has been called a "sky dance." The flight is performed by the male, and occasionally by the female, and consists of a series of nose dives or U-shaped dives (Bent 1937). Hamerstrom (1986) illustrated the behavior as a series of circular flights when viewed from the front. Copulation occurs either on the ground or on a short perch (Brown and Amadon 1968, Clark 1972). The female apparently solicits the male with the begging or food call. Harriers do not appear to mate for life (Hamerstrom 1969).

Both sexes may breed in their first year (Watson 1977); however, more females usually breed as yearlings than males (Hamerstrom et al. 1985, England 1989). In Wisconsin, the majority of females bred at one year of age (Hamerstrom et al. 1985). The number breeding as yearlings (both males and females) in Wisconsin (Hamerstrom et al. 1985) and New Brunswick (Simmons et al. 1986) increased during periods of high meadow vole abundance.

Although the male, female, or both may choose the nest site, the female appears to do the majority of nest building. Both parents bring nest material (Watson 1977, Toland 1985). The nest is built on the ground and is composed of dead grasses, weeds, and small twigs (Urner 1925, Bent 1937, Hecht 1951). Nests are frequently placed in dense vegetation (Duebbert and Lokemoen 1977, Hamerstrom and Kopeny 1981, Toland 1985, Serrentino 1987). Larger and deeper nests are often built in wet or flood-prone areas (Urner 1925, Sealy 1967). Sealy (1967) measured 12 nests in upland and wetland habitats; depths of nests ranged from 5.0-24.0 centimeters, and diameters varied from 39.0-63.0 centimeters. Harriers may use the same patch of shrubs, field, or general area for several years (Sealy 1967, Balfour and Cadbury 1979, Serrentino 1987, England 1989).

Incubation and feeding of the young is done by the female only (Hamerstrom 1969). During incubation and the early portion of the nestling stage, the female rarely leaves the nest. At this time she is supplied with food by the male, accomplished by a "food pass" in which the male drops the prey to her in mid-air over or near the nest (Breckenridge 1935, Hecht 1951). When she is absent, he drops the prey into the nest and usually leaves immediately (Breckenridge 1935). When the nestlings are about two weeks old, the female leaves the nest to hunt more frequently (Hecht 1951, Schipper 1973).

NESTLING DEVELOPMENT: Newly-hatched harriers are covered with a layer of white down. Their eyes open a few hours after hatching. Mean weight at hatching is 19.8 grams (Scharf and Balfour 1971). For the first five days, the nestlings are almost continually brooded by the female (Hecht 1951). Between two and three weeks of age the young begin to make tunnels in the vegetation adjacent to the nest. These tunnels may be used as escape routes (Balfour and MacDonald 1970). Between the third and fourth weeks, the young lose most of their down and acquire their distinctive juvenal plumage (Watson 1977). The young are usually able to fly at 30 days, and have become fairly proficient flyers at 35 days (Hammond and Henry 1949). The lightest individuals and those with the most well developed flight feathers, usually the males, fledge first (Scharf and Balfour 1971).

Because hatching occurs asynchronously, the nest contains young of varying sizes. The smallest nestlings often do not survive because of competition for food with their larger nest-mates (Breckenridge 1935, Balfour and MacDonald 1970). Female nestlings are larger than males for most of the nestling period (Scharf and Balfour 1971, Picozzi 1980).

LONGEVITY: The average life span is approximately seven years in the wild (Brown and Amadon 1968). The longest life span of a banded, free-ranging, individual was 16 years, 5 months (Clapp et al. 1982). Juvenile mortality has been attributed to starvation and malnutrition (Craighead and Craighead 1956). In Great Britain, mortality was highest for first-year birds (Balfour and Cadbury 1975, Watson 1977). In the Orkney Islands, survival of hen harriers increased from 32% in the first year to 70% in the following year (Balfour and Cadbury 1975).

NESTING SUCCESS: Hatching success varies greatly both among years and study areas. In Michigan, yearly hatching success varied from 0-78% (Craighead and Craighead 1956) and in Canada from 23-89% (Sealy 1967). Fledgling production, i.e., the number of young fledged per female (monogamous females only) varied as follows: 1.5-2.3 for all nests, including those that failed (Craighead and Craighead 1956, Picozzi 1978, Balfour and Cadbury 1979, Hamerstrom et al. 1985, England 1989), and 2.7-3.1 for successful nests (Picozzi 1978, Balfour and Cadbury 1979, Hamerstrom et al. 1985, England 1989). For data on fledgling production for polygynous females, see Balfour and Cadbury (1979), Hamerstrom et al. (1985), Simmons et al. (1986), and England (1989).

The frequency of renesting after nest failure is low. Renesting has been documented in populations studied in New Brunswick (Simmons 1984), Michigan (Craighead and Craighead 1956), and the Dakotas (Duebbert and Lokemoen 1977). In Wisconsin (Hamerstrom 1969) and New York (England 1989), harriers did not lay replacement clutches. In Wisconsin, the adults left the study area within 24 hours of nest failure (Hamerstrom 1969).

POLYGYNY: Polygyny has been well documented (Breckenridge 1935; Hecht 1951; Clark 1972; Balfour and Cadbury 1979; Hamerstrom et al. 1985; Simmons et al. 1986; England 1989). In mainland Scotland, the frequency of polygynous matings was low (Picozzi 1978). However, in the Orkney Islands in Scotland, polygyny accounted for a majority of the mating associations in some years (Balfour and Cadbury 1975, Balfour 1979; Picozzi 1984). In Wisconsin and New Brunswick, the occurrence and frequency of polygyny was related to meadow vole abundance. High vole numbers led to increases in (1) the numbers nesting, (2) the number of yearlings nesting, and (3) the occurrence of polygyny. Simmons et al. (1986) concluded that the frequency of polygynous matings increased during high vole years because males were able to provision more females successfully. In the Orkney Islands and on Long Island, New York, the occurrence of polygyny was related to an unbalanced sex ratio that resulted in a shortage of male breeders (Picozzi 1984, England 1989). Balfour and Cadbury (1979) noted that polygyny was fairly rare until the 1950s, when the population began to increase from a low point. Between the 1950s and 1960s more females than males were reared in the population (Picozzi 1984); during recent years, more males than females have fledged.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adult males show interesting behaviors during mating season. During this time the male courts the female by flying high into the air and then diving down. Males generally have between 1 and 3 mates.During incubation of the eggs the male provides food for the female, but he stays away from the nest. When he is near the nest he will call out, and when the female comes to him he will drop food to her. During breeding season, northern harriers become very territorial and will attack anyone who threatens their nesting areas.

Most males are monogamous, which means they mate with only one females, but some have been known to mate with up to 5 females in one season. Females only mate with one male per season.

Mating System: monogamous ; polygynous

Harriers often nest in loose colonies of 15 to 20 individuals. The nest, built mostly by the female, is made out of sticks and padded on the inside with grass. The nest is built on the ground, often on raised mounds of dirt or clumps of vegetation.

Eggs are laid from mid-May to early June. They are white with a blue tint, and occasionally have brown spots. The eggs are approximately 47 x 36mm. Three to five eggs are laid, and incubation is only by the female.

The eggs hatch in approximately 31 to 32 days. Male harriers will contribute to the feeding of their offspring during the time they are in the nest and will watch over the nest for a maximum of 5 minutes when the female is away.

Breeding interval: Northern harriers breed once per season.

Breeding season: Primary females breed from April through July, while secondary females breed from May through September.

Range eggs per season: 3 to 5.

Average eggs per season: 4.4.

Range time to hatching: 28 to 36 days.

Range fledging age: 30 to 35 days.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 3 years.

Average eggs per season: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

The female is the primary caregiver for young northern harriers. She shelters them from the weather with her wings. She also feeds her young by taking food from the male when they are young, and later, by passing the food to them while in flight. The male northern harrier brings food for his mate and offspring, but leaves them when the hatchlings are about two weeks old.

Parental Investment: altricial ; pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Chinery, M. 1992. Pp. 144 in The Kingfisher Illustrated Encyclopedia of Animals. New York: Kingfisher Books.
  • Terres, J. 1980. Pp. 483 in The Audubon Society Encyclopedia of North American Birds. New York: Alfred A.Knoph Inc..
  • Burton, M., R. Burton. 1989. Northern harrier. Pp. 1162 in The Marshall Cavendish International Wildlife Encyclopedia, Vol. 10. Toronto, Canada: Marshall Cavendish Corporation.
  • Baicich, P., C. Harrison. 1997. A Guide to the Nests, Eggs, and Nestlings of North American Birds. New York City, New York, USA: Academic Press.
  • Eastman, J. 1999. Birds of Lake, Pond, and Marsh. Pennsylvania, USA: Stackpole Books.
  • Ryser, F. 1985. Birds of the Great Basin- A Natural History. Reno, Las Vegas: University of Nevada Press.
  • Wheeler, B., W. Clark. 1987. The Peterson Field Guide Series- A Field Guide to Hawks of North America. Boston: Houghton Mifflin Company.
  • Macwhirter, R., K. Bildstein. 1996. Northern Harrier. The Birds of North America, 210: 1-25.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adult males show interesting behaviors during mating season. During mating season the male courts the female by flying high in the air and then dives down twirling and spinning. Males are sometimes polygynous and have 1 to 3 mates. During incubation the male provides food for the female, but he doesn't approach the nest. When he is near the nest he will call out, and as she comes to him he drops the food to her. During the breeding season northern harriers become very territorial and will attack other hawks, birds, or humans that approach their nesting areas.

Most males are monogamous, although some males are polygynous, having been known to pair with up to five mates in a season. Females are monogamous. This is due, not only to the female-biased sex ratio, but also to the abundance of food during the spring.

Mating System: monogamous ; polygynous

Harriers often nest in loose colonies of 15 to 20 individuals. The nest, built mostly by the female, is made out of sticks and padded on the inside with grass. The nest is built on the ground, often on raised mounds of dirt or clumps of vegetation.

Eggs are laid from mid-May to early June. They are white with a blue tint, and occasionally have brown spots. The eggs are approximately 47 x 36mm. Three to five eggs are laid, and incubation is only by the female.

The eggs hatch in approximately 31 to 32 days. Male harriers will contribute to the feeding of their offspring during the time they are in the nest and will watch over the nest for a maximum of 5 minutes when the female is away.

Breeding interval: Northern harriers breed once per season.

Breeding season: Primary females breed from April through July, while secondary females breed from May through September.

Range eggs per season: 3 to 5.

Average eggs per season: 4.4.

Range time to hatching: 28 to 36 days.

Range fledging age: 30 to 35 days.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 3 years.

Average eggs per season: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Female investment in her offspring begins with the provisioning of yolk to her eggs. After laying, the female will spread her wings to shelter her young from rain and extreme sun. Her mate will provide food for her for about two weeks after the eggs hatch, then departs. Food is transferred to the female via the male by aerial-pass, and then the female feeds her young. When young reach fledgling stage and are able to fly sufficiently well, food transfer is made to them by their mother, also via aerial-pass.

Parental Investment: altricial ; pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Chinery, M. 1992. Pp. 144 in The Kingfisher Illustrated Encyclopedia of Animals. New York: Kingfisher Books.
  • Terres, J. 1980. Pp. 483 in The Audubon Society Encyclopedia of North American Birds. New York: Alfred A.Knoph Inc..
  • Burton, M., R. Burton. 1989. Northern harrier. Pp. 1162 in The Marshall Cavendish International Wildlife Encyclopedia, Vol. 10. Toronto, Canada: Marshall Cavendish Corporation.
  • Baicich, P., C. Harrison. 1997. A Guide to the Nests, Eggs, and Nestlings of North American Birds. New York City, New York, USA: Academic Press.
  • Eastman, J. 1999. Birds of Lake, Pond, and Marsh. Pennsylvania, USA: Stackpole Books.
  • Ryser, F. 1985. Birds of the Great Basin- A Natural History. Reno, Las Vegas: University of Nevada Press.
  • Wheeler, B., W. Clark. 1987. The Peterson Field Guide Series- A Field Guide to Hawks of North America. Boston: Houghton Mifflin Company.
  • Macwhirter, R., K. Bildstein. 1996. Northern Harrier. The Birds of North America, 210: 1-25.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Circus cyaneus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Circus cyaneus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAGACATGGGCACCCTATACCTAATCTTCGGCGCTTGAGCTGGCATAGCCGGCACCGCCCTCAGTCTACTCATTCGTGCAGAACTCGGTCAACCAGGCACCCTTCTAGGTGATGACCAAATCTATAACGTAATCGTCACCGCACATGCCTTTGTAATAATCTTCTTCATAGTCATACCAATCATAATCGGAGGCTTCGGAAACTGACTAGTCCCACTCATAATCGGCGCCCCTGACATAGCCTTCCCACGCATAAATAATATAAGCTTCTGACTACTACCCCCATCTTTCCTCCTCCTACTAGCCTCCTCAACAGTAGAAGCAGGAGCTGGTACCGGATGAACTGTTTACCCCCCATTAGCCGGCAATATAGCCCATGCTGGCGCCTCAGTAGACTTGGCTATCTTCTCCTTACATTTAGCTGGAGTCTCATCCATCCTAGGAGCAATTAACTTCATTACAACCGCTATTAACATAAAACCCCCAGCCCTCTCTCAATACCAAACACCCCTATTCGTATGATCTGTTCTCATTACTGCTGTCCTACTATTACTCTCACTTCCAGTCCTAGCTGCCGGCATCACCATACTACTAACGGACCGAAACCTTAATACAACATTCTTCGACCCTGCCGGCGGGGGCGATCCTATCCTATACCAACACCTCTTCTGATTCTTTGGCCACCCAGAAGTTTACATCCTAATCCTACCAGGATTTGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N4N : N5B: Secure - Breeding, N4N: Apparently Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Range is extensive; secure, but declines have occurred in several areas, due primarily to habitat loss and degradation.

Other Considerations: Protected by the Migratory Bird Treaty Act of 1918. State-listed as Endangered , Threatened, or of Special Concern in several states (MacWhirter and Bildstein 1996). Listed as a species of management concern in the U.S. Fish and Wildlife Service's "Migratory Nongame Birds of Management Concern in the United States: the 1995 list."

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

No conservation measures have been enacted specifically for this species, however, conservation measures for waterfowl and habitat management for game birds has increased local numbers of nesting northern harriers. The species is abundant enough to be rated "Least Concern" by the IUCN. It it protected under the Migratory Bird Treaty, and is listed in Appendix II of CITES.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The northern harrier declining due to draining of wetlands, livestock
grazing, flooding, and monocultural farming [11,15]. It is noted on The
Blue List as down or greatly down throughout most of its range [24]. It
is state-listed as endangered in Rhode Island and Illinois and
threatened in Massachusetts [5,22,23].
  • 5. Dusek, G. L. 1975. Vegetational responses by substrate, gradient, and aspect on a twelve acre test plot in the Bull Mountains. In: Clark, W. F., ed. Proceedings of the Fort Union Coal Field symposium; [Date unknown]
  • 11. Finch, Deborah M. 1992. Threatened, endangered, and vulnerable species of terrestrial vertebrates in the Rocky Mountain Region. Gen. Tech. Rep. RM-215. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 38 p. [18440]
  • 15. Herkert, James R. 1991. Study suggests increases in restored prairie fragments to conserve breeding bird communities (Illinois). Restoration & Management Notes. 9(2): 107. [17575]
  • 22. Commonwealth of Massachusetts Division of Fisheries and Wildlife. 1994. Massachusetts list of endangered, threatened, and special concern species. Boston, MA: Natural Heritage and Endangered Species Program, Commonwealth of Massachusetts Division of Fisheries and Wildlife. 23 p. [23006]
  • 23. Herkert, J. R., ed. 1992. Endangered and threatened species of Illinois: status and distribution. Volume 2--Animals. Springfield, IL: Illinois Endangered Species Protection Board. 142 p. [23799]
  • 24. Tate, James, Jr. 1986. The Blue List for 1986. American Birds. 40(2): 227-235. [24324]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

No conservation measures have been enacted specifically for this species, however, conservation measures for waterfowl and habitat management for game birds has increased local numbers of nesting northern harriers. The species is abundant enough to be rated "Least Concern" by the IUCN. It it protected under the Migratory Bird Treaty, and is listed in Appendix II of CITES.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Although population trends vary regionally, the global population appears to be declining (MacWhirter and Bildstein 1996). The North American Breeding Bird Survey (BBS) is not the best survey method for this generally sparse raptor; where data are credible, trends are mixed. In Montana and South Dakota, BBS data indicate a declining trends for 1980-2004 (-1.0 and -2.9% per year, respectively), while in North Dakota and the Central Valley, California, increasing trends were estimated for the same time period (3.8 and 3.1%/year, respectively; Sauer et al. 2005). For 1980 to 2004, BBS data indicate a decline for the U.S., Canada, and survey-wide (-0.3, -3.0 and -1.1% per year, respectively; Sauer et al. 2005).

Numbers may fluctuate with populations of voles (Microtus) (Kirk et al. 1995).

Global Long Term Trend: Decline of 30-50%

Comments: Declines have occurred where large wetlands and moist grasslands have been lost. Historical accounts described the harrier as abundant and widely distributed (Baird et al. 1860, Bendire 1895, Coues 1892, Bent 1937); declines in breeding harriers have since been observed in parts of North America through the late twentieth century (Arbib 1973, Evans 1982, Robbins et al. 1986, Serrentino and England 1989, Serrentino 1992). In the Northeast, breeding birds may have been extirpated in Connecticut, are restricted primarily to offshore islands in Massachusetts and Rhode Island, and remain as small and scattered populations in Vermont and New Hampshire.

BBS data indicate a significant negative trend (-3.0%/year, P<0.00, n = 269) for Canada from 1966 to 2004; for the same time period BBS data indicated a non-significant negative trend (-0.3%/year, P<0.60, n = 660) for U.S. routes and for combined U.S. and Canadian routes (-1.1%/year, P<0.02, n = 929; Saur et al. 2005).

Analyses of migratory trends showed no clear trend for northeastern North America from 1972 to 1987 (Titus and Fuller 1990). Dunne and Sutton (1986) assessed migratory data from Cape May Point, New Jersey, from 1976-85 and concluded that numbers had doubled during this period. In two studies conducted at Hawk Mountain, Pennsylvania, numbers increased slightly from 1934-66 (Spofford 1969), and no definitive trend was observed from 1934-75 by Nagy (1977). Using Hawk Mountain data from 1934-86, Bednarz et al. (1990) concluded that harriers did not show any population trend during the DDT period. Harriers exhibited a slightly positive, significant trend overall from 1934-86, and no trend was detected from 1971-86. Migration counts in Ontario increased from 1975 to 1990 (Kirk et al. 1995).

Brown (1973) analyzed Christmas Bird Count data from 45 states between 1952 and 1971; harriers showed a downward trend from 1952 to 1966 and an increase from 1966 to 1969; this increase however, was primarily attributed to populations in California. Bildstein and Collopy (1990) analyzed Christmas Bird Count data for 12 southeastern states (Alabama, Arkansas, Florida, Georgia, Kentucky, Louisiana, Mississippi, North Carolina, South Carolina, Tennessee, Virginia, West Virginia) from 1962-64 and 1971-85 and found that wintering populations appeared to have been fairly stable since the early 1960s.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.1,300,000 individuals (Rich et al. 2004), while national population estimates include: c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in China; < c.50 individuals on migration and < c.50 wintering individuals in Taiwan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Medium

Comments: HABITAT LOSS/DEGRADATION: Population decline is primarily attributable to habitat loss and degradation. Destruction of wetlands and conversion of native grasslands to monotypic farmlands have been major sources of habitat loss (Evans 1982). The majority of southern California habitat has been lost to urbanization. In the northeastern United States, declines are attributed primarily to habitat loss from reforestation, wetland filling, and urban and industrial development in coastal areas (Serrentino 1992); also degradation of marshes by ditching (Serrentino and England 1989). Increases in intensive sheep grazing have been implicated in declining populations of Orkney Island, Scotland (Amar and Redpath 2005).

DISEASE: Rosen and Morse (1959) documented the death of Northern Harriers from the ingestion of mice contaminated with the fowl cholera bacterium, Pasteurella multocida. During an outbreak of cholera among waterfowl in California, both mountain voles (Microtus montanus) and Peromyscus spp. had ingested portions of dead birds.

CONTAMINANTS: The effects of a variety of organochlorines on raptors have been well documented in North America (Hamerstrom 1969) and Europe (Bijleveld 1974); effects include eggshell thinning, reproductive failure, and death (Newton 1979). On Long Island, New York, high levels of DDE were found in one harrier egg from an abandoned nest (Foehrenbach et al. 1970), although no evidence of eggshell thinning was observed. In North America, a mean decrease of 15% in eggshell thickness was noted between 1947 and 1969 (Anderson and Hickey 1974). Declines in both breeding and migrating harriers and the occurrence of behavioral changes coincided with the heavy use of DDT at a Wisconsin study site and elsewhere in North America. Pesticide use in Vermont (Laughlin and Kibbe 1985), Connecticut (Dowhan and Craig 1976), and New Jersey (Dunne 1984) has been implicated in population declines. A variety of biocides (DDE, dieldrin, PCBs) were found in Northern Harrier eggs collected during the 1980s on Long Island, New York. Hands et al. (1989) pointed out that few studies have been conducted on the long term effects of DDT and other biocides on harriers, with the exception of Hamerstrom (1969).

PREDATION AND HUMAN DISTURBANCE: Because harriers nest on the ground, eggs and young are vulnerable to destruction by humans and natural causes. A number of mammalian and avian predators (e.g., skunks, mink, raccoons, dogs, and other raptor species) prey upon eggs and young, and nests have been trampled by deer (Odocoileus virginianus) and livestock (Craighead and Craighead 1956, Hamerstrom 1969, Toland 1985, England 1989). Predation of harrier young has occurred when predators followed humans to nests (Watson 1977, Toland 1985). Farming activities such as mowing and harrowing may cause nest abandonment by adults (Hamerstrom 1969, Follen 1986) and destruction of nests and young (Craighead and Craighead 1956, Hamerstrom 1969, Thomas 1987). During the first half of the 1900s, mortality from shooting was common (Craighead and Craighead 1956); however, death from shooting is no longer a serious threat in North America (Bildstein 1988). In Great Britain, Watson (1977) reported that human-related mortality remained one of the most frequent causes of death for the hen harrier. Deaths also resulted from starvation and collisions with automobiles and overhead wires.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
A marked decline in the North American population in the 1950s-1960s is thought to have resulted from excessive use of harmful organochlorine pesticides. Currently, the major threat to the species is habitat loss, from agricultural intensification, wetland draining and afforestation in parts of its range (del Hoyo et al. 1994, Ferguson-Lees and Christie 2001). Persecution is an important threat locally, notably on game preserves in Scotland (del Hoyo et al. 1994). It is also highly vulnerable to the impacts of potential wind energy developments (Strix 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Preserve Selection and Design Considerations: The amount of land required to maintain a viable population has not been established. Breeding and wintering densities will vary between areas because of differences in habitat types, availability and density of prey species, availability and distribution of suitable nesting sites, and the frequency of polygyny (Craighead and Craighead 1956, Clark 1972, Picozzi 1978, Balfour and Cadbury 1979, Hamerstrom et al. 1985). F. Hamerstrom (pers. comm., cited by Hands et al. 1989) recommended that an adequate amount of habitat should be protected to support more than four females during the breeding season.

The results of several long-term studies can provide land managers with general estimates of the size requirements necessary for the maintenance of breeding populations. At a 160 sq km site in Wisconsin, between four and 34 harrier nests were found per year (Hamerstrom et al. 1985). In New Brunswick, a 60 sq km portion of the reclaimed Tantramar Marsh supported 12-37 nests over a five year period (Simmons et al. 1986). At a 120 sq km site in Scotland, between five and 15 nests per year were found (Picozzi 1978). A 26 sq km portion of barrier beach on Long Island, New York, supported from nine to 14 nests each year (England 1989).

Management Requirements: Protection of favorable habitat and of nest sites are important; nests should not be disturbed during the early part of the nesting cycle, especially prior to hatching. Wetland preservation aimed primarily at waterfowl and habitat management programs for prairie chickens are beneficial to this species (Evans 1982).

The implementation of a management plan in the Northeast requires more detailed and accurate data on abundance and current population trends, habitat and area requirements, and more specific information, such as prey selection and predation rates. The following discussion of management recommendations for the northern harrier is based, in part, on Serrentino and England (1989); however, most of the information necessary to design a concise and scientific plan is currently lacking.

HABITAT PRESERVATION: Habitat loss and degradation are most likely the primary causes of the decline of the harrier in the northeastern region (Dowhan and Craig 1976, Laughlin and Kibbe 1985, Robbins and Boone 1985, England 1989, Serrentino and England 1989). If the current trend of land use patterns continues, open land will decline and the amount of developed area will increase (Brooks 1989). Habitat preservation is imperative in states where remnant populations are (1) confined to islands or small areas of suitable habitat on the mainland, or (2) threatened by development of coastal areas, drainage of wetlands, reforestation, and other forms of habitat loss (Serrentino and England 1989).

HABITAT MANAGEMENT: Harriers will breed and winter in a wide range of open lands provided that the following are available: (1) suitable breeding sites (e.g., cattail marshes, wet meadows, and shrub uplands and wetlands); (2) hunting habitats, such as early successional fields, grasslands, and wet meadows; and (3) an adequate prey base, comprised primarily of small mammals and birds. Harriers breed in areas managed for prairie chickens (TYMPANUCHUS spp.) that consist of early successional fields and dry and wet habitats (Hamerstrom 1969, 1979; Hamerstrom et al. 1985). Harrier breeding habitat in New Brunswick is composed of cattail marshes, wet meadows, upland hayfields, and abandoned fields (Simmons and Smith 1985). In northern New Hampshire, harriers continue to nest in an area where dairy farming and timber harvesting are the primary forms of land use (Serrentino 1987). Crops are rarely grown, and hayfields, abandoned fields, and shrub wetlands are common. Harriers breed in areas managed for waterfowl in the Dakotas, where fields are maintained in early successional stages composed of planted grass and legume species (Duebbert and Lokemoen 1977).

Management areas consisting of a complex of several different habitat types, such as dense shrublands and grasslands (dry and wet) and marshes may benefit breeding harriers. Nests have been found in areas where the dominant shrubs ranged from 0.5-2.0 meters (Holt and Melvin 1986, Toland 1985, Serrentino 1987). In grasslands in the Dakotas, harriers nested in vegetation ranging in height from 30 centimeters to more than 60 centimeters (Duebbert and Lokemoen 1977). The dead vegetation remaining from previous growing seasons was an important component in nest site selection. At least one harrier nest was present in fields ranging in size from 11-54 hectares. Harriers have nested in wet meadows comprised of bluejoint (CALAMAGROSTIS CANADENSIS) and prairie cordgrass (SPARTINA PECTINATA) (Simmons and Smith 1985). Cattail marshes are also important nest sites and, in some studies, predation rates were lower in these habitats compared to drier areas (Sealy 1967, Simmons and Smith 1985).

Harrier hunting habitats must be capable of providing an adequate prey base for breeding, wintering, and migrating birds. The maintenance of early successional stages is recommended. Small mammals prefer abandoned fields and other disturbed habitats with vegetation cover consisting of dense grasses and weeds (Birney et al. 1976, Baker and Brooks 1981). In contrast, extensive croplands and hayfields that are subjected to several annual cuttings may depress small mammal populations. Burning, grazing, mowing, and disking may be used to encourage early successional stages. The timing and frequency of these treatments would depend on characteristics of the particular site (e.g., location or successional stage).

PROTECTION OF NEST SITES: Nests should be protected from disturbance by recreational activities (e.g., off-road vehicle use), timber operations (cutting and bulldozing), certain agricultural operations (mowing, plowing, etc.), and unnecessary nest visitations from both researchers and the public. Nest visitations should be avoided during the early part of the nesting cycle, especially from the pre-laying and egg-laying stages up to hatching (Hamerstrom 1969, Fyfe and Olendorff 1976). Predation of harrier young has occurred when predators followed humans to nests (Watson 1977, Toland 1985). In agricultural areas, haying and tilling has destroyed nests and young (Craighead and Craighead 1956, Thomas 1987).

The use of buffer zones around nest sites may be necessary in areas where human-related disturbance is likely to occur. The size of these buffers has not been established and would most likely vary with the habitat type surrounding the nest, nature of the disturbance, stage of the nesting cycle, and the individual behavior of the pair (White and Thurow 1985; P. Serrentino, pers. obs.). Harriers will tolerate some agricultural activities during the breeding season. In New Hampshire, harriers nested in shrub wetlands and uplands adjacent to hayfields (Serrentino 1987) and did not seem disturbed by haying operations, perhaps because of familiarity with the activity. In addition, the availability of suitable nesting habitat adjacent to agricultural fields may have prevented the birds from using the hayfields as nest sites. In Wisconsin, farmers left the area around nests unmowed or unplanted (Follen 1986). Follen, 1986, also reported that nests in agricultural fields were abandoned or females left eggs or young for long periods during rainy weather when farmers were plowing.

PUBLIC EDUCATION: A public education campaign would benefit harriers by increasing the awareness of this raptor's status in the region.

Management Research Needs: Regional Management Program. - A regional management program should be implemented in the Northeast for species that remain threatened by continued habitat loss. It may also be possible to design a management plan that would include other threatened species with similar habitat requirements such as the short-eared owl (S. Melvin and G.R. Tate, pers. comms.). Particular question which need to be researched before a regional plan can be implemented include: (1) can populations be maintained in areas where agriculture is declining; (2) should management efforts concentrate on breeding and wintering populations that occur in traditional habitats such as inland and coastal wetlands; and (3) how can key habitats be preserved in areas where the cost of land acquisition may already be prohibitive? In addition, cooperation and communication among biologists in the Northeast are urgently needed to prevent the duplication of research efforts and to disseminate information on current harrier protection efforts (Serrentino 1992). RESEARCH NEEDS:

Determine the amount and type of disturbances that breeding harriers will tolerate, especially for populations located in coastal areas with high human densities (Serrentino and England 1989).

Investigate the relationship between wintering distribution and abundance in coastal Massachusetts, Rhode Island, and Connecticut, and the decline or lack of breeding birds in these same areas.

Determine the effect of saltmarsh ditching on populations and their major prey species (Serrentino and England 1989).

Collect data on hunting habitat and roost site selection in various habitats such as saltmarshes, freshwater wetlands, agricultural habitats, and maritime heaths.

Conduct analyses of pellets and prey remains found at roost sites to determine the prey selection of nonbreeding harriers.

Determine the causes of breeding failure and mortality in young and adults.

Monitor the current levels of biocides and compare with the results of previous studies.

Determine the sizes of hunting ranges of birds during the breeding and nonbreeding season at sites with varying densities and habitat types.

Implement accurate and standardized survey methods to determine the population trends on a regional level. Currently, the status of most populations in the Northeast is unknown because of the lack of reliable estimates of their abundance.

Conduct studies on the techniques used to maintain early successional habitats. Comparisons between treatments and the cost-effectiveness of each treatment are especially needed.

Biological Research Needs: Some important research needs include the following: Determine the extent of breeding range (MacWhirter and Bildstein 1996). Research tolerance to disturbances, especially for populations located in coastal areas with high human densities (Serrentino and England 1989). Investigate the relationship between wintering distribution and abundance and the decline of breeding birds in coastal Massachusetts, Rhode Island, and Connecticut. Determine the effect of saltmarsh ditching on populations and their primary prey (Serrentino and England 1989). Collect data on hunting habitat and roost site selection in various habitats such as saltmarshes, freshwater wetlands, agricultural habitats, and maritime heaths. Conduct analyses of pellets and prey remains found at roost sites to determine the prey selection of nonbreeding harriers. Determine the causes of breeding failure and mortality in young and adults. Monitor the current levels of biocides and compare with the results of previous studies. Conduct studies on the techniques used to maintain early successional habitats; compare treatments and the cost-effectiveness of each treatment.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

Northern harrier nests are often trampled by grazing cattle.
Suggestions for limiting livestock impact on nesting success include:
fence off nesting areas from livestock, provide more watering sites to
prevent congestion near nests, and reduce stocking rates [3]. Livestock
grazing and haying can also reduce the small mammal population on which
northern harriers depend [6].
  • 3. Benson, Patrick C. 1979. Land use and wildlife with emphasis on raptors. [Ogden, UT]
  • 6. Cornely, J. E.; Britton, C. M.; Sneva, F. A. 1983. Manipulation of flood meadow vegetation and observations on small mammal populations. Prairie Naturalist. 15: 16-22. [14509]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Use of Fire in Population Management

When considering controlled burning in wetland areas with ground nesting
northern harriers, it is best to either leave partial burns or conduct
burning after young have fledged in order to maximize recruitment of
this species [18].
  • 18. Kruse, Arnold D.; Piehl, James L. 1986. The impact of prescribed burning on ground-nesting birds. In: Clambey, Gary K.; Pemble, Richard H., eds. The prairie: past, present and future: Proceedings, 9th North American prairie conference; 1984 July 29 - August 1; Moorhead, MN. Fargo, ND: Tri-College University Center for Environmental Studies: 153-156. [3561]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative affects of northern harriers on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Northern harriers help protect crops by reducing populations of field mice and other rodents. Unlike some other hawk species, they do not attack poultry.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no negative affects of northern harriers on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Northern harriers help protect crops by reducing populations of field mice and other rodents. Unlike some other hawk species, they do not attack poultry.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: Breeds in a wide range of open habitats across much of the Northeast, including abandoned fields, upland maritime heaths, wet hayfields, saltmarshes, and cattail marshes. Nesting sites are chosen based on their availability and the abundance of prey in adjacent areas. Harriers feed their young primarily small mammals and birds. In high quality habitats with abundant prey, tend to nest in greater densities and form polygynous mating associations. From August to November, northeastern harriers migrate to their wintering grounds in the saltmarshes of the Atlantic coast where they may form communal roosting flocks on the ground in open habitats.

The Northeast regional population has remained stable from 1966-87 according to data from the BBS; however, the bird may be easily overlooked during the nesting period when the female rarely leaves the nest. Population declines have been documented in several northeastern states and have been attributed primarily to habitat loss from reforestation, the filling of wetlands, and urban and industrial development in coastal areas. Limited data is available for populations in several states. Populations should be monitored across the Northeast by checking previously used or historic nesting sites for evidence of breeding at least every other year. Wintering populations should also be observed by surveying suitable hunting habitats. Both breeding and wintering habitats should be protected and managed to provide a complex of several different undisturbed habitat types for nesting and hunting (Serrentino 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hen harrier

The hen harrier (Circus cyaneus) or northern harrier (in the Americas) is a bird of prey. It breeds throughout the northern parts of the northern hemisphere in Canada and the northernmost USA, and in northern Eurasia. This species is polytypic, with two subspecies. Marsh hawk is a historical name for the American form.[2]

It migrates to more southerly areas in winter. Eurasian birds move to southern Europe and southern temperate Asia, and American breeders to the southernmost USA, Mexico, and Central America. In the mildest regions, such as France, Great Britain, and the southern US, hen harriers may be present all year, but the higher ground is largely deserted in winter.

Description[edit]

In flight
Adult female flying in California

The hen harrier is 41–52 cm (16–20 in)[3] long with a 97–122 cm (38–48 in) wingspan.[4][5] It resembles other harriers in having distinct male and female plumages. The sexes also differ in weight, with males weighing 290 to 400 g (10 to 14 oz), with an average of 350 g (12 oz), and females weighing 390 to 750 g (14 to 26 oz), with an average of 530 g (19 oz).[2][5] Among standard measurements, the wing chord is 32.8 to 40.6 cm (12.9 to 16.0 in), the tail is 19.3 to 25.8 cm (7.6 to 10.2 in) and the tarsus is 7.1 to 8.9 cm (2.8 to 3.5 in).[5] It is relatively long winged and long tailed, having the longest wing and tail relative to its body size of any raptor occurring in North America.[5]

The male of the nominate race, C. c. cyaneus (Linnaeus, 1766), which breeds in Europe and Asia, is mainly grey above and white below except for the upper breast, which is grey like the upperparts, and the rump, which is white; the wings are grey with black wingtips. The female is brown above with white upper tail coverts, hence females, and the similar juveniles, are often called "ringtails". Their underparts are buff streaked with brown.[2]

The race C. c. hudsonius (Linnaeus, 1766) breeds in North America and is sometimes considered a distinct species, C. hudsonius.[6] The male's plumage is darker grey than that of C. c. cyaneus and the female is also darker and more rufous.[2] In both North American and Eurasia, the adult male is sometimes nicknamed the "Grey Ghost", because of his striking plumage and spectral aura.

The female gives a whistled piih-eh when receiving food from the male, and her alarm call is chit-it-it-it-it-et-it. The male calls chek-chek-chek, with a more bouncing chuk-uk-uk-uk during his display flight.[4]

Behaviour[edit]

This medium-sized raptor breeds on moorland, bogs, prairies, farmland coastal prairies, marshes, grasslands, swamps and other assorted open areas.[7] The nest is built on the ground or on a mound of dirt or vegetation. Nests are made of sticks and are lined inside with grass and leaves. Four to eight (exceptionally 2 to 10) whitish eggs are laid.[2][7] The eggs measure approximately 47 mm × 36 mm (1.9 in × 1.4 in).[8] These are the only hawk-like bird known to practice polygyny – one male mates with several females. When incubating eggs, the female sits on the nest while the male hunts and brings food to her and the chicks.[7] Up to five females have been known to mate with one male in a season.[9] A male will maintain a territory averaging 2.6 km2 (1.0 sq mi), though male territories have ranged from 1.7 to 150 km2 (0.66 to 57.92 sq mi).[10] The eggs are incubated mostly by the female for 31 to 32 days. The male will help feed chicks after they hatch, but doesn't usually watch them for a greater period of time than around 5 minutes.[11] The male usually passes off food to the female, which she then feeds to the young, although later the female will capture food and simply drop into the nest for her nestlings to eat.[10] The chicks fledge at around 36 days old, though breeding maturity isn't reached until 2 years in females and 3 years in males.

In winter, the hen harrier is a bird of open country, and will then roost communally, often with merlins and marsh harriers. There is now an accepted record of transatlantic vagrancy by the American subspecies, with a juvenile being recorded in Scilly, Great Britain from October 1982 to June 1983.[12]

Hunting behavior[edit]

This is a typical harrier, which hunts long wings held in a shallow V in its low flight during which the bird closely hugs the contours of the land below them. Northern or hen harriers hunt primarily small mammals, as do most harriers. Preferred prey species can include voles, cotton rats and ground squirrels. Up to 95% of the diet is comprised by small mammals.[13] However birds are hunted with some regularity as well, especially by males. Preferred avian prey include passerines of open country (i.e. sparrows, larks, pipits), small shorebirds and the young of waterfowl and galliforms. Supplementing the diet occasionally are amphibians (especially frogs), reptiles and insects (especially orthopterans).[5] Larger prey, such as rabbits and adult ducks are taken sometimes and harriers have been known to subdue these by drowning them underwater.[5] Harriers hunt by surprising prey while flying low to the ground in open areas, as they drift low over fields and moors.[2][7] The Harriers circle an area several times listening and looking for prey.[7] Harriers use hearing regularly to find prey, as they have exceptionally good hearing for diurnal raptors, this being the function of their owl-like facial disc.[5] This harrier tends to be a very vocal bird while it glides over its hunting ground.

Mortality and competition[edit]

Little information is available on longevity in Hen or Northern Harriers. The longest lived known bird is 16 years and 5 months. However, adults rarely live more than 8 years. Early mortality mainly results from predation. Predators of eggs and nestlings include raccoons, skunks, badgers, foxes, crows and ravens, dogs and owls. Fledgings are also predated regularly, especially by great horned owls in North America.[14] Both parents attack potential predators with alarm calls and striking with talons. Short-eared owls are natural enemies of this species that favor the same prey and habitat, as well as having a similarly broad distribution. Occasionally, both harriers and Short-eared Owls will harass each other until the victim drops its prey and it can be stolen, a practice known as kleptoparasitism. Most commonly, the harriers are the aggressors pirating prey from owls.[15]

Status[edit]

This species has a large range, with an estimated global extent 1–20 million km², and a population estimated at 1.3 million individuals. There is evidence of a population decline, but the species is not believed to approach the thresholds for the population decline criterion of the IUCN Red List (i.e., declining more than 30% in ten years or three generations). It is therefore classified as "least concern".[1]

Relationship with humans[edit]

In some parts of Europe people believed that seeing a harrier perched on a house was a sign that three people would die; on a happier note, some Native American tribes believe that seeing a hawk on your wedding day is a sign of a long, happy marriage. Unlike many raptors, hen or northern harriers have historically been favorably regarded by farmers because they eat predators of quail eggs and mice that damage crops. Harriers are sometimes called "good hawks" because they pose no threat to poultry as some hawks do. Heavy pesticide use in the 1970s and 1980s caused a decline in harrier populations.[7]

Problems in the United Kingdom[edit]

In the UK, the hen harrier suffers illegal persecution by gamekeepers and their employers on shooting estates, particularly those managed for Red Grouse shooting, resulting in local and regional extinction in many areas, particularly in England where in 2013 for the first time since the 1960s hen harriers failed to nest successfully[16] despite abundant suitable habitat capable of holding several hundred pairs.[17][18][19] Because of this they are now very rare in many parts of the UK, and under threat in many more areas.[20][21][22]

This problem received a high profile in October 2007 when police investigating the killing of two hen harriers on the Queen's estate at Sandringham in Norfolk interviewed Prince Harry and a friend, William van Cutsem, during their investigation.[23][24] No charges were brought as police were unable to obtain sufficient evidence to prosecute.[18][25][26]

Since the assumed threat to Red Grouse is the main reason for the persecution of this species in the UK, a project funded by Scottish Natural Heritage, the Game & Wildlife Conservation Trust, the RSPB and Natural England was launched at Langholm Moor in Scotland from 2007. The Langholm Moor Demonstration Project (LMDP), a 10-year investigation, costing £3 million, is intended to see whether grouse and raptors can live side-by-side harmoniously.

A similar project, the Joint Raptor Study (also referred to as the 'JRS' or 'the Langholm Study') was run on Langholm from 1992 to 1997. The study made many findings and a host of peer reviewed papers were published on the work, in addition to the final report. Among the most often quoted findings were that long term declines in red grouse populations were "extremely unlikely" to be due to raptor predation and were attributed to habitat degradation/loss, and that raptor predation was the most likely explanation for the failure of grouse stocks to recover at Langholm once the population had fallen to a low level.[27] The project ended in 1997, although a follow up supplementary feeding trial was run by the same team in 1998 and 1999. Grouse shooting on the moor was abandoned for the 1998 season onwards.[28][29]

While the Langholm Project is working on practical solutions, another project is focusing on raising awareness about the plight of hen harriers and inspiring people to care about them. Despite its status as England's most threatened bird of prey, most people have never even heard of a hen harrier. Though once seen, it is rarely forgotten. In October 2011, the RSPB began Skydancer, a four-year project with the aim of protecting and promoting the conservation of hen harriers across their remaining breeding grounds in northern England.[30] Skydancer is funded by the Heritage Lottery Fund and United Utilities, and supported by the Forestry Commission.

Forestry and hen harriers[edit]

The hen harrier is a bird of open habitats such as heather moorland and extensive agriculture. However, much of its range, particularly in Ireland and parts of western Britain, has been (and continues to be) afforested, predominantly with non-native conifers such as Sitka Spruce (Picea sitchensis) from North America (Barton et al. 2006,[31] Fielding et al. 2010[32]). Hen harriers nest and forage in commercial forestry when it is young, before the canopy closes (typically at between 9–12 and years old), but do not make much use of thicket and subsequent growth stages (Madders 2000,[33] O'Donoghue 2004[34]), which typically comprise between two thirds and three quarters of the commercial growth cycle. Where forests replace habitats that were used by hen harriers they will therefore tend to reduce overall habitat availability (O'Flynn, 1983[35]). However, where afforestation takes place in areas that were previously underutilised by hen harriers, it may increase the value of such areas to this species in the long-term (Wilson et al. 2009,[36] Haworth & Fielding 2009[37]). Areas dominated by forestry may remain suitable to hen harriers provided that a mosaic of age classes is maintained within the forest, such that areas of young, pre-thicket forest are always available.

References[edit]

  1. ^ a b BirdLife International (2013). "Circus cyaneus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f del Hoyo, J., Elliott, A., & Sargatal, J., eds. (1994). Handbook of the Birds of the World Vol. 2. Lynx Edicions, Barcelona ISBN 84-87334-15-6.
  3. ^ del Hoyo, J. Elliott, A. and Sargatal, J. Handbook of the Birds of the World Volume 2: New World Vultures to Guineafowl. Lynx Edicions, Barcelona
  4. ^ a b Mullarney, Killian; Svensson, Lars; Zetterstrom, Dan; Grant, Peter (1999). Collins Bird Guide. London: HarperCollins. p. 86. ISBN 0-00-219728-6. 
  5. ^ a b c d e f g Ferguson-Lees, J.; Christie, D. (2001). Raptors of the World. London: Christopher Helm. ISBN 0-7136-8026-1. 
  6. ^ Ferguson-Lees, J., & Christie, D. A. (2001). Raptors of the World. Christopher Helm, London ISBN 0-7136-8026-1.
  7. ^ a b c d e f "Northern Harrier (Circus cyaneus)". Wildlife Fact Sheets. Texas Parks and Wildlife Department. Retrieved 25 June 2012. 
  8. ^ Baicich, P., C. Harrison. (1997). A Guide to the Nests, Eggs, and Nestlings of North American Birds. New York City, New York, USA: Academic Press ISBN 0120728311.
  9. ^ Northern Harrier, Life History, All About Birds – Cornell Lab of Ornithology. Allaboutbirds.org. Retrieved on 2012-08-23.
  10. ^ a b Macwhirter, R., K. Bildstein. (1996). Northern Harrier. The Birds of North America, 210: 1–25.
  11. ^ Scott Weidensaul (1996). Raptors: the birds of prey. Lyons & Burford. ISBN 978-1-55821-275-6. 
  12. ^ Fraser, P. A. et al. (2007). Report on rare birds in Great Britain in 2006. British Birds 100 (12): 707.
  13. ^ Ryser, F. (1985). Birds of the Great Basin: A Natural History. Reno, Las Vegas: University of Nevada Press ISBN 087417080X.
  14. ^ Wheeler, B., W. Clark. (1995). A Photographic Guide to North American Raptors. San Diego: Academic Press Inc ISBN 071366763X.
  15. ^ Short-eared Owl – Asio flammeus – Information, Pictures, Sounds. Owlpages.com (2012-08-12). Retrieved on 2012-08-23.
  16. ^ RSPB News hen harrier on the brink of extinction in England, RSPB news (2013-08-09)
  17. ^ Etheridge, B., Summers, R. W. & Green, R. E. (1997). "The effects of illegal killing and destruction of nests by humans on the population dynamics of the hen harrier Circus cyaneus in Scotland". Journal of Applied Ecology 34 (4): 1081–1105. doi:10.2307/2405296. JSTOR 2405296. 
  18. ^ a b Birdguides: Hen Harrier shooting enquiry to go no further
  19. ^ National Wildlife Crime Unit: Hen Harrier Persecution
  20. ^ Bird of prey persecution. rspb.org.uk
  21. ^ Call for gamekeepers to stamp out wildlife crime[dead link]
  22. ^ Chief Constable reminds wildlife criminals of jail threat[dead link]
  23. ^ UK | England | Norfolk | Rare birds dead on Queen's estate. BBC News (2007-10-25). Retrieved on 2012-08-23.
  24. ^ Prince Harry is questioned over shooting of two rare birds of prey at Sandringham. The Times (2007-10-31)
  25. ^ No charges over alleged hen harrier shooting. Shooting Times (2007-11-06)
  26. ^ http://www.theguardian.com/uk/2007/nov/07/monarchy.wildlife
  27. ^ Redpath and Thirgood (1997) Birds of Prey and Red Grouse. London, Stationery Office.
  28. ^ New Langholm project to balance shooting with raptors. Shooting Times (2007-09-20)
  29. ^ New project to use novel approach in the conservation of raptors on grouse moors. rspb.org.uk (2007-09-20).
  30. ^ RSPB Skydancer Project, RSPB Skydancer Four Year Project October 2011 to 2015
  31. ^ Barton, C., Pollock, C., Norriss, D. W., Nagle, T., Oliver, G. A. & Newton, S. (2006). The second national survey of breeding hen harriers Circus cyaneus in Ireland. Irish Birds 8: 1–20.
  32. ^ Fielding, A., Haworth, P., Whitfield, P. & McLeod, D. (2010). Raptor species conservation frameworks: Hen Harrier framework project final report. Edinburgh: Scottish Natural Heritage.
  33. ^ Madders, M. (2000). "Habitat selection and foraging success of hen harriers (Circus cyaneus) in west Scotland". Bird Study 47: 32. doi:10.1080/00063650009461158. 
  34. ^ O'Donoghue, B. The Hen Harrier in Ireland. Master's Thesis, University College Dublin
  35. ^ O’Flynn, W.J. (1983). Population changes of the hen harrier in Ireland. Irish Birds 2, 337–343.
  36. ^ Wilson, M. W., Irwin, S., Norriss, D. W., Newton, S. F., Collins, K., Kelly, T. C. & O'Halloran, J. (2009). "The importance of pre-thicket conifer plantations for nesting Hen Harriers (Circus cyaneus) in Ireland". Ibis 151 (2): 332. doi:10.1111/j.1474-919X.2009.00918.x. 
  37. ^ Haworth, P. F. & Fielding, A. H. (2009). An assessment of woodland habitat utilisation by breeding hen harriers. SNH Project No. 24069. Edinburgh: Scottish Natural Heritage.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Old World subspecies is Circus cyaneus cyaneus. New World subspecies is C. c. hudsonius (MacWhirter and Bildstein 1996). Circus cyaneus and South American cinereous harrier (C. c. cinereus) constitute a superspecies (AOU 1998).

This species previously was known in North America by the common name "marsh hawk."

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

More info for the term: marsh

northern harrier
marsh hawk
blue hawk
white-rumped harrier
cinereous harrier
frog hawk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The currently accepted scientific name for northern harrier is Circus
cyaneus Linneaus [1]. There are three subspecies of northern harrier,
but only one of these, C. cyaneus ssp. hudsonius (Linnaeus), inhabits
North America [16].
  • 1. American Ornithologists' Union. 2004. The A.O.U. check-list of North American birds, 7th edition, [Online]
  • 16. Johnsgard, Paul A. 1990. Hawks, eagles, and falcons. Washington, DC: Smithsonian Institution Press. 403 p. [21510]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!